ID: 1119766962

View in Genome Browser
Species Human (GRCh38)
Location 14:77196280-77196302
Sequence CCAGCTCCCCACTTTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119766952_1119766962 17 Left 1119766952 14:77196240-77196262 CCGGCATCATCCCATCACCCATC 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221
1119766949_1119766962 30 Left 1119766949 14:77196227-77196249 CCAGGTAGGTGCCCCGGCATCAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221
1119766958_1119766962 -1 Left 1119766958 14:77196258-77196280 CCATCAGGGCTAAGCCCTAGTGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221
1119766951_1119766962 18 Left 1119766951 14:77196239-77196261 CCCGGCATCATCCCATCACCCAT 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221
1119766950_1119766962 19 Left 1119766950 14:77196238-77196260 CCCCGGCATCATCCCATCACCCA 0: 1
1: 0
2: 2
3: 17
4: 161
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221
1119766955_1119766962 7 Left 1119766955 14:77196250-77196272 CCCATCACCCATCAGGGCTAAGC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221
1119766956_1119766962 6 Left 1119766956 14:77196251-77196273 CCATCACCCATCAGGGCTAAGCC 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221
1119766957_1119766962 0 Left 1119766957 14:77196257-77196279 CCCATCAGGGCTAAGCCCTAGTG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119766962 Original CRISPR CCAGCTCCCCACTTTGAGCC TGG Intronic
900917682 1:5650132-5650154 CCACCTCCTCACTTTGATCCAGG + Intergenic
900977288 1:6025623-6025645 CCATCTCCCAACTTTGTGCCAGG - Intronic
901601878 1:10429077-10429099 CCAGCTCCCTCCCTTGAGCCTGG - Intergenic
901631976 1:10652400-10652422 CCAGCACCCGGCTTGGAGCCTGG + Intronic
902329263 1:15723090-15723112 GCAGCTCCAAACTCTGAGCCTGG + Intronic
902379020 1:16043961-16043983 CCAGCACCTCACTTTGGCCCTGG + Intronic
902518408 1:17002169-17002191 GGAGCTCCCCACTTTCAGCTGGG + Intronic
903831614 1:26178551-26178573 CCAGCTCCCCACTCTGGGAGGGG - Intronic
904286430 1:29455618-29455640 TCAGCTCCCTACTTTGTGCTTGG + Intergenic
904768890 1:32870347-32870369 CTAGCTCCCTTCTTTGACCCAGG - Intronic
905178939 1:36155250-36155272 CAAGCTCCCCACTCTGCCCCGGG + Intronic
905303467 1:37001489-37001511 CCAGGTCCCCACCATGAGCAGGG - Intronic
905528015 1:38653993-38654015 CCAGCTCTCACCTGTGAGCCTGG + Intergenic
906510756 1:46409344-46409366 CCAGCTGGGCACATTGAGCCTGG + Intronic
907647416 1:56258223-56258245 CCTGCTCCCCAGTGTGAGCCTGG + Intergenic
908171077 1:61505264-61505286 CCACCACCCCACTCTGAGACTGG - Intergenic
908357081 1:63332683-63332705 CCAGTTCCCAAAGTTGAGCCCGG - Intergenic
911100944 1:94095353-94095375 GCATCTACCCACTTTGAGTCAGG - Intronic
912460758 1:109829407-109829429 CCAGCTGCCCCCTATGAGGCTGG + Intergenic
912550201 1:110480411-110480433 CCTGCTCCCCACTTGCAGACGGG - Intergenic
913053108 1:115134094-115134116 CCTGCTTCCCACTCTGAGCCAGG - Intergenic
914460996 1:147885041-147885063 CCAGCTCTCAGCTTTGAACCAGG + Intergenic
915524631 1:156468147-156468169 CCAGCTGCCCGCCCTGAGCCTGG - Exonic
915739036 1:158104107-158104129 TCAGCTCCCCAAATTGAACCAGG + Intergenic
918114006 1:181482117-181482139 CCATCTCCCCACTTAGCACCTGG - Intronic
921049554 1:211501297-211501319 CCAGCTCCACCCTTGGTGCCAGG - Intergenic
921675514 1:217971277-217971299 CAACCTCCCAACATTGAGCCAGG - Intergenic
922177460 1:223207792-223207814 ACAGCTCACCACTTCCAGCCTGG + Intergenic
923148865 1:231216679-231216701 CCAGCTTCCCACTGTGAGACTGG + Exonic
923669696 1:236029810-236029832 CCCACTCCACACTGTGAGCCTGG - Intronic
1063291671 10:4756097-4756119 CCAGCTCCCCACCCTGCGACAGG + Intergenic
1065361667 10:24894864-24894886 CCTGATGCCCACTCTGAGCCAGG - Intronic
1067283561 10:44891119-44891141 TCAGCTTCCCACTCTGACCCAGG + Intergenic
1067697533 10:48546862-48546884 CCAGGTACCTACTATGAGCCAGG + Intronic
1070518556 10:77230647-77230669 CCAGAGCCCCAGTGTGAGCCTGG - Intronic
1072274005 10:93804429-93804451 CCAGCTCCCCACTGGTAACCTGG + Intergenic
1075011701 10:118875937-118875959 CCAGCTCCCCATTTTGAGTAAGG - Intergenic
1075386599 10:122059821-122059843 CCAGAACCCCACTTTGAGAATGG - Intronic
1075872746 10:125782566-125782588 CCAGATCCCATCTCTGAGCCAGG - Intergenic
1075898940 10:126022565-126022587 CCAGCTGCACATTTTGACCCTGG + Intronic
1076134506 10:128036227-128036249 GCAGCTCGCCACCTTGACCCTGG + Intronic
1076177158 10:128377020-128377042 CCATCCCCCCACTTGGGGCCAGG - Intergenic
1076191765 10:128488166-128488188 CCAGGTCAGCACTTTGATCCTGG - Intergenic
1076443395 10:130495682-130495704 CCAGCTCACCCCTCTGACCCTGG - Intergenic
1076819672 10:132932056-132932078 CCTGCTCCCCACACAGAGCCTGG + Intronic
1077252095 11:1565259-1565281 ACTGCTCCCCTCTGTGAGCCTGG + Intronic
1079188751 11:18260255-18260277 ACAGCACCCCACACTGAGCCCGG + Intergenic
1079378915 11:19919507-19919529 CCATATTCCCACTCTGAGCCAGG - Intronic
1079660862 11:23035249-23035271 CCAGGGCCCCACCTTAAGCCTGG + Intergenic
1081990559 11:47335191-47335213 GCAGCCACCCACTCTGAGCCTGG + Exonic
1083725552 11:64626152-64626174 GGAGCTCCCCACTGTGAGCCCGG - Intronic
1084418621 11:69049176-69049198 CCAGCACCCCGCTTTCTGCCGGG + Intronic
1084952685 11:72675370-72675392 ACAGCTCCACACCTTGAGGCAGG + Intergenic
1085033876 11:73288760-73288782 CCACCTACCCTCTCTGAGCCTGG - Intronic
1085260670 11:75203007-75203029 CCAGATGCCCACTGTGTGCCAGG + Intronic
