ID: 1119766791

View in Genome Browser
Species Human (GRCh38)
Location 14:77195571-77195593
Sequence CAGAATCATCTGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119766791_1119766801 29 Left 1119766791 14:77195571-77195593 CCCTCCTCCTGCAGATGATTCTG 0: 1
1: 0
2: 3
3: 25
4: 237
Right 1119766801 14:77195623-77195645 CTCCCCCAGCTCAACCCTGCTGG 0: 1
1: 0
2: 3
3: 27
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119766791 Original CRISPR CAGAATCATCTGCAGGAGGA GGG (reversed) Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900854798 1:5172200-5172222 CAGACTCATCAGCAGGCTGATGG + Intergenic
900929322 1:5726358-5726380 CAGAGGCAGCTGCAGGAGCAAGG + Intergenic
900929435 1:5726926-5726948 CAGAGGCAGCTGCAGGAGCAAGG - Intergenic
902950710 1:19881029-19881051 CAAAATCATGTCCAGGAAGAGGG + Intergenic
903652627 1:24930760-24930782 CAGAATAATGTGCGGGACGAGGG - Intronic
904445490 1:30570342-30570364 CAGAAGCCACTGCAGGAGGGTGG + Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905851768 1:41280036-41280058 CAGGGGCATCTGCAGGAGAAGGG - Intergenic
906560362 1:46752229-46752251 CAGACTCAGCTGCTGGAGCAGGG + Intergenic
906987610 1:50702097-50702119 CAGAAGCTTCTGCAGTAGTAAGG + Intronic
907072359 1:51548097-51548119 AAAAATCATCTGGAGGAGTATGG + Intergenic
907629982 1:56070883-56070905 TAAAATCATCTGGAGGAGAATGG + Intergenic
909532881 1:76700606-76700628 CAGAAGCATGTGCAGGGGAAGGG - Intergenic
914825538 1:151136139-151136161 CAGGATCCTGTGCAGGAGTAGGG - Exonic
915205678 1:154268928-154268950 CACCATCACCTGCAGCAGGATGG + Exonic
915632550 1:157163491-157163513 CAGGATCACCTGCAGGGGGCAGG - Intergenic
918861513 1:189832180-189832202 CACAATCATCTTCTTGAGGAGGG + Intergenic
919002026 1:191844908-191844930 CAGAAACATTTGCAGTAGCAAGG + Intergenic
919650563 1:200144982-200145004 CAGAATCATCTGGGGGTTGAGGG + Intronic
919799569 1:201345347-201345369 AAGAGTCAGCTGCAGGAGGGAGG - Intergenic
920060931 1:203226395-203226417 CATGCTCATCTGCAGAAGGAAGG + Intronic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
924535311 1:244930798-244930820 CACAATCAACTTCAGGGGGATGG + Intergenic
924658788 1:245997425-245997447 CAGAAGCATGTTGAGGAGGAAGG - Intronic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1064214708 10:13390702-13390724 CAGAATCAACTGCTGCTGGAAGG + Intergenic
1067081496 10:43215087-43215109 CCGAATCATCTGCAGGTCGTGGG - Intronic
1067097072 10:43308554-43308576 CAGAATGGGCTGCAGGAAGAGGG - Intergenic
1067563893 10:47322823-47322845 CAGAAACATCTTCAGGTTGAAGG - Exonic
1069048851 10:63771090-63771112 AAGGCTCATCTGGAGGAGGAAGG - Intergenic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG + Intergenic
1074813860 10:117130507-117130529 GAGAAACAGCTGCAGGAGGGGGG - Intronic
1074929930 10:118114243-118114265 CAGAATCATCTTCAGGTCAAAGG + Intergenic
1075894694 10:125984637-125984659 CAGAGTCATCAGCATGAGGCTGG + Intronic
1075939787 10:126380984-126381006 CAGCATCATCTACACCAGGAAGG + Intronic
1078063039 11:8060596-8060618 CAGAAGCATCTCCAGGAAGCAGG + Intronic
1079320819 11:19449844-19449866 CAGAAAGATTTGCAGAAGGAAGG - Intronic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1081527185 11:43935107-43935129 TAGAATCCTCTGGAGGATGAGGG - Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083077505 11:60056291-60056313 GAGAAGCATCTGGAGGAGGGAGG - Intergenic
1083115300 11:60453585-60453607 CAGAATTATCTGCTGTTGGAGGG - Intronic
1083431228 11:62614491-62614513 CTGACTCACCTGCAGTAGGAAGG - Exonic
1083998371 11:66283254-66283276 CAGAGCCATCTGCAGGACGGTGG - Exonic
1085457425 11:76672867-76672889 CAGAGGCATCTGCAGCAGGTGGG - Intergenic
1085737609 11:79052814-79052836 CAGAATAGTCTGTGGGAGGAAGG - Intronic
1085738064 11:79056715-79056737 CAAGATGATCTGCAGCAGGATGG + Intronic
1087305591 11:96486384-96486406 CAGAATCATATCAAGCAGGAAGG + Intronic
1087826892 11:102775434-102775456 TGGAATCACATGCAGGAGGATGG - Intronic
1089336210 11:117725657-117725679 CAGAGAGGTCTGCAGGAGGAGGG + Intronic
1089572087 11:119417689-119417711 CAAAAGCATCGGCAGGAGAAAGG - Exonic
1089601986 11:119622044-119622066 CAGAAAGCTCTGAAGGAGGAAGG - Intergenic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1090717383 11:129442389-129442411 GAGAATCACCTGCCGGAGGTGGG + Intronic
1091954597 12:4627936-4627958 CAGAACCTTCTTCAGTAGGATGG + Exonic
1092072412 12:5642349-5642371 CAGACTCATATGCATCAGGAGGG + Intronic
1093942958 12:25074668-25074690 CAGAATTATCAGCAGCATGAAGG + Intronic
1096510106 12:52123025-52123047 CAGAAGCAGCGGCAGGAAGATGG - Intergenic
1096742384 12:53703248-53703270 CAAAAACAACTCCAGGAGGAGGG - Intergenic
1097085366 12:56464166-56464188 CTAAATCATCTGAATGAGGAAGG + Intronic
1098219398 12:68252639-68252661 CTCACTCATCTGCAGGTGGAAGG + Exonic
1101367207 12:104084421-104084443 GAGAAACCACTGCAGGAGGAGGG + Intronic
1101557376 12:105822992-105823014 CAGAGACATCTGCAGAAGGCTGG + Intergenic
1103253564 12:119521782-119521804 GAGAGCCATCTACAGGAGGAAGG + Intronic
1103963170 12:124622040-124622062 CAGAATCACATCCTGGAGGATGG - Intergenic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104857857 12:131910240-131910262 AAAACTCATCTGCAGGAGGAAGG - Exonic
1106962472 13:35014912-35014934 CAGGCTCATCTGCAAGAAGATGG + Intronic
1107100125 13:36581439-36581461 CAGAACCATCTCAAGGAGGCCGG + Intergenic
1107290639 13:38849192-38849214 CAAAATCATCAGGAGGAGAAAGG - Intronic
1107655215 13:42585898-42585920 AAGAATAATGTGCAGGAGAAAGG + Intronic
1108300159 13:49065489-49065511 ATGTATCATCTGCAAGAGGATGG + Intronic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1111181258 13:84668884-84668906 CAGAATCATTTACAGGACAAAGG + Intergenic
1112392469 13:98998021-98998043 CAGAAACATCTCCAGGGTGATGG + Intronic
1112397248 13:99044257-99044279 CAGAATCAATTACAGGAGGCTGG - Intronic
1112776232 13:102846431-102846453 CAGTGGCATCTGCAGGATGATGG + Intronic
1113097802 13:106684307-106684329 GAGAATCACCCGGAGGAGGAAGG - Intergenic
1113144081 13:107187445-107187467 CAGAATTATCTGCAGGGTGAGGG + Intronic
