ID: 1119763915

View in Genome Browser
Species Human (GRCh38)
Location 14:77175998-77176020
Sequence CAGGGGTAAGAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 1, 1: 0, 2: 1, 3: 78, 4: 769}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119763909_1119763915 -10 Left 1119763909 14:77175985-77176007 CCCAGTCTGAGGCCAGGGGTAAG 0: 1
1: 0
2: 2
3: 11
4: 178
Right 1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 78
4: 769
1119763902_1119763915 14 Left 1119763902 14:77175961-77175983 CCGGTGGGGTCTTGGTGAGTGGG 0: 1
1: 0
2: 3
3: 35
4: 267
Right 1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 78
4: 769
1119763900_1119763915 17 Left 1119763900 14:77175958-77175980 CCACCGGTGGGGTCTTGGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 78
4: 769
1119763899_1119763915 18 Left 1119763899 14:77175957-77175979 CCCACCGGTGGGGTCTTGGTGAG 0: 1
1: 0
2: 0
3: 20
4: 587
Right 1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 78
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119763915 Original CRISPR CAGGGGTAAGAGAGGGCAGA GGG Intronic
900486474 1:2925065-2925087 CAGCGGAAACAGAGGTCAGAGGG + Intergenic
900972093 1:5997333-5997355 GAAGGGGAAGAGAGGGCAGGAGG + Intronic
901004398 1:6164900-6164922 CAGGGGGAAGAGAGAAAAGACGG + Intronic
902653832 1:17854013-17854035 GAGGAGTAAGACAGGGAAGAGGG + Intergenic
902756063 1:18550051-18550073 CAGGAGCAAGAGAGGGGAGGAGG - Intergenic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
902972646 1:20065425-20065447 CAGGGGTTTGGGAGGACAGAGGG - Intronic
903066359 1:20701839-20701861 TAGGGGCAAGAGAGAGCAGAGGG + Intronic
903140786 1:21338059-21338081 GAGGGATGAGGGAGGGCAGAGGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903587412 1:24426748-24426770 GAGGTGGAAGAGAGGGGAGAAGG - Intronic
903639703 1:24849804-24849826 GAGGGGTCAGGGAGGGCAAAAGG + Intergenic
904173012 1:28605222-28605244 CAAGGGTCAGAGAGGGCAAGAGG - Intronic
904214838 1:28911074-28911096 CAGAAGTCTGAGAGGGCAGATGG + Intronic
904373867 1:30067175-30067197 AAGGAGGAAGAGAGGGCAGGTGG - Intergenic
904457411 1:30655973-30655995 CAGGGGTGACAGAGGAGAGAGGG - Intergenic
904677022 1:32205028-32205050 AGGGGGTGAGAGAGGGCAGGCGG + Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905825964 1:41026383-41026405 CAGGAGGAAGAGAAGGCATAGGG - Intergenic
905869567 1:41395335-41395357 GAGGGCTGAGAGACGGCAGAGGG - Intergenic
906191773 1:43903573-43903595 CAGGGGGAAGAGAGAGGACAGGG + Intronic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
907090597 1:51721231-51721253 CAAGGGAAAGGGAGGGCTGAAGG + Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907501499 1:54884910-54884932 CAGGGCCAACAGATGGCAGAGGG + Intronic
908120148 1:60978746-60978768 TAGAGGTAAGATGGGGCAGAGGG + Intronic
908433153 1:64078730-64078752 CACAGGTAAGAGGGGGCAGAAGG + Intronic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
911235267 1:95405138-95405160 CAGGAGGAAGAGAGAGCAAAAGG - Intergenic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
912579895 1:110711061-110711083 CATGGGTATAAGAAGGCAGAGGG - Intergenic
912735327 1:112145106-112145128 CAGGGGGAGGATGGGGCAGAAGG + Intergenic
912933897 1:113986353-113986375 CAGGGAGAAGCCAGGGCAGAAGG + Intergenic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
913697017 1:121336462-121336484 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
914140542 1:144943582-144943604 GAGAGGGAAGAGAAGGCAGAGGG + Intronic
914438117 1:147678720-147678742 CAGGGGTGAGAGAGAGAAAAGGG + Intergenic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
915144950 1:153791148-153791170 AGGGGCTGAGAGAGGGCAGATGG + Intergenic
915730169 1:158047810-158047832 CATGGGTCAGAGAAGGGAGACGG - Intronic
915937997 1:160100021-160100043 AAGGGGGATGAGAGGGGAGAGGG - Intergenic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916053557 1:161052422-161052444 CAGGGGTAAGTCTGGGGAGATGG - Exonic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916825216 1:168436100-168436122 GAGGAGTAAGATTGGGCAGAAGG - Intergenic
916829114 1:168473342-168473364 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
917136579 1:171793980-171794002 CTGGGGTAGTAGGGGGCAGATGG - Intronic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917235230 1:172884565-172884587 GAGGAGGAAGAGAGGACAGAAGG + Intergenic
917601165 1:176575398-176575420 CAGAGGTAAGACATGGCAGATGG - Intronic
918106416 1:181419199-181419221 CAGGGGGAAGAGGGAGAAGATGG - Intronic
918124833 1:181574124-181574146 CACGGGTAAGTGTGGGGAGAGGG + Intronic
918485994 1:185028583-185028605 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
918490453 1:185075658-185075680 CAGGAGGAAGAGAGAGCAGTGGG + Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
919764418 1:201117005-201117027 CAGAGGTGAGAGGGTGCAGAAGG - Intronic
920484348 1:206354799-206354821 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
920703718 1:208236532-208236554 CAGGGGTTAGAGGGAGCAGCCGG - Intronic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921981908 1:221267966-221267988 CAGGAGCAAGAGAGGGTTGAGGG + Intergenic
921991550 1:221372638-221372660 CAGGTGAAAGGGAGGCCAGAAGG + Intergenic
922128067 1:222748839-222748861 CAGGGGTAAGAGAAGGCTGTCGG + Intronic
922193398 1:223339456-223339478 CAGGGGTGGGACAGGACAGAGGG + Intronic
922470328 1:225873122-225873144 CATGGGGAAGAGAGGACAGAAGG + Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923415631 1:233757185-233757207 CAGGTTTCAGAGAGAGCAGATGG - Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
924306143 1:242691065-242691087 GAGGGGAGAGAGAGAGCAGAGGG - Intergenic
924369890 1:243336552-243336574 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
1063167510 10:3477178-3477200 CATGGGTAGAATAGGGCAGATGG + Intergenic
1063309545 10:4939341-4939363 CAGGGGAAAGACACAGCAGAAGG + Intronic
1065804699 10:29383681-29383703 AAGGGGAAAGAGCGGGCAGGAGG + Intergenic
1065939771 10:30553775-30553797 AAGGGGGAAGAGTGGGCAGGAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067016933 10:42764242-42764264 CAGGAGGAAGAGAGAGCAAAAGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG + Intergenic
1069894487 10:71672144-71672166 TGGGGGTCAGGGAGGGCAGAAGG + Intronic
1070001487 10:72381285-72381307 CAAGGTTAAGTGAGGGGAGATGG + Intronic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070525173 10:77290020-77290042 CAGGGGTTAGAGATGGAAGGAGG + Intronic
1070731269 10:78830157-78830179 GAGAGCTTAGAGAGGGCAGAAGG - Intergenic
1070923941 10:80205696-80205718 CAGGGGTTAGGGGCGGCAGAGGG - Intergenic
1071222869 10:83490269-83490291 CATGGGGAAAAGAGTGCAGAAGG - Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071681379 10:87709246-87709268 CAGGAATAAGAGAGGGCAAGTGG + Exonic
1071796898 10:89017730-89017752 TAGGGCTCAGCGAGGGCAGAAGG - Intergenic
1071863772 10:89703221-89703243 CATGGGTAAGGGGGTGCAGAGGG - Intronic
1072625274 10:97107378-97107400 CCGGGGTAAGGCAGGGCAGCTGG + Intronic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073156815 10:101354062-101354084 GAGAGGTAAGAGAGGGCGGGGGG + Exonic
1073215292 10:101832853-101832875 AAGGGGGAAGAGAGGGCATCTGG - Intronic
1073448825 10:103597384-103597406 CTGGGGTGAGAGAGGGCTGCTGG + Exonic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073847307 10:107571831-107571853 CAGGGGTAAGGGTGGGAAGGGGG + Intergenic
1074156275 10:110802666-110802688 CATGGGTTAAAGAGGTCAGATGG + Intronic
1074702062 10:116101142-116101164 CAGGGGAAAGTGTGTGCAGAAGG - Intronic
1074781767 10:116807361-116807383 CAGGGGTAAGAGGGGAAAGCAGG - Intergenic
1074946875 10:118288498-118288520 TAGGGGTAGGAAAGGGTAGAAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1075960245 10:126562269-126562291 AGGGGGTAAGGGAGGGCAGGGGG - Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076324240 10:129609028-129609050 CAGCAGTAAGAGAGGAGAGAAGG - Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076870467 10:133190468-133190490 CAGGGGGAGGAGACGGCAGCCGG + Intronic
1077548069 11:3185083-3185105 CAGGAGGAAGAGAGGCCAGAGGG + Intergenic
1077843810 11:6002873-6002895 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1077846240 11:6027573-6027595 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1077944530 11:6880733-6880755 CAGAGGTTAGAGAAGACAGAAGG + Intergenic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1078434477 11:11313102-11313124 GAGGGATAAGAAAGGGGAGAAGG + Intronic
1078441563 11:11372633-11372655 CAGGGGCAGGGGAGAGCAGAAGG + Intronic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078724490 11:13917462-13917484 AAGGGGAAAGAGTGGGCAGTAGG + Intergenic
1078893737 11:15579949-15579971 CATGAGCAAGAGAGGGCAGTTGG + Intergenic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1079609870 11:22418945-22418967 CAGGGGTTGGAGAGGGGAAATGG - Intergenic
1080642805 11:34167539-34167561 CCTGGGCAAAAGAGGGCAGATGG + Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080808977 11:35683398-35683420 GAGAGGCAAGAGAGGTCAGAGGG + Intronic
1081362623 11:42199126-42199148 AAGGAGTAACAGTGGGCAGAGGG + Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082829110 11:57602239-57602261 CTGGGGAAAGAAAGGACAGAGGG + Intronic
1083196144 11:61089714-61089736 CACGGGAAAGATAGGGCAAAGGG - Intergenic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1083826158 11:65205209-65205231 CAGGGGAAAGATAGGGGATAGGG + Intronic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084152951 11:67299723-67299745 CTGGGGGAAGAGGGGTCAGACGG - Intronic
1084209516 11:67614576-67614598 GAGGTGGAAGAGAGGACAGATGG - Intergenic
1084275376 11:68048720-68048742 GAGGGGCAACAGAGCGCAGATGG - Intronic
1084617673 11:70247244-70247266 CAGGAGAGAGAGAGGGCAAAGGG + Intergenic
1085266507 11:75240857-75240879 CGGGGGCAAGAGGGGTCAGACGG - Intergenic
1085352879 11:75811625-75811647 CAAGAGCAAGATAGGGCAGATGG - Intergenic
1085770369 11:79320124-79320146 CAGGAGTCAGAGGGTGCAGAAGG - Intronic
1085793485 11:79516426-79516448 CATGGGTGGGAGAAGGCAGAGGG - Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088950189 11:114560781-114560803 CAGGGGTTAGAGGGGAAAGAAGG - Intergenic
1089356456 11:117857077-117857099 CAGGGACATGAGAGGGCAGGAGG + Intronic
1089584823 11:119503561-119503583 CAGGAGCAAGAGAGGAGAGAGGG - Intergenic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1090098717 11:123771336-123771358 CAGGAGGAAGAGAGCGCATAAGG + Intergenic
1090187121 11:124746055-124746077 GAGGGGTGAGGGTGGGCAGAGGG - Intronic
1090687058 11:129133132-129133154 CAGGGGGAAGAGTGAGCAGGAGG + Intronic
1090805650 11:130200442-130200464 CAGGAGCAAGAGAGAGCAGGAGG + Intronic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1090958707 11:131536947-131536969 CAGGTGTAACACTGGGCAGAGGG - Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092049130 12:5455507-5455529 GAGGGGTTACAGAGGCCAGATGG - Intronic
1092240607 12:6833898-6833920 CAGGGAAAAGACAGAGCAGAGGG - Intronic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1092458065 12:8662391-8662413 CAGGGGTGAAAGAGGCCAAAGGG - Intronic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1093919192 12:24840341-24840363 TGGGGGTAAGAGTGGGCAGATGG + Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1096247080 12:49997205-49997227 CTGGGATAAAACAGGGCAGAAGG + Intronic
1096548320 12:52356357-52356379 CAGGGGTGAAGGAGGGCAGCCGG + Intergenic
1096835327 12:54346929-54346951 CACGGGTAACAGAGAACAGAGGG - Intronic
1097831782 12:64232610-64232632 CAGGGGCAGGATTGGGCAGAGGG - Intergenic
1098621024 12:72598874-72598896 GAGGGGTAAGGGAGGGACGAAGG - Intronic
1098772759 12:74575358-74575380 CAGGAGAAAGAGAGAGCAAAAGG - Intergenic
1100553151 12:95666269-95666291 CAGGGGGAAGAGAGGGGATAAGG + Intronic
1100974337 12:100106607-100106629 TAGGGGTAGGAGAGGGATGAGGG + Intronic
1101719652 12:107340467-107340489 AAGGGGGAAGAGATGGGAGAAGG - Intronic
1101754819 12:107613235-107613257 AAGTGGAAAGAGAGGGCTGATGG - Intronic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1102074363 12:110048254-110048276 CAGGGGATAGAGTGGGGAGATGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102542237 12:113629671-113629693 CAAGGGTCAGAGAGTGCATATGG + Intergenic
1102551250 12:113693769-113693791 CAGAGGTCAGACAGGGCTGATGG + Intergenic
1102595547 12:113989723-113989745 CTGGAGTGAGAGAGGGTAGATGG + Intergenic
1102723375 12:115036848-115036870 CAGGAGAAAGAGAGAGCAAAGGG + Intergenic
1102867175 12:116383513-116383535 AGGGTGTAGGAGAGGGCAGAGGG + Intergenic
1103123844 12:118403823-118403845 CAGAGGTAAGAGGGGTCAGAGGG - Intronic
1103239781 12:119403590-119403612 CAGGGGGAAGATGGGGCTGAGGG - Intronic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1104581149 12:130011724-130011746 CAGGAGGAAGAGAGAGCAGGAGG + Intergenic
1104860981 12:131923374-131923396 CAGGGTGAAGAGAGTCCAGAGGG + Intergenic
1105073744 12:133255977-133255999 CAGGAGGAAGAGAGAGCAAAGGG + Intergenic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1105810101 13:23987762-23987784 CAGGGGTTGGAGAGGGGAGTGGG - Intronic
1106583346 13:31036384-31036406 GAGGAGGAAGAGAGGGCAGTGGG - Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107445260 13:40465068-40465090 CAGGGCTAGCACAGGGCAGAGGG - Intergenic
1107568351 13:41629893-41629915 GAGGGATTAAAGAGGGCAGAGGG - Intronic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1108472156 13:50778200-50778222 CAGGGGAGAGAGAGAGCAAAGGG + Intronic
1109491189 13:63101659-63101681 CAAGGGTAAGAGAGAGAAGCGGG - Intergenic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1109992872 13:70082061-70082083 CAGGAGGAAGAGAGAGCAAAGGG - Intronic
1109996776 13:70137963-70137985 CAGGGGATAGAGAGAGCAAAGGG + Intergenic
1110549745 13:76798874-76798896 GAGGAGTAAGAGGGAGCAGAGGG + Intergenic
1111413396 13:87907341-87907363 CAGGAAAAAGAGAGGGCAAAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112322171 13:98417612-98417634 CAGGGGTAAGAGATGTGAGAAGG + Intronic
1112483749 13:99801043-99801065 AGGGTGTAAGTGAGGGCAGAAGG + Intronic
1112514433 13:100039836-100039858 AAGGGGCAGGAGAGTGCAGAGGG + Intergenic
1113332248 13:109341237-109341259 CAGGGCTGAGAGATGACAGAAGG - Intergenic
1113535764 13:111065097-111065119 CATGGGTAAGAGAAGGCCCATGG + Intergenic
1113838350 13:113344296-113344318 AAGGGCTAAGAGACGGCAAAAGG + Intronic
1114068308 14:19085848-19085870 CAGGAGGAAGAGAGAGCAAAAGG - Intergenic
1114093956 14:19314177-19314199 CAGGAGGAAGAGAGAGCAAAAGG + Intergenic
1114536203 14:23424595-23424617 CAGGAGGAGGAAAGGGCAGAGGG - Intronic
1114730856 14:24991098-24991120 GAGGGGGAAGAGAGAGGAGAAGG + Intronic
1115692191 14:35856215-35856237 CAGGGGCAAGAGGCAGCAGATGG + Intronic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1116153098 14:41167164-41167186 CAGGGGAAAGGGAGGGGAAAGGG - Intergenic
1116430083 14:44836127-44836149 CCGGGGTGGGGGAGGGCAGAGGG - Intergenic
1116442703 14:44972008-44972030 AAGGAGGAAGAGAGGGCAGGAGG + Intronic
1117073126 14:52074102-52074124 TATGGGTAAGACTGGGCAGAGGG - Intergenic
1117493240 14:56273687-56273709 CAGTGGCAAGAGAGGGCTCAGGG + Intronic
1117656920 14:57964783-57964805 CATTGGTGAGAGGGGGCAGAGGG + Intronic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1118035582 14:61862775-61862797 CAGGGGTTAGAAAGGGTAGAAGG - Intergenic
1118485207 14:66208102-66208124 GAGGGGCTGGAGAGGGCAGAAGG - Intergenic
1118740710 14:68737483-68737505 CAGAGGTGAGAGAGGGCATCAGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118908684 14:70043259-70043281 CAAGGGTGAGAGAGGCCAGGTGG + Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120757820 14:88260277-88260299 CAGGAGGAAGAGAGAGCAAAGGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1121880504 14:97496485-97496507 GAGGGGTGAGAGATGGCAGGAGG + Intergenic
1122034085 14:98935004-98935026 CAAGGGGAGGACAGGGCAGAGGG + Intergenic
1122324784 14:100875626-100875648 GAGGGGTGAGAAAGGGAAGATGG - Intergenic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1202918721 14_KI270723v1_random:10807-10829 CAGAGGTTAGTGATGGCAGAAGG + Intergenic
1202925903 14_KI270724v1_random:23763-23785 CAGAGGTTAGTGATGGCAGAAGG - Intergenic
1123449636 15:20351699-20351721 CAGGGGAAAGAGAGAGCATGGGG + Intergenic
1124091385 15:26605984-26606006 CATGGGGAAGAGAGAGCAAATGG + Intronic
1124246361 15:28073853-28073875 CAGGGGTTAAAGATGGCAGGGGG + Intronic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1124867188 15:33503993-33504015 CTGGGATAAGAGAGGGGAGTAGG - Intronic
1125205675 15:37151368-37151390 CAGAAGTAAGAGAGGCCAGGTGG + Intergenic
1125697507 15:41651679-41651701 AAGGGGTAAGAGAGGGGAAAGGG - Intronic
1125697512 15:41651696-41651718 AAGGGGTAAGAGAGGGGAAGGGG - Intronic
1125711335 15:41789380-41789402 GAAGAGAAAGAGAGGGCAGAAGG + Intronic
1125878989 15:43175936-43175958 AAGGGGTAACAGAGGGCACCTGG + Intronic
1126644029 15:50856998-50857020 CTGGGGAAAGAAAGAGCAGAGGG + Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128524304 15:68402085-68402107 CAGGGGCCAGAGTGGGAAGAGGG + Intronic
1128656656 15:69467670-69467692 CAGGGGCCAGAGAGGTCAGGGGG - Intergenic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1128748941 15:70134773-70134795 CAGGGGTAAGCCAGGGCAAGTGG - Intergenic
1129618899 15:77124665-77124687 CTATGGTAAGAGAGGTCAGAAGG - Intronic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1130428692 15:83824639-83824661 CAGGGGTTAGCGAGGAGAGAGGG - Intronic
1131062532 15:89412720-89412742 CAAGGGGATGAGAGGGCTGAGGG + Intergenic
1131233179 15:90674186-90674208 GAGGGGTTAGTGATGGCAGAGGG + Intergenic
1131467644 15:92668231-92668253 GAGGGGACAGAGAGGTCAGAGGG - Intronic
1131768879 15:95712843-95712865 AAGGGGAGAGAGAGGGCACAGGG - Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132651776 16:1024432-1024454 GAGGGGACAGCGAGGGCAGATGG + Intergenic
1132863959 16:2084632-2084654 CAGGGGCAAGAGAGTAGAGAGGG + Exonic
1133301121 16:4783603-4783625 CTGGGGTCAGCGGGGGCAGAGGG - Intronic
1133513707 16:6485332-6485354 GAGGGGTAAGAGAGGGAGGGAGG - Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1134297580 16:12960814-12960836 CAGGGCTGAGATAGGGAAGAAGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1135245128 16:20849498-20849520 AAGGGGTAAGAAATGGCACATGG - Exonic
1135505134 16:23029860-23029882 GAGGGATAGGAGAGGTCAGAGGG - Intergenic
1136533026 16:30882576-30882598 AAGGGGTGAGAGATGGCAGCAGG + Intronic
1136534060 16:30888842-30888864 CTGAGGTGAGAGAGGCCAGAAGG - Exonic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138150183 16:54649685-54649707 CAGAGGAAAAAGGGGGCAGATGG + Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138380018 16:56593627-56593649 CAGGAGAGAGAGAGGACAGAGGG - Intergenic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138553108 16:57757815-57757837 CAGGGCAAAGAGTGGGCAGTGGG + Intergenic
1138606671 16:58094271-58094293 CAGGGGTGAGAGGAGGGAGAGGG - Intergenic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG + Intronic
1140217430 16:73019725-73019747 GAGGGGTGAGAGAGCGGAGAAGG - Intronic
1140670634 16:77274947-77274969 CTAGGGTTGGAGAGGGCAGAAGG - Intronic
1140712378 16:77690525-77690547 CAGGAGGAAGAGACAGCAGAGGG + Intergenic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1140981208 16:80111571-80111593 ATGGGGTAGAAGAGGGCAGAGGG - Intergenic
1141010134 16:80389267-80389289 CAGGGGAGAGAGTGAGCAGAGGG + Intergenic
1141170258 16:81686487-81686509 GAGCGGTATGTGAGGGCAGAGGG - Intronic
1141382562 16:83589241-83589263 AAGGGGAAAGAGAGAGAAGAGGG - Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141704253 16:85655943-85655965 CAAGGGACAGGGAGGGCAGAGGG - Intronic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142480474 17:215613-215635 CGGGGGCAGGAGAGGGGAGAAGG + Intronic
1143892373 17:10112369-10112391 CAGGAGCAAGGTAGGGCAGATGG + Intronic
1144420918 17:15097818-15097840 GAGGGGGAAGAGGGGGCTGATGG - Intergenic
1144813242 17:18015519-18015541 CAGGAACAAGAGAAGGCAGAAGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146334772 17:31960101-31960123 TAGCTGCAAGAGAGGGCAGAGGG + Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146590106 17:34121429-34121451 AATGGGTCAGAGAAGGCAGATGG - Intronic
1146890506 17:36503561-36503583 GTGGGGTCAGAGAGGTCAGAGGG - Intronic
1147169204 17:38608412-38608434 TTTGGGGAAGAGAGGGCAGAAGG - Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147918323 17:43901425-43901447 CAGGGAAAAGTGTGGGCAGAAGG + Intronic
1148083005 17:44977773-44977795 CAGGGGTAGGAGTGAGCAGAGGG - Intergenic
1148128892 17:45250864-45250886 CAGGAAGGAGAGAGGGCAGAGGG + Intergenic
1148612200 17:48971937-48971959 GAGGGGTCAGAGAGGACACAGGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149107254 17:52984379-52984401 AAAGGGTCAGAGCGGGCAGAAGG - Intergenic
1149216372 17:54358952-54358974 CAGGGTTAAGAGAGGCCAAATGG - Intergenic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1150293555 17:63995855-63995877 CACAGGTAAGACAGGCCAGAAGG - Intergenic
1150564445 17:66326336-66326358 TACGGGTGAGTGAGGGCAGAGGG - Intronic
1150862139 17:68811640-68811662 CAGGAGGAAGAGAGAGCAGGAGG - Intergenic
1150864590 17:68836297-68836319 CAGAGGTATGGGAGGGTAGAGGG + Intergenic
1151095424 17:71492175-71492197 CTGAGGTAAGAGAGGAGAGAAGG + Intergenic
1151304677 17:73255606-73255628 CAGGGCTCAGAGAGGGGAAAAGG + Intronic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1151964141 17:77422525-77422547 CTGGGGTAAGAGCGGGCTGGGGG + Intronic
1152418092 17:80175896-80175918 CAGGGATGAGAGAGGGAAGCAGG + Intronic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1153380654 18:4435489-4435511 AAGGGGGAAGAGAGGGGAAACGG + Intronic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1154071593 18:11157377-11157399 CAGGAGTAAGAAAGGGCATGAGG + Intergenic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154220346 18:12447512-12447534 GTGGGGTAAGAAAGGGCACATGG - Exonic
1155390532 18:25330873-25330895 CAGGGGAAAGAGATGACACAAGG + Intronic
1155571409 18:27197751-27197773 CAGGGGTGAGAGAGAGAACATGG + Intergenic
1155812735 18:30258918-30258940 CAGGAGGAAGAGAGAGCAAAGGG - Intergenic
1155980502 18:32174838-32174860 GAGGGCTTAGAGAGGGCAGCGGG + Intronic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1157324177 18:46657206-46657228 CAGGAGCCAGAGAAGGCAGAGGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158454533 18:57594407-57594429 CAGGGGTCAGAGAGCGCCTATGG + Intergenic
1158493148 18:57928557-57928579 GATGGGGAAGAGAGGGGAGATGG - Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159030849 18:63229580-63229602 AAGGAGTAAGAGAGAGGAGACGG - Intronic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1160772472 19:839162-839184 AAGGGCTGAGGGAGGGCAGAGGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161433661 19:4249162-4249184 CAGGGGCAGGACATGGCAGAGGG - Intronic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162187927 19:8921843-8921865 CAGGGGGAAGAGGGGACAGGGGG - Intronic
1162924993 19:13926431-13926453 CTGGGGGAAGAGAAGGCAGGCGG + Intronic
1163434218 19:17285607-17285629 CAGGGTTCAGCGAGGGCAGTCGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1164250390 19:23470522-23470544 GCTGGGAAAGAGAGGGCAGAAGG - Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166386047 19:42381932-42381954 CAGGGAGAAGTGACGGCAGAGGG - Intergenic
1166412718 19:42567080-42567102 CTGGGGTAAAAGAGGGGATAGGG - Intergenic
1166560287 19:43728314-43728336 CAGGAGCAAGAGGGGGCAGGTGG - Exonic
1166768285 19:45265353-45265375 GATGGGCAAGAGAGGGCTGAGGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1167572574 19:50298280-50298302 CAGGTGAAAGAGGGGGCAGGAGG + Intronic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
925080443 2:1059216-1059238 CAGCTCTAAGAGATGGCAGAAGG - Intronic
925221303 2:2143640-2143662 CAGGTGTTAGAGGGGACAGAAGG + Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925827940 2:7868644-7868666 CATGGGAAAGAGAGGACAAATGG - Intergenic
925886538 2:8397954-8397976 CACAGGTAAGAGAGAGCTGAGGG - Intergenic
926087332 2:10028672-10028694 GAGGGGAAAGGGAGGGGAGAAGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926342523 2:11915601-11915623 CATGGATTAGAGAGGCCAGAAGG - Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
928838757 2:35579812-35579834 GAGGGGTAAGAGAGAGGAGTTGG + Intergenic
928843804 2:35644412-35644434 CAGAGGTAGGATTGGGCAGATGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
930601577 2:53450063-53450085 CAGGGCTAAGTGAAGGCATATGG - Intergenic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
930745586 2:54880164-54880186 CTGGGGTAAGGGAGGACAGGTGG - Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933455889 2:82518503-82518525 CAGGAGGAAGAGAGAGCAAAGGG + Intergenic
933816684 2:86074258-86074280 CATGGGTATGGGTGGGCAGAGGG + Intronic
935092150 2:99905429-99905451 CAAGAGGAAGGGAGGGCAGAGGG - Intronic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
936403657 2:112184271-112184293 ACGGGAGAAGAGAGGGCAGAGGG + Intronic
936518423 2:113197084-113197106 TAGGGGGAAAAGAGGGCAGGTGG + Intronic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937610080 2:123850584-123850606 CAGTAGGAAGAGAGGGCAAAGGG - Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
940268912 2:151870352-151870374 GAGAGGAAAGAAAGGGCAGAGGG + Intronic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