1088315224 11:108499462-108499484 CCAGCTCCTCACTCTGGGCTTGG - Intergenic
1088907882 11:114168748-114168770 TCAGCTCCCCAGTTTGAGATTGG - Intronic
1089688109 11:120169635-120169657 CCACTTCCCCTCTTTGAGCGTGG + Intronic
1090412291 11:126517594-126517616 ACAGCATCCCACTTTGAGGCTGG - Intronic
1091287811 11:134417996-134418018 CCAGCTTCCCACAATCAGCCAGG - Intergenic
1091588983 12:1831788-1831810 CCAGCTCCCCACTTTCTCCTAGG + Intronic
1093610433 12:21149502-21149524 CCAGCTCATCTCTTTGAGACTGG + Intronic
1094811907 12:34146753-34146775 CCAGCTCCCCACCCTCAGACAGG - Intergenic
1096671158 12:53198974-53198996 CCAGCTCCCCAGCTCCAGCCTGG + Intronic
1097287340 12:57888349-57888371 CCAGCTGCCCACCAAGAGCCAGG - Intergenic
1098866654 12:75771443-75771465 CCAGGCCCCCACTGTGAGTCAGG + Intergenic
1101833056 12:108274386-108274408 CCCTCTCCCCACTTTGTTCCAGG + Intergenic
1103258042 12:119560126-119560148 CCACCTCCCAAGCTTGAGCCAGG + Intergenic
1104259797 12:127172084-127172106 CCTGCTCCCCACTCAGGGCCTGG - Intergenic
1104749958 12:131231978-131232000 CCAGCCACACACTTTGAGTCTGG + Intergenic
1104795561 12:131514730-131514752 CCACCTCCCCACTTTGTCTCTGG - Intergenic
1104843898 12:131837235-131837257 CCACCTCCCCGCTGTGTGCCTGG - Intronic
1105817922 13:24053507-24053529 CAACCTCCCCACTTCTAGCCAGG - Intronic
1108678948 13:52762980-52763002 CCACCTCCCCACGTGGCGCCTGG - Intergenic
1112984733 13:105434391-105434413 CCTGCTCCCCATTGTGAGCCTGG - Intergenic
1114055658 14:18965328-18965350 CCAGCTGCTCCCTGTGAGCCTGG + Intergenic
1114106888 14:19436435-19436457 CCAGCTGCTCCCTGTGAGCCTGG - Intergenic
1115429584 14:33300860-33300882 TCAGGTCCCCAATCTGAGCCAGG - Intronic
1115906468 14:38208498-38208520 CCAACTCCCTTCTTTGCGCCTGG - Exonic
1117734417 14:58754631-58754653 TCCTCTCCCCACTGTGAGCCTGG + Intergenic
1117804854 14:59481016-59481038 CCAGCTTCCCAATTTCATCCTGG - Intronic
1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG + Intronic
1122792696 14:104191015-104191037 CCTGCTCCCCGCCATGAGCCAGG + Intergenic
1123041844 14:105493470-105493492 TCATGTCCCCACTGTGAGCCTGG + Intronic
1125514417 15:40309676-40309698 CCCCCTCTCCACTTTGGGCCTGG + Intergenic
1126740538 15:51772434-51772456 CCTGCTCCTAACTTCGAGCCAGG - Intronic
1127510159 15:59632935-59632957 CCAACTCCCCACTCTTAGCTTGG + Intronic
1127845049 15:62862527-62862549 CCATCTCTTTACTTTGAGCCTGG - Intergenic
1131047309 15:89324265-89324287 CCAGATGCCCACTCTGGGCCAGG + Intronic
1133312982 16:4862924-4862946 CCAGCTCCCCACTGGGACCCAGG - Intronic
1133322286 16:4921822-4921844 CCAGCTCTCCACTTTGCAGCTGG - Intronic
1133403295 16:5504288-5504310 ACAGCTGCCAACTTTGAGGCAGG + Intergenic