1113673273 13:112189466-112189488 CAGCAACATCTGAAGGAGAAAGG - Intergenic
1113702795 13:112399576-112399598 CAGACTCATCTGTTGGAGGGAGG - Intronic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1116171269 14:41406131-41406153 CAGAATCAACTGCAGCATTAGGG - Intergenic
1118110423 14:62712054-62712076 GAGAAGCAGGTGCAGGAGGAAGG + Intronic
1119208860 14:72814216-72814238 CAGAATCATCTTCATGAAGGAGG - Intronic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1121030798 14:90657131-90657153 CAGAGTCCTCTGCAGGAGCGGGG + Intronic
1122494326 14:102140750-102140772 CAAAAACATCCGCGGGAGGACGG + Intronic
1202943068 14_KI270726v1_random:1199-1221 CAGCATCCTCTGCAGGGTGAGGG + Intergenic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124241142 15:28028534-28028556 CAGAAGCATGAGCAGGAAGAGGG + Intronic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1125448979 15:39788188-39788210 CAGAGTCATTTGCAGGGGGAAGG + Intergenic
1129231356 15:74198908-74198930 CAGAATCATGTGGTGGAGAAAGG + Intronic
1130445017 15:83992550-83992572 CAGAATCCTCTGCAGGTATAGGG - Intronic
1131372549 15:91894798-91894820 CAGAAGCATGTGCAGGGTGAGGG - Intronic
1131422945 15:92322383-92322405 CAGGCTCATCTGAATGAGGAAGG - Intergenic
1131953488 15:97706374-97706396 CAGCATCATCCGCAGAGGGAAGG + Intergenic
1133189140 16:4120486-4120508 GAGAACCATCTGCTGGAAGATGG + Intergenic
1137736168 16:50725496-50725518 GAGAACCATCTCCAGGATGAAGG + Exonic
1137760327 16:50935250-50935272 CAGAATCATGTCCTGGAGGATGG - Intergenic
1138342548 16:56299772-56299794 AAGCATCATCTTCAGGAGGATGG + Intronic
1138965584 16:62080334-62080356 CAGAATCATCAGTAGAAGAATGG - Intergenic
1140754689 16:78056704-78056726 AAGAATGAGCTGCAGGAGGTGGG - Intronic
1142339245 16:89509720-89509742 CTGAAGCTTCTGCAGGAGAAAGG - Intronic
1142523262 17:519666-519688 GAGAAGCCTCTGGAGGAGGATGG - Intronic
1143166247 17:4898628-4898650 CAGATTGATCAGCAGGGGGAAGG + Exonic
1143172081 17:4936168-4936190 CAGGACCATCTGGAGGGGGATGG - Intergenic
1144378118 17:14665707-14665729 CAGAATCATTAACAGAAGGAAGG - Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1145208927 17:20998979-20999001 CAGAAGCATCTGAAAAAGGAGGG + Intergenic
1146893997 17:36528019-36528041 GAGTATCATCTCCAGGAGGTTGG - Intronic
1148968529 17:51458600-51458622 GAGAATCATCAACAGGTGGAAGG + Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1150125665 17:62632905-62632927 CTGCCTCATCTACAGGAGGAAGG - Intronic
1151084767 17:71367299-71367321 CAGAATCTTCTGATGGAAGATGG - Intergenic
1151460788 17:74252912-74252934 CAGAATGATCTGCAGGAGGCAGG + Intronic
1152457269 17:80423579-80423601 AAGAAACTTCTGCAGGTGGATGG + Exonic
1153945816 18:10016282-10016304 CAGGAGCATCTGCAGGAAGCAGG + Intergenic
1154251290 18:12747187-12747209 AAGAACCATCTGCTGGTGGATGG - Intergenic
1158265754 18:55659287-55659309 CAGATTAAACTTCAGGAGGAAGG - Intronic
1161327303 19:3670038-3670060 CAGAAGCCTCTGCAGGCGGCAGG + Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1164472433 19:28547277-28547299 CAGAATTATTTGGAAGAGGAGGG - Intergenic
1165374303 19:35430921-35430943 TGGATTCAACTGCAGGAGGACGG + Intergenic
1165784132 19:38451240-38451262 GAGCATCATCAGCAGGTGGATGG + Intronic
1166708829 19:44924329-44924351 CACAAACAGCTGCTGGAGGATGG - Intergenic
1167300331 19:48674084-48674106 GTGCATCAGCTGCAGGAGGATGG + Intergenic
1167795030 19:51703446-51703468 CACAAGCATCAGCAAGAGGAGGG + Intergenic
1168316382 19:55486529-55486551 CAGGAACACCGGCAGGAGGAGGG - Exonic
925587323 2:5476423-5476445 CCGAATCATCAGCAGCAGCATGG - Intergenic
926327010 2:11793701-11793723 CAGACTCATCTGCAGGGAAAGGG - Intronic
928713456 2:34033599-34033621 CAGACTCATCTGCCCTAGGACGG + Intergenic
929435147 2:41923109-41923131 AGGAATCATATGCATGAGGAAGG + Intergenic
930737498 2:54794462-54794484 CAGAAACATCTGAGGGAGTAGGG + Intronic
932848034 2:75154937-75154959 CAGACTCATCTGGAGGAGAAAGG - Intronic
933873728 2:86597140-86597162 CATAATCATGTGCTGGTGGAGGG - Intronic
934753449 2:96809306-96809328 CCGAGTGATCTGCATGAGGAAGG - Exonic
936094278 2:109519927-109519949 CTGAAGCATCTGCGTGAGGATGG + Intergenic
937213862 2:120297885-120297907 CAGAATAATCTTCAGAAGAATGG - Intergenic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
938598891 2:132817216-132817238 CAGAATCATCTGAAGGAATCAGG + Intronic
938853026 2:135281427-135281449 CAGAATCATTTGCAGGGGAAAGG - Intronic
939300614 2:140332539-140332561 CACAATTATCTGGAGAAGGAGGG - Intronic
940383713 2:153046148-153046170 CAGAAGCATCTCCAGGAAGCTGG - Intergenic
940561358 2:155301360-155301382 CAGTATCATATCCTGGAGGATGG - Intergenic
941069906 2:160944276-160944298 AAGAGACATCTGCAGGAGGCTGG + Intergenic
941285885 2:163611396-163611418 CAGAGACATCTGCTGGAGGGAGG + Exonic
945976714 2:216276838-216276860 CACAATCATCTGTTGGGGGAGGG + Intronic
947922946 2:233894080-233894102 CTTCATCTTCTGCAGGAGGAAGG + Intergenic
948453384 2:238092632-238092654 CAGATGCAGCTGCAGGAGCACGG - Intronic
948558882 2:238837196-238837218 GAGAATGATCTGCAGGATTAGGG - Intergenic
1170335834 20:15269228-15269250 CCATATCATCTGCATGAGGAAGG - Intronic
1171491981 20:25526429-25526451 GAGAAGCGTCTGCAGGAGGACGG + Exonic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1173554256 20:43954418-43954440 CAGAGTCCACTGCAGGAGGCAGG - Intronic
1179592108 21:42415666-42415688 CAGCAGCATCTGCTGGAGGACGG - Intronic
1179936019 21:44603635-44603657 CAGAACCTCCTGCAAGAGGAAGG + Intronic
1181009942 22:20034264-20034286 CAGAAACATCTGCAGGGCAAAGG - Intronic
1181342697 22:22195565-22195587 CAGAAACACCAGCAGGTGGAGGG - Intergenic
1182021241 22:27083397-27083419 CAGAATCCCCTGCAGAAGGGAGG - Intergenic
1182115343 22:27753256-27753278 CACCATCAGCTCCAGGAGGAGGG - Intronic
1182333042 22:29564409-29564431 CAGCATCATTGGCAAGAGGAAGG + Intronic
952886230 3:38012840-38012862 CAGAAGCTTCTGGAGGAGGTAGG - Intronic
953930033 3:47001275-47001297 CAGCATCATCTCCAGGAGGCTGG - Exonic
955619847 3:60851037-60851059 CCAGATCATCTCCAGGAGGAGGG + Intronic
956239415 3:67112845-67112867 AAGGATTATCTGCAGGAGCATGG + Intergenic
