ID: 1119764054

View in Genome Browser
Species Human (GRCh38)
Location 14:77177245-77177267
Sequence CTTTATCAGCAGCATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7135
Summary {0: 1, 1: 72, 2: 1954, 3: 2246, 4: 2862}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119764054_1119764057 14 Left 1119764054 14:77177245-77177267 CCGTCCTCATGCTGCTGATAAAG 0: 1
1: 72
2: 1954
3: 2246
4: 2862
Right 1119764057 14:77177282-77177304 CGATAATTTATAAAGAAAAGAGG 0: 5
1: 462
2: 5444
3: 11025
4: 8921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119764054 Original CRISPR CTTTATCAGCAGCATGAGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr