ID: 1119762606

View in Genome Browser
Species Human (GRCh38)
Location 14:77162354-77162376
Sequence TAGGCTAGTAAGGAAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119762604_1119762606 -10 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119762606 Original CRISPR TAGGCTAGTAAGGAAGTTGC TGG Intronic
901804027 1:11726486-11726508 TTGGCTCGGAAGGAAGCTGCTGG - Intergenic
904445413 1:30569924-30569946 AAGGTTAGAAAGGCAGTTGCTGG - Intergenic
906816303 1:48883373-48883395 TAGGCAAGGAAGGATGTAGCAGG - Intronic
906850933 1:49250062-49250084 GAGGCCAGTAAGGAAGTTGGAGG + Intronic
909647767 1:77936662-77936684 TAAGCTAGAAGGGATGTTGCAGG - Intronic
924074003 1:240314056-240314078 AAAGCTACTAAGGAAGATGCTGG + Intronic
1064384334 10:14877949-14877971 CACGTTAGTAAGGAAGCTGCAGG - Intergenic
1065257391 10:23884805-23884827 GAAACTAGTAAGCAAGTTGCTGG - Intronic
1067238886 10:44473766-44473788 TTGCCTAGTAGGGAAATTGCTGG - Intergenic
1070106782 10:73440569-73440591 TAGAATAGAAAGGAAGTTACTGG - Intronic
1073554629 10:104436825-104436847 TAGGCTGGTAAGGCAGTCCCTGG + Intronic
1073953245 10:108835846-108835868 TAGGCTATTAAGAAAGTTTTGGG - Intergenic
1077395698 11:2320055-2320077 TAGGCTGGGAAGGAAAGTGCCGG + Intergenic
1077909859 11:6564280-6564302 TAGGCCAGTGAGGAGGGTGCAGG - Intronic
1081441216 11:43083478-43083500 TAGGCTACTAACCATGTTGCTGG - Intergenic
1081678390 11:44984695-44984717 CAGGCTAGTCTGGAACTTGCGGG + Intergenic
1082056410 11:47821068-47821090 TAGTATCCTAAGGAAGTTGCAGG + Intronic
1082839037 11:57673482-57673504 TAAGCTAGGAAGGAAGTGGGAGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1092027057 12:5249883-5249905 TGGGCTAGTAAGGAAGAAGTTGG - Intergenic
1093163247 12:15774335-15774357 TAGGCCTGTATGCAAGTTGCAGG - Intronic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG + Intergenic
1100589263 12:96010192-96010214 TACACTAATAAGGAAGTTTCAGG - Intronic
1102789112 12:115629480-115629502 AAGGCTAGTTAGGAGGCTGCCGG + Intergenic
1109549438 13:63874263-63874285 AAGGCTGGGCAGGAAGTTGCTGG - Intergenic
1114933810 14:27507705-27507727 CAGGCTACTCAGGAAGTTGAGGG - Intergenic
1117507214 14:56415734-56415756 TATGCTTGTAAGGATGTTTCTGG - Intergenic
1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120307979 14:82794946-82794968 TAGGCTAAAAAGCAAATTGCTGG - Intergenic
1121226964 14:92328179-92328201 TAGGCCAGGGAGGAAGATGCTGG - Intronic
1121334885 14:93071152-93071174 CAGGCAGGAAAGGAAGTTGCAGG - Intronic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1125898011 15:43318767-43318789 TAGGCTAGAAAGTAGGATGCTGG + Intergenic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1135196988 16:20402907-20402929 CAGGCTAGAAAGGCAGGTGCCGG - Intronic
1136459952 16:30403916-30403938 TAGTCTAGTAAAGAAGTTTTTGG - Intergenic
1139968679 16:70760308-70760330 TATCCTAGAAAGGAAGTTTCAGG + Intronic
1152367456 17:79864837-79864859 CAGGCTAGCAGGGAAGGTGCAGG - Intergenic
1155729113 18:29130130-29130152 TATTCTAGTTAGGAAGTTGAGGG - Intergenic
1159600605 18:70425314-70425336 TAGGCTAGTCTGAAATTTGCAGG + Intergenic
1159988851 18:74878160-74878182 TAAGCTTGTAAGGAAGTTTTGGG - Intronic
931775167 2:65534137-65534159 TAGACTAGTAAAGAAGTCCCAGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