958486434 3:94716812-94716834 CAGAATCACCTCCAGGTGGCAGG - Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959066844 3:101666109-101666131 AAGAAACAGCTGCTGGAGGATGG + Intronic
959191721 3:103121049-103121071 CAGATTCAGAAGCAGGAGGATGG + Intergenic
959495913 3:107051704-107051726 CAGAAGCACCTGCAAGAGAATGG + Intergenic
960590567 3:119361704-119361726 CAGAATCATCCGGAGGATGCCGG + Intronic
962290708 3:134134287-134134309 CAGAATCATCTGGAGAGTGAAGG + Intronic
962617902 3:137146741-137146763 CAAAAACACCTGCTGGAGGAAGG + Intergenic
964622988 3:158733937-158733959 CACAATTATCTGCAGAAGGAAGG - Intronic
965888751 3:173483053-173483075 CAGAATCAACTACTGGAGGTTGG - Intronic
965932189 3:174058398-174058420 GAGATTCATCTGCAAGGGGATGG - Intronic
965943001 3:174208219-174208241 GAGAATCATCTGTGGGAGGTAGG + Intronic
968041913 3:195595961-195595983 CAGAACCCTCTGCTGTAGGAGGG + Intergenic
969918133 4:10510215-10510237 CAGAATCACTTGCGGGGGGAGGG + Intronic
970920221 4:21385302-21385324 CAGAACCACCAGCAGGAGGTGGG + Intronic
972059417 4:34850920-34850942 CAAAAGCATCTCTAGGAGGATGG - Intergenic
972234065 4:37109593-37109615 CAAAATCACCTGGAGGAGAATGG - Intergenic
974040444 4:56852714-56852736 GAGAAACATGTGAAGGAGGATGG + Intergenic
977928453 4:102727678-102727700 CAGAATCTCCCTCAGGAGGATGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
985326446 4:188776251-188776273 GAGCATCAGCTGCTGGAGGATGG + Intergenic
985355789 4:189117191-189117213 CAGCATCAGCTGAAGTAGGAGGG - Intergenic
985826231 5:2193551-2193573 CAGAAACAGCTGCAAGAGGTGGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987101805 5:14597745-14597767 GAGAACCATCTGGAGGTGGATGG - Intronic
987195162 5:15518632-15518654 CAAAGTCCTCTACAGGAGGATGG - Intronic
989987205 5:50714780-50714802 CACAGTCAGCTGCAGGAGGGAGG - Intronic
990816913 5:59795906-59795928 CACACACATATGCAGGAGGAAGG + Intronic
992102457 5:73420196-73420218 AAGAGCCATCTGCAGAAGGACGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993552511 5:89291305-89291327 TACAATCATCAGCAGGAGGAAGG + Intergenic
997339281 5:133130141-133130163 CTAAATCATCTGCAGAAGGATGG - Intergenic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
999222564 5:149992946-149992968 CAGAATGGACTGCAGGAGAAAGG + Intronic
999685156 5:154096165-154096187 AAGCAACATCTTCAGGAGGAAGG + Intronic
1000017934 5:157294780-157294802 CAGAATGAGATGCTGGAGGAAGG + Exonic
1005592143 6:27339638-27339660 CAGAAACCTCTGGAGGATGAAGG - Intergenic
1007034823 6:38663534-38663556 CAAAATCAGCTGCAGAAGTAAGG + Intergenic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1013933264 6:115561802-115561824 CAAAATTATCTGAAGGCGGATGG - Intergenic
1014694567 6:124603238-124603260 CAGAATCATTTTCAGTAGCAGGG - Intronic
1015799120 6:137043338-137043360 CAGAGACATAGGCAGGAGGATGG - Intronic
1016239401 6:141911069-141911091 CAGAGAGATCTGCAGGAGGTTGG + Intergenic
1016279885 6:142404342-142404364 TAGAATCTTCTGGAGGAGGCTGG + Intronic
1018968040 6:168503923-168503945 CAGAATCCTCTGCCGGAGGGAGG + Intronic