1133741338 16:8653936-8653958 TCAGCTTCCCACATTGAGCTTGG - Intergenic
1133988426 16:10685928-10685950 CCAGCTCCCCACTTCAAGTCTGG + Intronic
1135261743 16:20986687-20986709 CCTGGTCCCCACTCTGTGCCTGG + Intronic
1137870175 16:51942732-51942754 CCAAATGCCCACTATGAGCCAGG + Intergenic
1139507139 16:67404417-67404439 CCAGGTACCCACCTTGGGCCTGG - Intronic
1139671035 16:68492676-68492698 ACAGCTCCCCACCCTGTGCCAGG - Intergenic
1140481997 16:75266885-75266907 CCAGGTCCCCGCCATGAGCCCGG - Intronic
1141674999 16:85513196-85513218 CCAGCTGCCATCTCTGAGCCGGG - Intergenic
1141675015 16:85513258-85513280 CCAGCTGCCATCTCTGAGCCGGG - Intergenic
1142885546 17:2910200-2910222 CCAGGTCCCCACCCTAAGCCAGG - Intronic
1143297615 17:5883234-5883256 CCACCACCCCACTCTGAACCAGG + Intronic
1143330455 17:6131201-6131223 CCTGGTCCCCACATTCAGCCTGG + Intergenic
1144802441 17:17939227-17939249 CCAGCTGCCAACTTTTTGCCTGG - Intronic
1144948606 17:18982311-18982333 CCTGCTCCCCAGCTTGTGCCTGG + Intronic
1145976840 17:28988740-28988762 CCACTGCCCCACTTGGAGCCTGG - Intronic
1147382753 17:40065305-40065327 CCTGCGCCCCACCTTGAGTCTGG + Intronic
1148241870 17:46004445-46004467 CAAGCTCCCAATTTTGATCCAGG - Intronic
1148862668 17:50612738-50612760 CCAGGTCCCCACTTCGGGGCAGG - Intronic
1148865868 17:50628287-50628309 CCAGCTCCCCACTCAGCACCTGG - Intergenic
1150272619 17:63876431-63876453 CCATCTCCCCACTTTCAGAGCGG + Intronic
1150390282 17:64786178-64786200 CCAGGTGCCCACTTTGTGCCTGG + Intergenic
1151171447 17:72249645-72249667 CCAGCTGCCAAGTTTCAGCCAGG - Intergenic
1151806919 17:76411462-76411484 CCAGCTCCCCTTTTTGAACTGGG - Intronic
1151942476 17:77301107-77301129 GCTCCTTCCCACTTTGAGCCTGG - Intronic
1152241400 17:79163203-79163225 CCAGCTCCCTCCTTGGGGCCGGG + Intronic
1152597531 17:81245234-81245256 GCAGCTCCCCAGCCTGAGCCTGG + Exonic
1152615435 17:81335794-81335816 CCATCTGCCCACTCTGAGCAGGG - Intergenic
1154290394 18:13101712-13101734 GAAGCTCCCCGCTCTGAGCCTGG + Intronic
1160836482 19:1127028-1127050 CCAGCTCCCCACCCTGGGACAGG + Intronic
1162462009 19:10818873-10818895 CCAGCTTCCCTCTCTGAGCTAGG + Intronic
1163569137 19:18069881-18069903 TCTGCTACCCACTTTGTGCCTGG - Intronic
1167941408 19:52948467-52948489 CAAGCTCCCCACCTTTGGCCAGG - Intronic
925188424 2:1864904-1864926 CCAGCTCCCAGCTGAGAGCCAGG - Intronic
927161080 2:20262087-20262109 ACTTCTCCCCACTTTGAGACAGG - Intronic
927510712 2:23642411-23642433 CCAGCCTCCCACCTTCAGCCCGG + Exonic
927519554 2:23690606-23690628 CCTGCTTCCCACCCTGAGCCCGG - Intronic
927522389 2:23707212-23707234 CCAGCTGCCCACGCGGAGCCAGG + Exonic
927702550 2:25277276-25277298 CCAGCTCCCCACTTTTTTCGCGG + Intronic
927914657 2:26927402-26927424 CAAGCTCCCCATTTTCAGCATGG - Exonic
930771752 2:55136882-55136904 ACAGCTCCCCACTCTGTACCTGG - Intergenic
931668811 2:64628625-64628647 CCAGCTCTCCACTCTCAGCGCGG - Intergenic
934921282 2:98347016-98347038 CCCGCTCCCGACTTGGAGCCGGG - Intronic
935185145 2:100725017-100725039 CTACTTCCCCATTTTGAGCCTGG - Intergenic
936076256 2:109403656-109403678 CCAGCACCCTGCATTGAGCCTGG - Intronic
937156606 2:119724419-119724441 CCAGCTCCCCACCAGGCGCCTGG - Intergenic
937964469 2:127492070-127492092 CCAGCTGCCTAGTGTGAGCCAGG - Exonic
941002672 2:160218353-160218375 CCAACTCCCCACATCTAGCCAGG - Intronic
941463980 2:165803317-165803339 CTTACTCCCCACTTTGAGCTGGG + Intergenic
943934918 2:193903917-193903939 ACAGCTCCCAGCTGTGAGCCAGG + Intergenic
945097362 2:206232055-206232077 CAATCTCCCCACTGTGAGACTGG - Intergenic
947795397 2:232891004-232891026 CCAGCTCCTCCCTGTCAGCCAGG + Intronic
947808201 2:232982833-232982855 CACTCTCCCCACTTTGATCCAGG - Intronic
948132287 2:235609565-235609587 CCTGCTCCTCACTTTGACCCCGG + Intronic
1168830868 20:844721-844743 CCAGCTGCCTACTTTCTGCCCGG + Exonic
1169379654 20:5095632-5095654 CCATCTCCTCACCTTGAGACTGG - Intronic
1170863502 20:20130867-20130889 CCACCTCCCCACTTTGTTTCTGG + Intronic
1172511554 20:35504393-35504415 CCAGCTGCCGACTGTGTGCCTGG - Exonic
1172889975 20:38257218-38257240 CCAGTTCCCTACTGTGTGCCAGG - Intronic
1173523193 20:43713899-43713921 CCGCCTCCCCACTCTGAGCCAGG - Intronic
1174183784 20:48691199-48691221 CCAGCTCCCCATCCTGATCCAGG - Intronic
1175025065 20:55893440-55893462 CAAGCTCCCCACTCTGGGCTTGG + Intergenic
1175785658 20:61710280-61710302 TCAGCTCACCTCTCTGAGCCTGG + Intronic
1178902113 21:36606280-36606302 CCAACTCCCCACTTTGGGGTGGG + Intergenic
1179470250 21:41605564-41605586 CCCACTGCCCACTTGGAGCCTGG - Intergenic
1179588455 21:42389114-42389136 CCAGCTCCGCACTGTGTGGCAGG - Intronic
1180474134 22:15687880-15687902 CCAGCTGCTCCCTGTGAGCCTGG + Intergenic
1180713149 22:17853756-17853778 CCAGCTCCACTCTCTGAGGCTGG + Intronic
1181092456 22:20483329-20483351 CCAGCTCATCATATTGAGCCTGG + Intronic
1181262147 22:21606195-21606217 CCTGTTCCCCACTGTGGGCCAGG - Intronic
1182011654 22:27006308-27006330 CCATCTTCCCACTGTGAGCAAGG - Intergenic
1183401203 22:37605678-37605700 CCTGATCCCCAGTTTGGGCCAGG + Intergenic
1184445673 22:44545481-44545503 CCAGCTCTCCACCTTGACCCTGG + Intergenic
1184487025 22:44785915-44785937 CCAGCTCCAAATTCTGAGCCAGG - Intronic
1184911756 22:47540049-47540071 TCTGCTCCCCAGTTTGGGCCAGG - Intergenic
950045565 3:9946880-9946902 CCAGCTGCCCACTCTCCGCCGGG + Exonic
950577113 3:13838599-13838621 CCAGCTCCCTCCTGTGAGTCGGG - Intronic
950609956 3:14120112-14120134 CCAGTTCCCCACTCTGACCAAGG - Intronic
950664348 3:14486194-14486216 CCCACTCCCCACTCTCAGCCTGG + Exonic
952877746 3:37961240-37961262 TCATCTCCCAACTATGAGCCAGG + Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954243889 3:49315781-49315803 CCAGAGCCTCACTTTGGGCCTGG - Intronic
964716040 3:159722916-159722938 CCTGCTCCCCACTTTTCTCCAGG - Intronic
965758941 3:172054339-172054361 CCAGCTACCCAGGTTTAGCCTGG - Intronic
969964780 4:10982999-10983021 CCAGCCCCACACTTTCAGCCTGG - Intergenic
970360161 4:15301338-15301360 ACATCTCCCCACTTTGGGCAAGG + Intergenic
971413100 4:26395997-26396019 TCATCTCCTCACTTTGAGACAGG + Intronic
975390107 4:73806300-73806322 CAACCTCCCAAGTTTGAGCCAGG + Intergenic
977577250 4:98688455-98688477 CCACCTCACCACTTTGAACTGGG + Intergenic
977971985 4:103223729-103223751 CCAGCGCCCCACCCTGGGCCTGG + Intergenic
978289950 4:107126073-107126095 CCTGCTCTTCACATTGAGCCTGG + Intronic
978825791 4:113021908-113021930 TCAGCTTCCCACTTTGAAGCTGG + Intronic
980014297 4:127631225-127631247 CCACCTCGCAAATTTGAGCCTGG - Intronic
982658182 4:158174758-158174780 CGCTCACCCCACTTTGAGCCTGG + Intergenic
984835591 4:184017143-184017165 TCAGAACCCCGCTTTGAGCCCGG + Exonic
985525790 5:401051-401073 CCAACTGCCCGCTCTGAGCCGGG - Intronic
989195241 5:38709849-38709871 CCAGCTCCTCTCTTCCAGCCTGG + Intergenic
994233624 5:97336728-97336750 CCAGCTCATCACATTGAGACTGG - Intergenic
996905526 5:128595523-128595545 CCAGCTATCCCCTCTGAGCCAGG - Intronic
998134133 5:139665841-139665863 CCAGGTGCCCACTCTGGGCCAGG - Intronic
998172162 5:139878917-139878939 CCAGGCACCCACTGTGAGCCAGG + Intronic
999203447 5:149832498-149832520 CCAGCTTCCCACACAGAGCCGGG - Intronic
999302631 5:150500633-150500655 GCACTTGCCCACTTTGAGCCAGG - Intronic
1001381053 5:171306985-171307007 ACAGCTCCCCACTTGGGGGCTGG - Exonic
1002329423 5:178431195-178431217 CCAGCTCCCCACTGGCAGCCTGG - Intronic
1002459822 5:179367773-179367795 CCAGCTCCCCTCTGTGTGGCAGG - Intergenic
1004413387 6:15402288-15402310 CCAGGTATCCAATTTGAGCCAGG - Intronic
1007514989 6:42403972-42403994 CTAGCTCCCAACTTGGTGCCAGG + Intronic
1008232603 6:49001987-49002009 CCTGCTCCTCTCTTTGTGCCAGG + Intergenic
1009778131 6:68232928-68232950 CCCCCTCCCCAGTTTGAGACAGG + Intergenic
1016720829 6:147295618-147295640 CCTGTCTCCCACTTTGAGCCAGG + Intronic
1018108239 6:160509601-160509623 CCAGCTCCCCACTTTATACTTGG + Intergenic
1020676819 7:11193221-11193243 GCAGCTCCCCACTCCCAGCCGGG + Intergenic
1023968995 7:44978054-44978076 CTAGCCCTCCTCTTTGAGCCAGG + Intronic
1024004745 7:45217093-45217115 CCAGATCCCCTCTCTGAGCCTGG - Intergenic
1024619699 7:51146952-51146974 TCAGCTCCCCACCTTGGGCATGG + Intronic
1026025393 7:66740504-66740526 CCAGCGCCCCACCTTTACCCCGG + Intronic
1029401234 7:100347876-100347898 CCTGCATCCCACTTTCAGCCAGG - Intronic
1029547160 7:101216607-101216629 CCAGGTCCCCACGGTAAGCCTGG - Intronic
1029610688 7:101625086-101625108 GCTGATCCCCACTTTGAGCCAGG - Intronic
1030069962 7:105689820-105689842 TCAGCTCCCCTGTATGAGCCAGG + Intronic
1032026415 7:128446134-128446156 CCAGCTCTCCCATTTGACCCTGG - Intergenic
1032505303 7:132429932-132429954 CCAGCTGCCCACTCTGCTCCTGG - Intronic
1033023640 7:137752526-137752548 CCAGCGCCGCACCTTGGGCCTGG + Intronic
1033559434 7:142517143-142517165 CCTGCTCCCCACTTTGTGAGTGG - Intergenic
1033583042 7:142753763-142753785 CCAGCTCCTCACTCTGACCAGGG + Intronic
1033584591 7:142764678-142764700 CCAGCTCCCCACTCTGACCAGGG + Intergenic
1033586070 7:142775235-142775257 CCAGCTCCTCACTCTGACCAGGG + Intergenic
1034193144 7:149226021-149226043 CCGGCTGCCCACTGTGATCCCGG - Exonic
1034958357 7:155349947-155349969 CCGAATCCCCACTTTCAGCCTGG + Intergenic
1036001345 8:4608292-4608314 CCATCTCCCCACTTTGCCCTTGG - Intronic
1037982060 8:23261466-23261488 ACACCTCCCCTCCTTGAGCCTGG + Exonic
1049529263 8:143146335-143146357 CCCTCTCCCCACTTTGAAACGGG + Intergenic
1049582093 8:143417445-143417467 CCGGCTCCACAGTTTGATCCAGG - Intergenic
1052901810 9:33799896-33799918 CCAGCTCCCCACTCTGACCTGGG + Intergenic
1053596840 9:39571446-39571468 CCTACTCCCCGCTTTGAGCTAGG - Intergenic
1053854812 9:42328093-42328115 CCTACTCCCCGCTTTGAGCTAGG - Intergenic
1054569413 9:66793556-66793578 CCTACTCCCCGCTTTGAGCTAGG + Intergenic
1060438966 9:123620386-123620408 CCAGCTGCCTACTTGGTGCCAGG + Intronic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1062004808 9:134233822-134233844 CCAGCTCCCCAGCTGCAGCCAGG + Intergenic
1062444488 9:136587940-136587962 CCAGCACCCCCCTTGCAGCCAGG - Intergenic
1062479234 9:136743826-136743848 CCAGCCCCCGCCTCTGAGCCCGG + Intergenic
1187705569 X:22006323-22006345 CCAGGCCTCCACTTTGATCCGGG + Intergenic
1189034593 X:37482795-37482817 CCAGTTCCCTTCTTTAAGCCTGG + Intronic
1190582621 X:51903508-51903530 CAGGCTCCCCTCTTTCAGCCAGG + Intergenic
1190929106 X:54933544-54933566 CAGGCTCCCCTCTTTCAGCCAGG + Intronic
1192259128 X:69493483-69493505 CCCCCTCCCCACATTGGGCCAGG - Intergenic
1192329745 X:70165695-70165717 CCAGCTGCCTACCCTGAGCCCGG - Intronic
1192442659 X:71186125-71186147 CCTCCTCACCACTCTGAGCCTGG - Intergenic
1199379733 X:147155905-147155927 CCAGCTTGTCACTCTGAGCCAGG - Intergenic
1200069131 X:153519131-153519153 CCAGGTGCCCACTCTGTGCCAGG - Intronic
1200943800 Y:8811365-8811387 CCAGCACCACACTCTGGGCCCGG + Intergenic