935041807 2:99437458-99437480 GAGGGTAGTAAGGAAGTATCTGG - Intronic
937505011 2:122527067-122527089 TAGGTTAGTTAGGAAGATACTGG - Intergenic
939100115 2:137886370-137886392 AAGGCTAGTGGGAAAGTTGCAGG + Intergenic
939560911 2:143730545-143730567 TAAGCCACTTAGGAAGTTGCTGG + Intronic
944470276 2:200045620-200045642 TAGCCTATGAAGGCAGTTGCAGG - Intergenic
946093639 2:217252786-217252808 AAGACTAGGAAGGAAGCTGCTGG - Intergenic
946500169 2:220238724-220238746 TGGGTTATTTAGGAAGTTGCTGG + Intergenic
1168874200 20:1159460-1159482 AAGGCTAGAAAGGCAGTTGCAGG - Intronic
1169317910 20:4608722-4608744 TAGCCTGGTGAGGAGGTTGCAGG + Intergenic
1169460498 20:5790229-5790251 TAGGGGAGGAAGGAAGTTTCAGG - Intronic
1169832557 20:9839738-9839760 CTGGCTAGTAAGCCAGTTGCTGG + Intergenic
1171063865 20:21994073-21994095 TAGGTTAGGAAGCAAGTTTCTGG - Intergenic
1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG + Exonic
1178934234 21:36847461-36847483 TAGGATAGTAAATAAGTTGCTGG - Intronic
1182173735 22:28261076-28261098 AAGGCTAGGAAGAAAGTTACAGG - Intronic
1184751384 22:46488373-46488395 TAGGCGAGCAGGGAAGCTGCGGG - Intronic
952636984 3:35544841-35544863 TTGGCCAGTAAGGTTGTTGCAGG + Intergenic
956747971 3:72324380-72324402 GAGGCCAGTTAGGAAGTTGATGG - Intergenic
957889438 3:86336727-86336749 TAAACTAGTAATGATGTTGCTGG - Intergenic
963280643 3:143381738-143381760 TTGGCTAGCTAGCAAGTTGCTGG + Intronic
964327570 3:155563806-155563828 TAGGCTAGGAAGGGAGCTGAGGG - Intronic
969385409 4:6843307-6843329 TAGTCCAGGAAGGAAGTTTCTGG - Intronic
978930886 4:114310378-114310400 TAGACCAGTAAGGAAGTCACTGG - Intergenic
987154052 5:15070077-15070099 AAGGCTGGACAGGAAGTTGCTGG + Intergenic
987617226 5:20291955-20291977 GAGGCTAGGAAGGAAATTACGGG - Intronic
992093861 5:73342436-73342458 CAGACTAGCAAGGAAGTAGCAGG - Intergenic
992692184 5:79251663-79251685 AAGGGTAGGAAGGAAGTTGAGGG - Intronic
992874285 5:81037396-81037418 TAGGATAGCATTGAAGTTGCCGG - Intronic
993231682 5:85245872-85245894 TAGGCTAAGAAGGGAGTTACAGG - Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
1003965787 6:11250888-11250910 AAAGGTAGTAAGGAATTTGCAGG - Intronic
1004071603 6:12303304-12303326 GAGGCTAGACAGGCAGTTGCTGG - Intergenic
1005275825 6:24216342-24216364 TAGGCTGTCAAGGAAGATGCGGG + Intronic
1008781097 6:55106353-55106375 TAGGTTGGCAGGGAAGTTGCTGG - Intergenic
1011650992 6:89506022-89506044 TAGAGTAGGAAGGTAGTTGCGGG + Intronic
1012306637 6:97666888-97666910 TAGGATAGTTAGGAAGATGTAGG - Intergenic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1019101124 6:169631171-169631193 TAGCCTTGTAAAGAAGTTACAGG + Intronic
1024973784 7:55094617-55094639 GAAGTTAGAAAGGAAGTTGCTGG - Intronic
1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG + Intergenic
1050792061 9:9485544-9485566 TAAGCAACTAAGGAAGTTGAAGG - Intronic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057111516 9:92476584-92476606 TATGCTAGGAAGGAGGTTACAGG + Intronic
1188711829 X:33410464-33410486 AAGGTTAATAAGGTAGTTGCAGG + Intergenic
1190627282 X:52348575-52348597 TAGACTAGTAATGAAGTTCCAGG - Intergenic
1192082523 X:68062149-68062171 TAGGATAGCAAGGAAATGGCAGG - Intronic
1198657613 X:138932144-138932166 TAAGCTTTTAAGGACGTTGCTGG - Intronic