1022390602 7:29940621-29940643 CAGAAACAGCTGCAAGAGAAAGG + Intronic
1024623616 7:51185443-51185465 CAGCTTCATCTGCAGGTTGAGGG + Intronic
1029018632 7:97340590-97340612 GAGAATTATCTGCAGGATGATGG + Intergenic
1029507678 7:100972104-100972126 CAGAGCCCTCTGCAAGAGGAGGG - Intronic
1031918135 7:127582267-127582289 CAGGATCGGCTGCTGGAGGAGGG - Exonic
1032665090 7:134028082-134028104 TAGAATCCTCTGGAGGAGGAGGG + Intronic
1033968809 7:147011844-147011866 CAGCACCATATTCAGGAGGAAGG + Intronic
1035642761 8:1196604-1196626 CAGAGGCATCTGCAGGTCGAGGG + Intergenic
1036228924 8:6983115-6983137 GAGAATCACCTGCCGAAGGATGG - Intergenic
1036231376 8:7002220-7002242 GAGAATCACCTGCCGAAGGATGG - Intronic
1036233830 8:7021316-7021338 GAGAATCACCTGCGGGAGGATGG - Intergenic
1037920487 8:22802155-22802177 CAGAACCCGCTGCAGGAGGAGGG + Intronic
1037936519 8:22918590-22918612 CAGCATCATCAGCACGCGGAAGG + Intronic
1038024717 8:23578140-23578162 AAGAATCATCTTCCAGAGGAGGG - Intergenic
1038222198 8:25621461-25621483 GTTAATCATCTGGAGGAGGAAGG + Intergenic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1040391576 8:46954939-46954961 GCGAAGTATCTGCAGGAGGAGGG + Intergenic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1041078024 8:54186938-54186960 GAAAGTCATCTGGAGGAGGATGG - Intergenic
1045703291 8:104891986-104892008 CAGACACAGCTGCAGGAGGTGGG + Intronic
1046783970 8:118245941-118245963 GAGAAGCAGCTGCAGGAGGTAGG + Intronic
1048659983 8:136588472-136588494 CAGAATCATATGGAGGAGAAGGG - Intergenic
1051607253 9:18928090-18928112 CTGAATCATCTACAGAAAGATGG + Exonic
1051936764 9:22451715-22451737 CATATTCTTCTGCAGGAAGAGGG + Exonic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG + Intergenic
1056129442 9:83569343-83569365 GAGATCCATCTGCAAGAGGAGGG - Intergenic
1056154183 9:83817976-83817998 CAGAACCACCTGCTGGAGAAGGG + Intronic
1056356325 9:85805133-85805155 CAGAACCACCTGCTGGAGAAAGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1056947973 9:91016936-91016958 CAGAGTCCTCTGCAGGATTATGG - Intergenic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1058714597 9:107712502-107712524 CAGACTCATGTGGAAGAGGAAGG - Intergenic
1058976000 9:110126179-110126201 CAGAATCATCTGTAGACAGAGGG + Intronic
1061262776 9:129489124-129489146 CCACATCATCTGCAGTAGGACGG + Intergenic
1185825255 X:3243377-3243399 TAGGCTCATGTGCAGGAGGAGGG - Intergenic
1186851499 X:13584462-13584484 GGGAATCATCTGCAGGTAGATGG - Intronic
1188329489 X:28851228-28851250 CAAAATGATATGCAGGGGGATGG - Intronic
1190461075 X:50676068-50676090 CAGTATCATTTGTAGCAGGAAGG - Intronic
1190533784 X:51407047-51407069 CAGAAGCACCAGCAGGACGAGGG + Exonic
1190949251 X:55126752-55126774 TAGACTCATCTGCTGGAGAATGG - Intronic
1195642651 X:107193458-107193480 GAGAAACATCTACAGGAGGATGG + Intronic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1198883884 X:141312174-141312196 CAAAATCAAAGGCAGGAGGAAGG + Intergenic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic