ID: 1119762783

View in Genome Browser
Species Human (GRCh38)
Location 14:77164137-77164159
Sequence CAGTAAACTTACAGTAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8566
Summary {0: 1, 1: 5, 2: 519, 3: 3761, 4: 4280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119762783 Original CRISPR CAGTAAACTTACAGTAATGG TGG Intronic
Too many off-targets to display for this crispr