941168031 2:162104346-162104368 CAGGGGAAAGAGAGGGCACCAGG + Intergenic
941195373 2:162444184-162444206 GAGGGGTAGGGGATGGCAGAGGG - Intronic
941667373 2:168255863-168255885 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
941728827 2:168893054-168893076 CAGGAGCAAGAGAGGTCAGGAGG + Intronic
941989533 2:171541440-171541462 CAGGGGTAACATGGGGAAGAGGG + Intronic
942227112 2:173826750-173826772 CAAGGGTAAGATTAGGCAGATGG + Intergenic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943142074 2:183995350-183995372 CTGGCTTAAGAGAGGACAGATGG - Intergenic
943184547 2:184590405-184590427 AAGGGGTAAGGGAGGGAAAAAGG - Intergenic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
945124281 2:206491146-206491168 CAGGGGTAGGGGCAGGCAGAGGG - Intronic
946026566 2:216675247-216675269 CTGAAGTAAGAGATGGCAGAGGG - Exonic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
946435226 2:219647230-219647252 CAGGGGTAAGAGAGAGAGGGGGG - Intergenic
946516736 2:220420032-220420054 CATGGGGAAGGGAGAGCAGAGGG + Intergenic
946633413 2:221697174-221697196 AAGGTGTATGGGAGGGCAGAGGG + Intergenic
947074250 2:226324832-226324854 AAGAGGTCAGAGAGGACAGAGGG + Intergenic
947126472 2:226874017-226874039 CAGGTGTAAGAGAGAGCACAGGG + Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948460253 2:238125611-238125633 CAGGGGTAAAAGCGGGGAGACGG + Intronic
948494316 2:238337029-238337051 CAGGGTGGAGAGGGGGCAGAGGG + Intronic
948751815 2:240137464-240137486 AAGGGGTAAGAGGAGGGAGAAGG + Intergenic
948910488 2:240999967-240999989 CGAGGGTATGAGAGGGCTGATGG - Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
1169041747 20:2501066-2501088 AAGGGGTGAGAGAGGGCACCTGG + Intronic
1169340947 20:4795797-4795819 CAGGGGTGAGTGAGGAGAGACGG - Exonic
1169638356 20:7720362-7720384 AAGGGTTAAGAAAGGGCAGCAGG + Intergenic
1169771446 20:9205773-9205795 CAGGGGTTAGAGAGGAGAGAAGG - Intronic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1169963619 20:11190941-11190963 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
1170032688 20:11959300-11959322 GAGGGGGAAGAGAGAGAAGACGG + Intergenic
1170323522 20:15129677-15129699 CAGTCGTAAGAGAGAGCAAAGGG - Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1171250645 20:23643868-23643890 TAGGGGTAAGGCAGGGCAGCTGG - Intergenic
1171490540 20:25513754-25513776 AAGGAGGAAGAGAGAGCAGAGGG - Intronic
1171782701 20:29435503-29435525 CAGAGGTTAGAGATGGCAGAAGG + Intergenic
1172080588 20:32337760-32337782 CAGGGGAAATACAGGACAGACGG + Intergenic
1172127293 20:32632229-32632251 CAGGAGTGGGAGAGGGGAGAAGG + Intergenic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172719515 20:36988866-36988888 CAGGAGGAAGAGAGAGCAGGGGG - Intergenic
1173007942 20:39155484-39155506 CAGGGGTAGGAGATGACTGATGG + Intergenic
1173039413 20:39447126-39447148 CAGGGGTAAGACACGGAATATGG + Intergenic
1173517309 20:43673908-43673930 CATGGGGAAGAGAGGGTTGATGG + Intronic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173718905 20:45236111-45236133 CAGGCGGAAGTGAGGGCAGCGGG + Intergenic
1173845558 20:46186358-46186380 CAAGGATAAGAAATGGCAGATGG - Intronic
1175708238 20:61197285-61197307 CTGGGGAGAGAGAGTGCAGAGGG - Intergenic
1175943384 20:62548038-62548060 GAAGGGGAAGAGAGGGGAGAAGG - Intergenic
1175962741 20:62645399-62645421 CAGGGGCCAGAGAAGGCAGCAGG - Intronic
1176099734 20:63359470-63359492 CAGGGGTCTGGGTGGGCAGAGGG - Intronic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1178062842 21:28871351-28871373 CAGGAGGAAGAGAGCGAAGAGGG + Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179903498 21:44406998-44407020 CAGAGGTCAGAGTGGGCCGAGGG + Intronic
1180057580 21:45366914-45366936 GTGGGGTGAGAGAGAGCAGAAGG + Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180486780 22:15808410-15808432 CAGGAGGAAGAGAGAGCAAAAGG - Intergenic
1181019959 22:20094547-20094569 CAGGGTCAGGAGAGGACAGAAGG - Intronic
1181053180 22:20247183-20247205 CTGGGGTAAGAGGCTGCAGAGGG + Intronic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181236639 22:21451062-21451084 CCGGGGTGGGAGAGGGCAGAGGG - Exonic
1181319120 22:21991160-21991182 CAGAAGTCAGAGAGGGCAGCTGG - Intergenic
1181487628 22:23241543-23241565 AAGGGGCAAGACAGGGAAGATGG - Intronic
1181541061 22:23573601-23573623 AGGGGGTGAGAGATGGCAGAGGG + Intronic
1181550962 22:23638958-23638980 AGGGGGTGAGAGATGGCAGAGGG + Intergenic
1181797320 22:25319729-25319751 AGGGGGTGAGAGATGGCAGAGGG - Intergenic
1181996083 22:26883842-26883864 CAGGGGCCAGAGAGGGGAGGCGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182415853 22:30221108-30221130 GAGGGCAAAGGGAGGGCAGACGG + Intergenic
1182495736 22:30706062-30706084 AAGGGGAAAGAGAGGGGAAATGG + Intronic
1184207735 22:43015463-43015485 CAGGGGTAAGAGGGCGCGGCAGG + Intergenic
1184421437 22:44384868-44384890 GAGGGGCAGGAGAGGGGAGATGG + Intergenic
1184711094 22:46250015-46250037 CTGGGGCGAGAGAGGGCAGGCGG - Intronic
1184842190 22:47058557-47058579 CAAGCAGAAGAGAGGGCAGAGGG - Intronic
1184920363 22:47601236-47601258 GAGGGGCAAGAGAGTGCACAGGG - Intergenic
1185160859 22:49228962-49228984 CAGGGCTAGGAGTGGTCAGAAGG - Intergenic
1185197135 22:49478697-49478719 CAGGAGGAAGAGAGGGGAGGGGG + Intronic
1185213550 22:49585841-49585863 CAGGGGTGAGAGGGAGCAGCAGG + Intronic
949398674 3:3642364-3642386 CAGGGCCCAGAGATGGCAGAGGG + Intergenic
949830902 3:8213058-8213080 CAGGAGAAAGAGAGGACACAGGG - Intergenic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
949945755 3:9188575-9188597 CAGGGCTAGGAGAGCTCAGATGG + Intronic
949964054 3:9340291-9340313 GAGGGGGAAGAGAGCACAGAGGG - Intronic
950525550 3:13520800-13520822 CAGGGGGCAGAGAAGGCTGAGGG + Intergenic
951327690 3:21324890-21324912 GAGGGGCAAGAGAGGGCAATGGG + Intergenic
951467463 3:23017707-23017729 TAGGGGTAGGGGAGGGGAGAGGG + Intergenic
951928456 3:27936446-27936468 CAGGAGGAAGAGAGAGCAAAGGG - Intergenic
952221251 3:31326429-31326451 CAGGAGGAAGAGAGAGCAGAGGG + Intergenic
952357801 3:32600861-32600883 AAGAGGAAAGATAGGGCAGAGGG + Intergenic
952361589 3:32635689-32635711 AAGATGTAAAAGAGGGCAGACGG - Intergenic
952571655 3:34725073-34725095 CAGGGGTGAAAGATGGGAGATGG - Intergenic
952632718 3:35488992-35489014 CATGGGTAAGAAAGGGCAGATGG + Intergenic
953623363 3:44551282-44551304 CAGGGGAGAGAGAGAGCAAAGGG + Intergenic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
954213794 3:49112954-49112976 TAGGGGTAAGAGTGGGGAGGAGG - Intronic
954367410 3:50154056-50154078 GAGGGAGAAGAGAGGGGAGAAGG + Intergenic
954456018 3:50600315-50600337 CTGGGGTAAGTGGGGGGAGAGGG - Intergenic
954710018 3:52501032-52501054 CAGGGGTCAGAGTAAGCAGAGGG - Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
955843370 3:63135739-63135761 CAGGGACAAAAGAGGGTAGAGGG + Intergenic
956633243 3:71336865-71336887 CAGGAGATAGAGAAGGCAGAGGG + Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957082776 3:75650831-75650853 CAGAGGTTAGTGATGGCAGAAGG - Intergenic
957114161 3:76003191-76003213 CAGGATTAAGAGAGGGCATAGGG - Intronic
957683423 3:83469681-83469703 GAGGGGGAAGAGAGGAGAGATGG + Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
957868234 3:86051733-86051755 CAGGAGGAAGAGAGAGCCGAGGG + Intronic
959579098 3:107965900-107965922 GAGGGGTAAGAGAGTGAAGAGGG + Intergenic
960196664 3:114776839-114776861 CAGGGCAAAGAGAGTGCACAAGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960997458 3:123349485-123349507 CAGGCGTCAGGGAGGGCAGAGGG - Intronic
961703815 3:128768078-128768100 GAGGGGTAAGGAAGGGCAGTAGG - Intronic
961718966 3:128879539-128879561 CAGGGGATGGAGAGGCCAGAAGG - Intronic
961985290 3:131125555-131125577 CAACTGTAAGAGATGGCAGAAGG - Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962070464 3:132028510-132028532 AAGGGGTAAGAGATGGGGGAAGG + Intronic
962265231 3:133939841-133939863 AAGGAGAAAGAGAGGTCAGAAGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
963561598 3:146873296-146873318 CAGGAGGAAGAGAGAGCAAAGGG - Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964808174 3:160634438-160634460 CAGGGGGATGTCAGGGCAGAGGG - Intergenic
965369818 3:167847998-167848020 GAGGGTTAGGAGAGGGGAGATGG - Intergenic
965908457 3:173740522-173740544 CAGGGGTATGGGAGGGCATGAGG - Intronic
966262745 3:178000166-178000188 CAGGAGTAAGAGAGTGAAGGGGG - Intergenic
966491070 3:180529388-180529410 CAGGAGAAAGAGAGTGCAAAGGG + Intergenic
967430177 3:189374658-189374680 CAGGAGGATGAGAGGGCAGCTGG - Intergenic
967441460 3:189513826-189513848 AAGGGATAAAACAGGGCAGAAGG + Intergenic
967663551 3:192143973-192143995 AAGGGATGAGAGAGGGAAGAAGG + Exonic
968591960 4:1463912-1463934 CCGAGGTAGGAGGGGGCAGAAGG - Intergenic
969163378 4:5281093-5281115 CAGGAGAGAGAGAGGGCAAAGGG + Intronic
969201247 4:5608109-5608131 AAGGGGAAAGAGAGGCCAGGAGG - Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
969956248 4:10894008-10894030 CAGGGGTATGCAAGGGCAGTGGG - Intergenic
969956570 4:10897226-10897248 CAGGCATCAGAGAGGCCAGAAGG + Intergenic
970369620 4:15393961-15393983 AAGGGGGAAGTAAGGGCAGAGGG + Intronic
970454109 4:16204835-16204857 CAGTGGTGAGTGAGGCCAGAAGG - Intronic
970709591 4:18846317-18846339 CAAGGGTAAGAGTAGGAAGATGG + Intergenic
972661757 4:41123079-41123101 CTGGGGCAAGAGAGGGCTGCTGG - Intronic
972688523 4:41373931-41373953 CAGGAGGAAGAGAGAGCAGGGGG - Intronic
972945203 4:44245217-44245239 TTGGGGTAAGAGAGGGAATAGGG + Intronic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
973811492 4:54574736-54574758 CAGGAGGAAGAGAGAGCAAAGGG - Intergenic
973889749 4:55357138-55357160 CAGGGGACAGAGGGTGCAGAGGG - Intronic
974874424 4:67685775-67685797 CAAGAGTAAGAGAGGGCAATAGG - Intronic
976431512 4:84966969-84966991 CAGGGGTGGGAGAGGAGAGAGGG - Intergenic
976870802 4:89791135-89791157 CAGGAGAAAGAGAGAGCAAAAGG + Intronic
977362876 4:96028909-96028931 CAGGAGGAAGAGAGAGCAAAGGG + Intergenic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
977711033 4:100125834-100125856 CATAGGGAAGAGAGGGGAGAAGG + Intergenic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
978385060 4:108169845-108169867 AAGGGGGAAGAGAAGGCAAAAGG + Intergenic
978501997 4:109419716-109419738 AAGGGGTAAGAGAGGAGGGAAGG - Intergenic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979225061 4:118275463-118275485 AAGGAGGAAGAGAGAGCAGAGGG - Intergenic
979640183 4:123004196-123004218 AAGGGGTAACAGAGGGCACCTGG - Intronic
980070975 4:128242767-128242789 CAGAGGCAAGAGAGGGCCTAGGG + Intergenic
980245241 4:130230505-130230527 CAGTGGTAAGAGGGGCCAGATGG + Intergenic
980879301 4:138693222-138693244 CAGGAGGAAGAGAGAGCAGCAGG - Intergenic
981032941 4:140144127-140144149 CAGGGGTAGAAGTGGGTAGAAGG - Intronic
981081102 4:140640271-140640293 CAGGGGGAAGAAAGGGGAAAGGG + Intronic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
982271914 4:153599195-153599217 CAGGAGCACGAGAGGGGAGAAGG + Intronic
982286237 4:153738483-153738505 CAGGGATAAGAAAGGGCATTTGG - Intronic
983475207 4:168204508-168204530 CAGGAGAGAGAGAGGGCAAAGGG - Intergenic
985297399 4:188449857-188449879 CAGGGGGAAGAAAGCGCAGGTGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985637069 5:1041216-1041238 CAGTGGTGAGTGAGGGCTGAGGG + Intergenic
986940863 5:12947615-12947637 CTTGGCTAAGACAGGGCAGAAGG + Intergenic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
987393875 5:17402599-17402621 CAGGGATCAGAGCAGGCAGAGGG + Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
987754969 5:22088600-22088622 CAGGGGAAACAGAGGCCAAAAGG + Intronic
988864258 5:35317548-35317570 GAGGGGGCAGAGTGGGCAGAAGG - Intergenic
988965577 5:36414169-36414191 CAGGGGTTAGGGAGGACAGAGGG + Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989362790 5:40622860-40622882 CAGGGTTGTGAGAGAGCAGAGGG - Intergenic
989607195 5:43255924-43255946 CAGGCGTAAGAGTGTCCAGATGG + Intronic
989735661 5:44701500-44701522 CAAGGGTAAGGGTGGGAAGAGGG - Intergenic
989997194 5:50849802-50849824 CAGCATTAAGAGAGGGCAAAGGG - Intergenic
990240391 5:53811095-53811117 CAGGAGTAAGAGAGAGAAGGGGG + Intergenic
990504126 5:56427794-56427816 CTGGGGTGGGAGAAGGCAGAGGG - Intergenic
990970682 5:61502431-61502453 CAGGGGGAAGCGAGTGCTGAAGG + Intronic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991145324 5:63296264-63296286 CAGAGATTAGAGAGGGCAGTGGG - Intergenic
991565273 5:67998283-67998305 CAGGGGTATCAAAGGGCAAAGGG + Intergenic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
995308729 5:110687101-110687123 CAGGGGGAAGAAAGGTCAGAAGG - Intronic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
996346416 5:122493145-122493167 CAGGGGTAAAGGAGGACTGAAGG + Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
997359306 5:133284443-133284465 GAGGGGAAGGAGTGGGCAGAGGG + Intronic
997419243 5:133752750-133752772 CAGGGGTCATAGGGGGCAGGGGG + Intergenic
997752797 5:136364861-136364883 TAGGGGTGAGAGAAGGGAGAGGG - Intronic
999446296 5:151642639-151642661 CAGGAGAAAGAGAGGGCAAAGGG + Intergenic
999512710 5:152269400-152269422 AAAGGGTAAGAGAGGCAAGAAGG - Intergenic
1000941948 5:167372428-167372450 CAGAGGTAACAGTGGGCTGAGGG - Intronic
1001182013 5:169529306-169529328 AAGGGGACAGAGAGGGCAGGAGG - Intergenic
1001491468 5:172158873-172158895 CAGGGGTTAGAAAGGGGAAATGG + Intronic
1001514077 5:172342798-172342820 CCGGGGTAAGAAATTGCAGAAGG + Intronic
1001551158 5:172603068-172603090 CAGGGGTCAGGGAGGGGACAGGG + Intergenic
1001804422 5:174571068-174571090 CAGGGGTAAAAGGGAGGAGATGG - Intergenic
1003759690 6:9162771-9162793 GAGGGGAAAGAGAGAGAAGAAGG + Intergenic
1003782379 6:9443981-9444003 AAGGGGTAACAGATGGCAAATGG + Intergenic
1004137211 6:12978957-12978979 CAGGAATAAGAAAGGGCAGCTGG + Intronic
1004179788 6:13371318-13371340 TAGGAGTAAGAAAGTGCAGATGG - Intronic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004319652 6:14622378-14622400 CAAGGGAAAGAGAAGTCAGAAGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005072211 6:21872203-21872225 CAGGAGGGAGAGAAGGCAGAGGG + Intergenic
1005257667 6:24021467-24021489 AAAGGGGAAGAGAGGCCAGAAGG - Intergenic
1005784347 6:29227675-29227697 CATGGGTAAGAGAGGGTGAAAGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006358516 6:33574449-33574471 CGGGGCACAGAGAGGGCAGAGGG + Intronic
1006389140 6:33748337-33748359 CAGAGGTAAGATGGGGCAGGTGG + Intergenic
1006434862 6:34020794-34020816 CAGGAGTAAGAGTGGGCTGATGG + Intronic
1006511418 6:34523552-34523574 CACTGGTGAGAGAAGGCAGATGG + Intronic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1007056933 6:38895670-38895692 CAGAGGGAAGAGAGGACAAAGGG - Intronic
1007083337 6:39124711-39124733 CAAGAGTAAGTGGGGGCAGAAGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007783938 6:44269972-44269994 AAGGACTAACAGAGGGCAGAGGG - Intergenic
1008260862 6:49365630-49365652 CAGGCACAAGAGAGAGCAGAGGG + Intergenic
1008738592 6:54577285-54577307 CATCTGAAAGAGAGGGCAGAAGG + Intergenic
1010421477 6:75681286-75681308 CAGGAGTAACAGAGAGCAAAGGG - Intronic
1011567411 6:88691225-88691247 CAGGAGGAAGAGAGCGCAAAGGG - Intronic
1011806645 6:91079882-91079904 CAGGTGAAAGAGAGAGGAGATGG - Intergenic
1012535857 6:100296005-100296027 TAGGGGAGAGAGAGGGTAGAAGG + Intergenic
1013327064 6:109056924-109056946 CAGGGGAGGGAGAGGACAGATGG - Intronic
1013360585 6:109390586-109390608 CAGGAGTTAGGGATGGCAGAGGG + Intronic
1013762161 6:113531359-113531381 AAGGGGTGACAGAGGGCACATGG + Intergenic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1015210746 6:130695572-130695594 TAGGGGTAAGGGATGCCAGAGGG + Intergenic
1015336180 6:132041505-132041527 CAGGAGTAGGAGAGAGCACAGGG - Intergenic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1016278285 6:142380638-142380660 CAGGGGTAAGAAAGTAGAGATGG - Intronic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017513342 6:155133602-155133624 CAGGGGCAGGAGAGGGCAATGGG - Intronic
1017623170 6:156319447-156319469 CAGGGGTTAGTTAGGGGAGAGGG - Intergenic
1017637345 6:156456162-156456184 GAGGGGGAAGAGAGGGGAGGAGG - Intergenic
1017811616 6:157987997-157988019 CCCGGGCAAGAGAGGGCCGAGGG + Intronic
1017952458 6:159147523-159147545 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1019420518 7:948546-948568 CAGGTGAATGAGAGGCCAGAGGG - Intronic
1019612636 7:1944725-1944747 CAGGAGTGGGAGAGGGCCGACGG - Intronic
1019853927 7:3585629-3585651 CAGTGGTAACAGAGAACAGAGGG + Intronic
1020704459 7:11526696-11526718 CAGGAGAAAGAGAGGGGAAAGGG - Intronic
1021132687 7:16930153-16930175 AAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1021763055 7:23920103-23920125 CAGGAGCAAGAGAGGGGAAAGGG - Intergenic
1022426197 7:30271119-30271141 CAGGAGGAAGAGAGAGCAAAGGG - Intergenic
1023094225 7:36643822-36643844 CAGGAGGAAGAGAGAGCAAAGGG - Intronic
1023111665 7:36818918-36818940 CAGGTGGGAGAGAAGGCAGACGG - Intergenic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1024658654 7:51473203-51473225 CAGGGATGAGAGAAGGGAGATGG + Intergenic
1024810665 7:53207631-53207653 CTGGGATAAGAGATGGCAGATGG + Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026185197 7:68077412-68077434 CAGGAGGAAGAGAGAGCAAAGGG + Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027428742 7:78088325-78088347 CAGAGGTCAGAGAGGAGAGAAGG - Intronic
1027428831 7:78088958-78088980 CAGAGGTCAGAGAGGACAGAAGG + Intronic
1027768705 7:82379093-82379115 CAGGGGTGAGAGAGGGGACTGGG + Intronic
1027788989 7:82615650-82615672 CAGGAGGAAGAGAGAGCAAAAGG + Intergenic
1028707410 7:93866217-93866239 CAGGGGTTTGAGAGGAGAGAGGG - Intronic
1028942476 7:96538738-96538760 AAGGGGGAAGTGAGAGCAGAGGG - Intronic
1029098859 7:98111248-98111270 CAGGGGCCAGAGAGGGCCCAAGG - Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030695202 7:112577634-112577656 CAGGAGCAAGAGAGTGAAGAGGG + Intergenic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032328150 7:130951411-130951433 CAGAGGGAAGAGAGTCCAGAAGG - Intergenic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1032434786 7:131890910-131890932 AAGGTGAAAGAGAGGGCATAAGG - Intergenic
1032616438 7:133477315-133477337 CAGGGGTTAGGGAGGGTGGAGGG - Intronic
1032769992 7:135042504-135042526 CAGGGGTTAGAGGTGGCAGGAGG + Intronic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033036424 7:137879962-137879984 CAGGGGGCAGAGTGGGCGGAGGG + Exonic
1033351334 7:140564898-140564920 CATGGGTAAGAGAGGCCACTGGG - Intronic
1033478693 7:141716467-141716489 GATGGGGAAGAGAGGGCAGAAGG - Intronic
1033605765 7:142927584-142927606 CAGGAGGAAGAGAGAGCAGGAGG + Intronic
1033605769 7:142927600-142927622 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
1033646252 7:143306844-143306866 GAGGGGTAATAGAAAGCAGAAGG - Exonic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034277258 7:149829355-149829377 CAGGAGGAGGAGATGGCAGAGGG - Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1034990949 7:155548018-155548040 AGTGGGTCAGAGAGGGCAGAGGG - Intergenic
1035016379 7:155770017-155770039 CATGCGTAAGACAGGGAAGATGG + Intronic
1035494314 7:159309404-159309426 CAGGAGAAAGAGAGAGCAAAGGG + Intergenic
1035628582 8:1091782-1091804 GAGGGGTAGGAGTGGGGAGAGGG - Intergenic
1036134666 8:6149666-6149688 CAGGAGCAAGAGAGGGGAGGGGG + Intergenic
1036788957 8:11705046-11705068 CAGGGGTCACCGTGGGCAGAGGG + Intronic
1037244939 8:16822782-16822804 CAGGAGCAAGAGAGAGTAGAGGG + Intergenic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1037876830 8:22552539-22552561 CAGGGTTGAGAAGGGGCAGATGG + Intronic
1037906566 8:22719065-22719087 CAGGGGTCAGAGAGGAGAGACGG - Intronic
1038424879 8:27458644-27458666 CAGGGGTAGGGGTGGGGAGAGGG - Exonic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038846734 8:31237154-31237176 AAGGGGTAAGAGATGGCACCTGG - Intergenic
1038970142 8:32624322-32624344 TTGGGGTTAGTGAGGGCAGATGG + Intronic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1040984772 8:53281440-53281462 CAGGAGTAAGAGAGAGGTGAGGG - Intergenic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1042739068 8:72022977-72022999 CAGGTTTAAGAAAGAGCAGATGG - Exonic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1044189463 8:89297660-89297682 CAGGAACAAGAGAGGGGAGAAGG + Intergenic
1044417671 8:91954460-91954482 AAGGGGTCAGAAAGGGAAGATGG - Intergenic
1045606078 8:103778410-103778432 CAGAGGCCAGAAAGGGCAGAGGG - Intronic
1046768414 8:118095217-118095239 CAGGGATAACAGAGGGCAAAAGG - Intronic
1047703958 8:127478864-127478886 CACGTCTAAGAGAGGGGAGAAGG + Intergenic
1047781090 8:128111705-128111727 AAGGAAAAAGAGAGGGCAGAGGG + Intergenic
1048364345 8:133725303-133725325 CTGGGGGATGAGAGGCCAGATGG + Intergenic
1048557750 8:135497096-135497118 AAGGAGTAAGAGAGGGAAGTTGG + Intronic
1048978102 8:139684558-139684580 CAGGGGAAAAAGAAGGCAAAAGG + Intronic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050069948 9:1800114-1800136 CAGTGGTAAATGAAGGCAGATGG - Intergenic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1051349402 9:16184930-16184952 CAGGGGTAACAGCAGGCAGTGGG + Intergenic
1051617201 9:19017571-19017593 CAGGTATAGGAGAGGCCAGAAGG - Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1051937063 9:22456090-22456112 CATGGGTCAGTGAGGTCAGAAGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1053900931 9:42794875-42794897 CAGGGAGAAGAGTGGGCAGCAGG + Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1055206600 9:73738247-73738269 CAGGGGTTAGGGAGGAGAGAGGG - Intergenic
1055395813 9:75873868-75873890 CAGGAGGAAGAGAGAGCAAAGGG + Intergenic
1055478856 9:76690189-76690211 AAGGGGCGAGAAAGGGCAGAAGG - Intronic
1055507291 9:76961437-76961459 AGGGGGTGAGAGAGAGCAGAGGG - Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056798966 9:89678188-89678210 CAGGGGTCAAAGAGGGGAGCTGG + Intergenic
1057308638 9:93927491-93927513 CAGGACTCAGAGAAGGCAGAGGG + Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057794064 9:98143205-98143227 GAGGGGGAAGACAGGACAGAAGG + Intronic
1058189118 9:101891549-101891571 CAGGAGCAAGAGAGAGCAGGGGG + Intergenic
1059177400 9:112179777-112179799 CATGGGTATGGGAAGGCAGAGGG + Intergenic
1059736526 9:117105460-117105482 CACGGGTAACAGATGGCAGAGGG - Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060733184 9:126050609-126050631 GAGGGGTACGGGAGGGGAGAGGG - Intergenic
1060987232 9:127826711-127826733 CATGGGATAGAGAGGGCACAGGG - Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061076340 9:128343659-128343681 CAGGGGTGTGAGATGGCACAGGG + Intronic
1061630021 9:131866445-131866467 CAGGGGGAAGAGAGGCGACAGGG - Intronic
1061679832 9:132237545-132237567 CAGGTGTCAGGGAGGGCTGATGG - Intronic
1061854422 9:133433718-133433740 CTGGGGTAGGAGGGGGCAGCTGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185870888 X:3663963-3663985 AAGAGGAATGAGAGGGCAGAGGG + Intronic
1186732609 X:12426356-12426378 CAGGGCTAAGAGGGGCCTGAGGG + Intronic
1187017896 X:15348643-15348665 CAGGGAAAAGGGATGGCAGAAGG - Intronic
1188007589 X:25026761-25026783 CAGAGCTAAAAGAGGGCAGGTGG + Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1188822226 X:34789593-34789615 AAGGGGGAAGAGAGAGCAGGGGG - Intergenic
1188927370 X:36061149-36061171 AAGGAGGAAGAGAGGGCAGTGGG - Intronic
1189042823 X:37560750-37560772 AAGGGGTAACAGATGGCACATGG + Intronic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1190095243 X:47474555-47474577 CAGGGGTTAGGGATGGCAGTGGG + Intronic
1190592259 X:52016089-52016111 AAGGGGAAAGAGTGGGCAGGAGG - Intergenic
1190669126 X:52723572-52723594 CAGGGGTTAGGGATGGCGGATGG - Intergenic
1190670291 X:52734832-52734854 CAGGGGTTAGGGATGGCGGATGG + Intergenic
1190711254 X:53072289-53072311 CAGAGATAAGAGAGGGTAGCTGG - Intronic
1190715219 X:53097222-53097244 GAGGGGTATGAGAGGGCTGCCGG - Intergenic
1190983517 X:55479993-55480015 CACGGGTAAGGCAGGGCAGATGG + Intergenic
1190985182 X:55493190-55493212 CACGGGTAAGGCAGGGCAGATGG - Intergenic
1191656433 X:63603887-63603909 CAGGAGAGAGAGAGGGCACAGGG - Intergenic
1191998801 X:67126190-67126212 CAGGAGGAAGAGAGAGCTGAGGG - Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192563403 X:72142687-72142709 CAGAGCTAAGAGAGAGCAGATGG - Intergenic
1193152605 X:78140317-78140339 CAGGGCCAAGAGAGGCTAGAGGG - Intergenic
1193182305 X:78472128-78472150 AAGGGGTGAGAGAGGGCACCTGG - Intergenic
1194363989 X:92990792-92990814 CAGGAGAAAGAGAGAGCAAAGGG - Intergenic
1195519953 X:105819575-105819597 TCGGGGTAAGAGAGATCAGATGG - Intergenic
1195613547 X:106895169-106895191 CAGGGGTGAGAGGGGGATGAGGG - Intronic
1195687655 X:107600982-107601004 CAGGGGTGAGAGAAGGCTGGAGG + Exonic
1197925766 X:131645497-131645519 GAGAGGGAAGAGAGGGCATATGG + Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199062712 X:143377484-143377506 CAGGAGAGAGAGAGAGCAGAAGG + Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199967572 X:152832584-152832606 CAGGGGCAAAACTGGGCAGAGGG - Intronic
1200672219 Y:6107028-6107050 CAGGAGAAAGAGAGAGCAAAGGG - Intergenic
1200793195 Y:7317548-7317570 AAGAGGAATGAGAGGGCAGAGGG - Intergenic
1200855924 Y:7938130-7938152 CAGGGCTAAGACAGTGTAGAAGG + Intergenic
1201441421 Y:14012769-14012791 AAGGGGTGACAGAGGGCACATGG + Intergenic
1201443149 Y:14029938-14029960 AAGGGGTGACAGAGGGCACATGG - Intergenic
1201590653 Y:15611134-15611156 AAGGGGTGAGAGAAGGCACATGG + Intergenic
1201741102 Y:17325462-17325484 AAGGAGTAAGAGAGGAGAGAGGG + Intergenic