ID: 1119770198

View in Genome Browser
Species Human (GRCh38)
Location 14:77215823-77215845
Sequence CAGTAGAAGAAGTAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 0, 2: 0, 3: 78, 4: 852}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119770198 Original CRISPR CAGTAGAAGAAGTAGGAGGA GGG (reversed) Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
900755798 1:4433735-4433757 GATTAGAAGATGCAGGAGGAAGG + Intergenic
900851046 1:5143341-5143363 TAGTAAGAGAAGCAGGAGGAGGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901105386 1:6751863-6751885 GAGTAGGAGGAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
901751705 1:11413945-11413967 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902695542 1:18138403-18138425 CAGTAGCAGTAGTAGGAATACGG - Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902726724 1:18341108-18341130 GAGAAGAAGAAGGAGAAGGAGGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903589617 1:24444756-24444778 CAGTGGAAGAAGTAAGAGCCTGG + Intronic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904295199 1:29515757-29515779 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904920131 1:34000958-34000980 GAGTAGAAAGAGGAGGAGGAAGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905084954 1:35364957-35364979 CAGTAATAGAGGCAGGAGGACGG - Intronic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905842058 1:41189562-41189584 CACCAGAAGAAGGGGGAGGAAGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906900048 1:49825314-49825336 CACAAGAAGAAGGAGTAGGAAGG + Intronic
907044975 1:51295050-51295072 CTGTGGCAGAAATAGGAGGAGGG - Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907734365 1:57097415-57097437 CAGGAGAAGAAGGAGCTGGAGGG + Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908287518 1:62623619-62623641 CAGCTGAAGAAGTAGAAAGAGGG + Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
910000594 1:82336870-82336892 CAGTGGAGGAAGTAAGAGCATGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912422148 1:109550021-109550043 GAGAAGAATAAGTAGGAGTAGGG + Intronic
913588190 1:120297026-120297048 CAGTAGAGAAAACAGGAGGAAGG - Intergenic
913619995 1:120601343-120601365 CAGTAGAGAAAACAGGAGGAAGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914570207 1:148908899-148908921 CAGTAGAGAAAACAGGAGGAAGG - Intronic
914602621 1:149221370-149221392 CAGTAGAGAAAACAGGAGGAAGG + Intergenic
914823643 1:151124951-151124973 AAGCAGAAAAGGTAGGAGGAGGG - Exonic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915620215 1:157077664-157077686 GGATAGAAGAAGGAGGAGGAAGG - Intergenic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
916176147 1:162040629-162040651 CAGTAGAGGAAGGAGTAGCATGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916616377 1:166445531-166445553 CACTAGAAGAAGAAGAAGGAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916657077 1:166885796-166885818 CAAGAGGAGAAGGAGGAGGAGGG - Intergenic
917392787 1:174557465-174557487 AAGTAGTAGAAGTAGAATGACGG - Intronic
917687972 1:177437387-177437409 CAGTGGAAGAAGTATGAGCTTGG - Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918784748 1:188750933-188750955 CAGTAGAAAAAGGGAGAGGAGGG - Intergenic
919282539 1:195509780-195509802 CAGTAGAATAACTGGAAGGAAGG + Intergenic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919802008 1:201359764-201359786 CAGGAGGAGAAGGAGGAGCATGG + Intronic
920154216 1:203935139-203935161 CAATAGGTGAAGTAGGAGTAGGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
922486900 1:225980439-225980461 TACTAGAAGAGGAAGGAGGAAGG + Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923243498 1:232108842-232108864 CAGTAGAGTAAGTTGGGGGAGGG + Intergenic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923600134 1:235395525-235395547 AAGAAGAAGAAGTAGAATGATGG - Intronic
924006353 1:239615939-239615961 GAGAGGAAGAAGTAGAAGGAAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924654027 1:245956645-245956667 GAGGAGGAGAAGTAGAAGGAGGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064040788 10:11961495-11961517 CAGCAGAAGAGGGAAGAGGAGGG + Intronic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1064315726 10:14254198-14254220 CTGGAGTTGAAGTAGGAGGAAGG - Intronic
1064516925 10:16160065-16160087 CAGGAGTAGAAGTAGGAACATGG - Intergenic
1064927277 10:20582694-20582716 AAGCAGAGAAAGTAGGAGGAGGG - Intergenic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1067902329 10:50255235-50255257 AAGAAGAAGAAGTAGGAAGGGGG + Intergenic
1068005060 10:51383307-51383329 GAGTAGAAGAAAGAGAAGGAGGG + Intronic
1068042759 10:51846993-51847015 AAGTAGATCAAGTAGGAGGCTGG + Intronic
1068395726 10:56458727-56458749 AAAAAGAAGAAGTAGGAGGAGGG + Intergenic
1068451214 10:57191643-57191665 CAGCAAAAGCCGTAGGAGGAGGG - Intergenic
1068595103 10:58894802-58894824 GAGTAAAAGAGGGAGGAGGATGG + Intergenic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070267984 10:74923224-74923246 GAGTAGGAGAAGTAGAAGGGAGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070523520 10:77275522-77275544 CAGAAGCAAAATTAGGAGGATGG + Intronic
1070667355 10:78354586-78354608 GGGTAGTAGAAGTAGGATGAAGG + Intergenic
1070853160 10:79584163-79584185 CAGCAGGAGAAGCAGGAGAAGGG + Intergenic
1071420314 10:85489906-85489928 CAGAAAAAGAGGTTGGAGGAAGG + Intergenic
1071503935 10:86221885-86221907 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1071823927 10:89305743-89305765 CAGCAGAAGAATTAGGGCGAGGG - Intronic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071858243 10:89646878-89646900 GAGTACAAGGAGTAGGAAGAGGG - Intergenic
1071923119 10:90374043-90374065 CACTAGAGGAAGGTGGAGGAGGG - Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1072158343 10:92743919-92743941 TTGTAGGAGAAGTAGGGGGAGGG + Intergenic
1072567128 10:96626037-96626059 GAGTATTAGAAATAGGAGGAGGG - Intronic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075453662 10:122570656-122570678 CAGCAGAAGAGGTTGGGGGAGGG + Intronic
1075453862 10:122572080-122572102 CAGCAGAAGAGGTTGGGGGAGGG + Intronic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1076034067 10:127184373-127184395 CAGTAGGAGAAGCAACAGGAAGG - Intronic
1076224836 10:128765608-128765630 CATTAGAAGAAATTGGATGAAGG + Intergenic
1076302471 10:129438467-129438489 CAGAAGAACAAGTGGGACGATGG + Intergenic
1077165863 11:1137999-1138021 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1077613800 11:3660935-3660957 CAGAAGAAGAACCATGAGGATGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078717517 11:13854126-13854148 CAGAACAAGAGGTAGAAGGAAGG + Intergenic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1080274007 11:30483175-30483197 CAGTAGAATAAGTAGAAAAATGG - Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080532326 11:33189062-33189084 CAGTAGGAAAATTAGGAGCAGGG + Intergenic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1081127238 11:39336612-39336634 AAGTAGAAGTAGTAGGAGCTGGG - Intergenic
1081180724 11:39983519-39983541 CAGAAGGTGAAGCAGGAGGAGGG - Intergenic
1082069905 11:47930913-47930935 GAGTTGAAGAAGGAGGAAGAAGG - Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082303245 11:50537461-50537483 CAGTATAAAAACTAGAAGGAAGG - Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1082775221 11:57239444-57239466 CAGGAGAAGAACCAAGAGGATGG + Intergenic
1082965795 11:58965004-58965026 CAATGGAAGAAGTGGCAGGAAGG - Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084840468 11:71842510-71842532 GAGTAGAGGAAGTAGCAGAAAGG + Intergenic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086950882 11:92889158-92889180 CAGGAAAAGAAGTCGGAGGTAGG - Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087737467 11:101851252-101851274 CAGTAGAAGAGGTAGGGAGCAGG - Intronic
1088620081 11:111672592-111672614 CACTAGAAGAGGAAGGAAGATGG + Intronic
1088645450 11:111913216-111913238 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089251268 11:117163810-117163832 CAGCAGAAGAAGTAGCAGGTGGG + Exonic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092743826 12:11654634-11654656 GAGAAGAGGAAGTAGTAGGAGGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093754968 12:22842202-22842224 GAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094491093 12:30961176-30961198 CAGCAGAAGAGGCAGGAAGAGGG - Intronic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095879223 12:47114599-47114621 CAGTAGCAGAAGTAGTGGGGAGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098237899 12:68435625-68435647 GAGAAGAAGAAGTAAGAGGGAGG + Intergenic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098428158 12:70389742-70389764 CAGTATGAGAAGTAGGCAGATGG - Intronic
1098445873 12:70564971-70564993 AAGTAAAAGATGTAGGAGGTTGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1098860163 12:75700325-75700347 GAGGAGGAGGAGTAGGAGGAGGG + Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099284351 12:80697640-80697662 GAGTAAAAGAAGGAGGAAGAGGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099537817 12:83866512-83866534 CAACATAAGAAATAGGAGGATGG - Intergenic
1100428926 12:94512993-94513015 CAGAAGACGAAGGAGGAGCAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1101750626 12:107580331-107580353 CACTGGAAGAAATAGGAAGATGG + Intronic
1101920126 12:108925650-108925672 CAGGGGAAGAAGTAGAAGGTGGG - Intronic
1102408760 12:112698807-112698829 AAGTAGGAGAAGGAGAAGGAGGG - Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102679817 12:114683870-114683892 GAGCAGAGGAAGGAGGAGGAGGG - Intronic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1104092699 12:125529081-125529103 CAAAAGAAGAAGGAAGAGGAAGG - Intronic
1104272032 12:127290937-127290959 AAGTTGAAGAAGCAGAAGGATGG - Intergenic
1104310044 12:127646409-127646431 GAGAAGAAGAAGCAGGTGGAGGG + Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106006511 13:25775199-25775221 CAGGAGGAGAGCTAGGAGGAAGG - Intronic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106818258 13:33433950-33433972 CAGTAGTAGAAGTTTGTGGATGG + Intergenic
1106938247 13:34747739-34747761 CAGTAGAGGAAGCAGCAGAAAGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107454150 13:40538520-40538542 CAGTAGGAGAAGCTGGATGAAGG - Intergenic
1107526109 13:41233280-41233302 GAGTAGAGGAAGTAGGAAGAGGG + Intronic
1107588509 13:41879305-41879327 CAGCAGCAGAAAGAGGAGGAGGG - Intronic
1108291034 13:48961370-48961392 GAGAAGAAGAAGGAGGAAGAGGG + Intergenic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1109921133 13:69061207-69061229 AAGAAGGAGAAGTAGGAGAAAGG + Intergenic
1110041291 13:70762383-70762405 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1111912709 13:94329769-94329791 GAGGAGGAGGAGTAGGAGGAAGG - Intronic
1112142499 13:96660908-96660930 AGGTAGAAGAAGTGGGAAGAAGG + Intronic
1112236301 13:97640917-97640939 CATGAGAAAAAGTAGGATGATGG - Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112622660 13:101067347-101067369 GAGGAGGAGGAGTAGGAGGAAGG + Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112763237 13:102713793-102713815 CAGTAAAAGAGGCAAGAGGAGGG + Intergenic
1112814126 13:103252137-103252159 CAGTAGATGAAGGAGCAAGAAGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113898837 13:113784545-113784567 AAGAAGAAGAAGGAGGAGAAGGG + Intronic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119725978 14:76922134-76922156 CAGTAGAGGACGGTGGAGGATGG + Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1119977845 14:79045231-79045253 CAGTAGGAGATGAAGAAGGAGGG - Intronic
1119994396 14:79237170-79237192 CAGTAGAGGAATTTGGAAGAAGG + Intronic
1120209160 14:81617311-81617333 CAGTAGAATAAGCAGTAGGATGG + Intergenic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121613128 14:95294669-95294691 AGGAAGATGAAGTAGGAGGAGGG - Intronic
1122016785 14:98803276-98803298 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1122357385 14:101131892-101131914 CCTAAGCAGAAGTAGGAGGAGGG - Intergenic
1122581563 14:102775021-102775043 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124591585 15:31058669-31058691 CAGGAGAGGAAGGAGGAGTATGG + Intronic
1124986396 15:34620349-34620371 AAGTAGAGGAAGTGGGAGGGAGG - Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126339841 15:47627178-47627200 AAGTAGGAGGAGTGGGAGGAAGG + Intronic
1126406370 15:48327008-48327030 CAATAGAGGAGGTAGGAAGAAGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127434341 15:58942211-58942233 AAATAAAAGAAGTAGAAGGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128704580 15:69829227-69829249 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129162479 15:73754123-73754145 CAGAAGCAGAAATGGGAGGAGGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130080023 15:80724754-80724776 GAGAAGGAGAAGGAGGAGGAGGG - Intronic
1130949086 15:88571513-88571535 AAGTTGAAGAGGTAGGAAGAGGG + Intergenic
1131066390 15:89437263-89437285 AGGTAGAAGAAGGAGGAAGAGGG - Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131319790 15:91376351-91376373 AATGTGAAGAAGTAGGAGGAAGG + Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1132220293 15:100100256-100100278 GAGTCGAAGAAGCAAGAGGAGGG - Intronic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133514870 16:6498805-6498827 CAGGAGAAGAACTAGCAGGTGGG - Intronic
1133599331 16:7323788-7323810 AAGATGAAGATGTAGGAGGAAGG + Intronic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1135014288 16:18911202-18911224 CACTAGAAAATGTAGAAGGAGGG + Intronic
1135550130 16:23391529-23391551 CAGAAGAAGAACTAGAAGCAAGG - Intronic
1135942452 16:26834310-26834332 GAGAAGAAGAAGGAGGGGGAGGG + Intergenic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136548675 16:30969885-30969907 CAGCAGAAGAGGGAGCAGGAGGG - Intronic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137617498 16:49856230-49856252 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1137808164 16:51327132-51327154 CAGTAAAAGAAGCTGGAGAACGG - Intergenic
1137822108 16:51456062-51456084 GAGAAGAAGAAGGAGGAGCAGGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137961081 16:52882946-52882968 CATCAGAAGAAGGAGGAGAATGG - Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138153974 16:54685892-54685914 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1138188559 16:54995898-54995920 CTGTGGGAGAAGTAGGAGGTGGG + Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138708416 16:58941377-58941399 GAGTAGGAAGAGTAGGAGGAGGG - Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1138964873 16:62072091-62072113 CAGTGGAAGAAGCTGGGGGAAGG - Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1140127591 16:72131158-72131180 TAGAAAAAGAAGTGGGAGGAAGG + Intronic
1140212842 16:72984252-72984274 CAGTAGATAGACTAGGAGGAAGG - Intronic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140433133 16:74921946-74921968 CAGTGGAGGAAGCAGAAGGAAGG - Exonic
1140675422 16:77324165-77324187 CAGAAGAGGAAGTAAAAGGAGGG + Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142426767 16:90005752-90005774 GAGTAGAAGAAGGGGCAGGATGG + Exonic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143158657 17:4854675-4854697 CAGTTCTAGAAGTAGAAGGAAGG - Intronic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143510595 17:7393442-7393464 AAGTAGAAGGAGTGGGAGGTTGG - Intronic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1144146491 17:12404254-12404276 CAGCAGATGAAGTATGAGGTGGG + Intergenic
1144225547 17:13141538-13141560 AAGGAGAAAAATTAGGAGGAAGG - Intergenic
1144676980 17:17168114-17168136 CAGGAGGAGAACTAGCAGGAGGG + Intronic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146503429 17:33384010-33384032 AAGTAGAGGAACTAGAAGGAAGG + Intronic
1147053979 17:37819716-37819738 CAACAGAAGAAGGAGGAAGAGGG - Intergenic
1147264742 17:39227760-39227782 CAGTGGCAGAAGTAGGACAAGGG + Intergenic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147675823 17:42204855-42204877 CATTAGAAGGCGGAGGAGGAAGG - Intronic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151226111 17:72649391-72649413 CAGTAGGAGAGGAAGGAGAAAGG + Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1155016800 18:21850495-21850517 AAGTAGAAGAAGCAGGGGCAAGG - Intronic
1155927542 18:31673106-31673128 CACTAAAAGAAGCAAGAGGAAGG + Intronic
1156077349 18:33296509-33296531 CATTGGAAGAAGCTGGAGGAAGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1158096434 18:53777542-53777564 CAGTAAAAGGAGTACCAGGAGGG - Intergenic
1158600427 18:58851702-58851724 CAGTGAATGAAGTTGGAGGAAGG + Intergenic
1159165933 18:64700102-64700124 GCTTAGAAGAAGTAGGAGAATGG + Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1160159521 18:76460582-76460604 CAGTAAAAAAACTGGGAGGAAGG + Intronic
1160211274 18:76882188-76882210 CAGAGGAAGAGGTAGAAGGAAGG - Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160973930 19:1783251-1783273 CAGGAGGAGAAGGTGGAGGAGGG - Exonic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162053054 19:8046701-8046723 GAGGAGGAGAAGGAGGAGGAAGG - Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163197694 19:15735216-15735238 CAGAAGGAGAAGGAGAAGGAGGG - Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163465805 19:17467991-17468013 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1164486699 19:28662994-28663016 CAGTAAAAGTAGCAGTAGGAAGG - Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1165468763 19:35990799-35990821 GACTAGGAGAAGGAGGAGGAAGG + Intergenic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166167765 19:41004247-41004269 TTGTAGAAGAAGTTGGAAGAAGG - Intronic
1166322499 19:42027337-42027359 CAGGAGAAGACCTAGGGGGAAGG + Intronic
1166387514 19:42390435-42390457 CAGGAGGAGAAGTGGGGGGATGG - Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925260181 2:2521967-2521989 CAGATGAATAAGTAGGTGGATGG - Intergenic
926384196 2:12319841-12319863 CTGGAGATGAAGTAGGTGGAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
928024507 2:27728707-27728729 CATTGGAAGGAGTAGGGGGATGG - Intergenic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929717083 2:44323337-44323359 CATTAGAAGAATTAGAAGAATGG - Exonic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
930203397 2:48565346-48565368 CTGTATAAGAAGTCGGAGGCTGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930411621 2:51032161-51032183 GAGGAGGAGAAGGAGGAGGAGGG + Exonic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
931681787 2:64756007-64756029 AAATAGAAGAATTAGAAGGAAGG + Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932116235 2:69050947-69050969 CAATATAAGAAGCAGAAGGAAGG - Intronic
932968874 2:76514091-76514113 CAGTAGGAGTTGTGGGAGGAAGG - Intergenic
933158740 2:79001650-79001672 CAGAGGAGGAAGTAAGAGGAGGG + Intergenic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933729654 2:85447088-85447110 CAGTGGTAGATGTAGGAGGCTGG + Intergenic
933906773 2:86901925-86901947 CAGTTTAAGAAGTATGAAGAGGG + Intergenic
934024703 2:87991709-87991731 CAGTTTAAGAAGTATGAAGAGGG - Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
935366636 2:102298840-102298862 CGGTAGGAGAAGTTGAAGGATGG - Intergenic
936365391 2:111849746-111849768 CAGTTTAAGAAGTATGAAGAGGG - Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937579086 2:123461538-123461560 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939462913 2:142519673-142519695 GAGGTGAAGGAGTAGGAGGAGGG + Intergenic
939753057 2:146072823-146072845 GAATAGAAGAAGGTGGAGGAAGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940220888 2:151350143-151350165 CAGTACAACAGGTAGGATGAAGG - Intergenic
940736788 2:157462645-157462667 AAGAAGAAAAAGTAGCAGGAGGG + Intronic
940786423 2:157986458-157986480 TAATAGAAGAAGAAGAAGGATGG + Intronic
940940478 2:159554698-159554720 CAGTTGAAGAAGCAGGATCATGG + Intronic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942682292 2:178490110-178490132 CAGGAGAAGAGGTAGAAAGAGGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
944817786 2:203396813-203396835 CAGATGCAGAAGTAGCAGGAAGG - Exonic
945138831 2:206661535-206661557 GAGAAGAAGAGGGAGGAGGAGGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945943813 2:215975100-215975122 CTGCAGTAGAAGTAGGTGGAGGG - Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947530868 2:230907938-230907960 CAGAGAAAGAAGTGGGAGGAGGG + Exonic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169808234 20:9581237-9581259 AGGTAGAAGAAGTAGGGGGAAGG - Intronic
1169850280 20:10041453-10041475 AAGTAGCAGAGGTAAGAGGAAGG - Intronic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1172905243 20:38364276-38364298 AAGTAGGGGAAGAAGGAGGAGGG - Intronic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1174400901 20:50275272-50275294 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177905492 21:26967267-26967289 AGGGAGACGAAGTAGGAGGAAGG + Intergenic
1178219696 21:30642302-30642324 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1178225849 21:30717538-30717560 AAGTAGAAGGAGGAGGAGAAGGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179346627 21:40564473-40564495 AAGTAGAGGAAGGAGGAGGGTGG - Intronic
1179658774 21:42861704-42861726 CAGTGGAAGAAATTGGAGGGAGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181536813 22:23550571-23550593 CAGAGGAATAAATAGGAGGATGG - Intergenic
1181544421 22:23593270-23593292 CAGTAGAAGAAGTCAATGGAAGG + Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182043666 22:27258021-27258043 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182308528 22:29388375-29388397 CAGGAGAAGAAGTGGGGCGAGGG - Intronic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949628537 3:5895489-5895511 CAGATGGGGAAGTAGGAGGATGG - Intergenic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952107585 3:30087736-30087758 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
952948626 3:38498783-38498805 CAGTAGATGAATGAGGGGGAAGG + Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
953910241 3:46889105-46889127 CAGTAGTAGAACCTGGAGGAGGG + Intronic
954111670 3:48437009-48437031 CAGTAGAAGGAAGAGGATGAGGG - Intronic
954839475 3:53497678-53497700 TAGTAGTAGTAGTAGGGGGAGGG + Intronic
954894341 3:53963311-53963333 CAGCAGAAGAGGCTGGAGGAAGG + Intergenic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955506935 3:59641828-59641850 CTGCAGAGAAAGTAGGAGGAAGG - Intergenic
955660124 3:61289865-61289887 GAGGAGAAGAAATAGGACGAAGG + Intergenic
955884023 3:63578369-63578391 CAGGTGAAGAAGTAGGTGTAAGG + Intronic
956198845 3:66684173-66684195 AAGTAGAAGAAGGAGAAGGAGGG - Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
957408047 3:79797408-79797430 CAGTACAAAAAGTAGAAGGAGGG - Intergenic
957582535 3:82092961-82092983 AAGTACTAGAAGGAGGAGGAAGG - Intergenic
957589517 3:82177554-82177576 TGGTAGAAGAAATAGGAGGGGGG - Intergenic
957899926 3:86476169-86476191 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
957970563 3:87376508-87376530 CAGTAAAAGAAGTATGGGAATGG - Intergenic
957975419 3:87437252-87437274 CAGAACAAGATGTAGGAAGAGGG + Intergenic
958560132 3:95737960-95737982 CAGAAGAAGAAGCAGGCAGAGGG - Intergenic
958932027 3:100217455-100217477 AACTCCAAGAAGTAGGAGGAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959246942 3:103882567-103882589 CAATAGAAGAAGGAGGAGAAAGG + Intergenic
959330967 3:105004301-105004323 CAGTAGGAGGAGTGGGAGAAAGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960545829 3:118914187-118914209 CAGTAGAAGATATGGGAAGAGGG + Intronic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
965165652 3:165192787-165192809 CAGTAGAGGAGGGAGGAGAAGGG + Intronic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965550087 3:169955748-169955770 CAGTTGAGCAAGTAGGAGGGGGG - Intergenic
965622262 3:170653778-170653800 AAGAAGAAGAAGGAGGAGAAGGG - Intronic
966240288 3:177748172-177748194 AAGTAGAAGATGCAGCAGGATGG + Intergenic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966683385 3:182667433-182667455 CAGTAGCGGCAGTAGGTGGAGGG - Intergenic
966908546 3:184544673-184544695 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
967289653 3:187906555-187906577 CAGTAGAAGAAGCAGTGGAAAGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968095667 3:195928556-195928578 GAGCAGAAGAAGGAGAAGGAAGG - Intergenic
968748661 4:2374636-2374658 GAGAAGGAGAAGGAGGAGGAGGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969425202 4:7120247-7120269 AAGTAGCAGAAGTAGCAGGCAGG + Intergenic
971262737 4:25071670-25071692 AAGGAGATGAAGTTGGAGGAAGG - Intergenic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
974229244 4:59088853-59088875 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974383621 4:61175772-61175794 CAGTTGAATAAGTAAGAGAAAGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976295675 4:83468878-83468900 CAGTAACAGGAGTATGAGGAAGG + Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
977437042 4:97011391-97011413 CACTAGAAGATGTATGGGGATGG - Intergenic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
978086031 4:104656609-104656631 CAGTAGAAGAAGTGTGGTGATGG + Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979720575 4:123895293-123895315 CAGCAGAAGAAGGAAGAGCAAGG - Intergenic
980030988 4:127830034-127830056 AAGTCAAAGAAGTGGGAGGATGG - Intronic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980878287 4:138684199-138684221 CAGGAGCAGAAGTAGGAACAGGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
982232490 4:153222095-153222117 CCGTAAAAGAAGTTGGAGTAGGG - Intronic
982261487 4:153498126-153498148 TGGGAGAAGATGTAGGAGGATGG + Intronic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
983120366 4:163876440-163876462 CAGTAGTGGAAGTAGTTGGAGGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983973662 4:173904863-173904885 CTGTAGAATAAGTAGGAGAGGGG - Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984346046 4:178527458-178527480 CAGCAGAAAAAATAGGAGGTAGG + Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985196214 4:187432486-187432508 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985196228 4:187432555-187432577 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985208386 4:187565669-187565691 CAGCAGCAGAGGTAGGAGGAAGG - Intergenic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986494061 5:8323785-8323807 CAGGGGAGGAAGTAGAAGGAAGG + Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987165677 5:15195478-15195500 CAGAAGGTGAAGGAGGAGGAAGG + Intergenic
987353221 5:17039920-17039942 GAGGAGGAGAAGGAGGAGGATGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987987606 5:25168879-25168901 CACTAGATGAAGCAGGAGAAGGG + Intergenic
988015073 5:25545791-25545813 GACTAACAGAAGTAGGAGGAGGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988660150 5:33257657-33257679 CAGCATATGAATTAGGAGGATGG - Intergenic
989199527 5:38750031-38750053 CAGCAGAGGAAGTTGGGGGAGGG - Intergenic
990174926 5:53097131-53097153 CGGCAGAGGAAGTAGGCGGAGGG + Intronic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990490539 5:56298840-56298862 CTGTAGCAAAAGTAGCAGGATGG + Intergenic
990981452 5:61605863-61605885 CAGTGTAAGAATTAAGAGGATGG + Intergenic
991019941 5:61970076-61970098 CTTTAGAAGAAGTAGGAATATGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991251010 5:64561220-64561242 AAGTTGAAGAACTAGGAGTAGGG + Intronic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995733521 5:115272342-115272364 CAGAAGAAGAATTAAGAGTAGGG + Intronic
995753793 5:115480301-115480323 TAGTAGCAGAAGCAGGAGGAAGG - Intergenic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996798402 5:127376022-127376044 CTGTAGAAGAAGTAGATTGAGGG + Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997873021 5:137521924-137521946 AAGTAGAAGAAGTAGGAGTGGGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998520807 5:142798764-142798786 CAGTAGAAAAAGGAGAAGCATGG - Intronic
999000505 5:147916777-147916799 AAGAAAAAGAAGTAAGAGGATGG + Intergenic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000194280 5:158942900-158942922 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000194291 5:158942949-158942971 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1003057455 6:2834943-2834965 CATTAGAAGAAGTAGAGTGATGG - Intronic
1003414930 6:5898959-5898981 CAGCAGCAGAAGGTGGAGGAAGG - Intergenic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1004973418 6:20937191-20937213 CAGGAGCTGAAGTAGGAGGATGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005285745 6:24324980-24325002 CAGCACAAGAAGTAGAAGAAAGG + Intronic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007997602 6:46325222-46325244 AAGTAGAATAAGTTGGAAGAGGG - Intronic
1008666454 6:53721738-53721760 CAGGAGAAGAACTCGAAGGAAGG + Intergenic
1008829941 6:55746918-55746940 GAGTAGAAAAAGTTGGAGAAGGG + Intergenic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009061874 6:58406409-58406431 CAGGATAAGAACTAGAAGGAAGG - Intergenic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009450641 6:63796131-63796153 CAGTAGGAGAAACAGCAGGACGG - Intronic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1011664514 6:89621745-89621767 CAGGACAAGACCTAGGAGGATGG + Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012325973 6:97917969-97917991 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012665698 6:101965779-101965801 AAGTATAGGAGGTAGGAGGAAGG + Intronic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012800226 6:103817272-103817294 TAGTAGTGGAAGTAGCAGGATGG - Intergenic
1013356747 6:109351940-109351962 CAGGAGAATAATTAGGAGAAGGG - Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013901090 6:115156676-115156698 GGGTAGAAGAAGCAGGAGAAAGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014205446 6:118651317-118651339 CCGCCGAAGAAGCAGGAGGACGG - Intronic
1014304916 6:119727990-119728012 GGGTAGAAGAAGCAGCAGGAAGG - Intergenic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015483246 6:133739651-133739673 AAGTAAGAGAAGTAGGAAGAAGG + Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1018214678 6:161515161-161515183 CAGTAGATGCAGTTGGAGGAAGG - Intronic
1018928786 6:168225898-168225920 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1019437098 7:1028009-1028031 CAGGAGAGTAAGTGGGAGGAGGG + Intronic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1020514133 7:9094764-9094786 AGGTAGAGGAAGTGGGAGGAGGG + Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020787691 7:12591147-12591169 CAGTGGAAGAATGAGTAGGAAGG + Intronic
1021116115 7:16748099-16748121 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021723511 7:23528587-23528609 AAATAGAAGAAATAGGGGGAGGG - Intronic
1022035431 7:26529578-26529600 CAGAACAAGAGGTTGGAGGAAGG - Intergenic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1022971164 7:35518608-35518630 CTCTTGAAGAAATAGGAGGATGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023412172 7:39899043-39899065 GAGGAGGAGAAGTAGGAGGAGGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1024117088 7:46204793-46204815 AAGTAGAAGATGTAGGAACATGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025284352 7:57650147-57650169 GAGCAGAAGAAGCAGGAGGGAGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026191905 7:68136490-68136512 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026470539 7:70691515-70691537 CAGCATCAGAAGTAGGAAGAAGG - Intronic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027832604 7:83199140-83199162 CAGTGGAAGAAGGAGGGGCAAGG + Intergenic
1028094412 7:86742541-86742563 AAATAGAAGATGTAAGAGGAAGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1029575606 7:101401489-101401511 GACTAGAAGAAGGAAGAGGAGGG + Intronic
1029802734 7:102966704-102966726 CAAAAGCAGAAATAGGAGGATGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031556444 7:123182466-123182488 CAGTGGAGGAAGTGGGTGGAGGG - Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031820606 7:126496737-126496759 CAGTTGCAGAACTAGTAGGATGG + Intronic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032025937 7:128442602-128442624 CAGTTAAATAAGTAGGAGGTAGG + Intergenic
1032066338 7:128774359-128774381 CAGCAAAGGAAGTAGGAGGAGGG - Intronic
1032439768 7:131933426-131933448 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1032515033 7:132500461-132500483 GAGAAGAAGAAGGAGGGGGAGGG + Intronic
1032523515 7:132562972-132562994 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523545 7:132563110-132563132 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033742283 7:144284476-144284498 CAGGAGCAGAAATGGGAGGAAGG + Intergenic
1033751619 7:144365138-144365160 CAGGAGCAGAAATGGGAGGAAGG - Exonic
1033863098 7:145653691-145653713 AGGAAAAAGAAGTAGGAGGAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034247973 7:149663338-149663360 AAGTAGAAGAAGCAGTAAGAAGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036229885 8:6990685-6990707 GACTAGGAGAAGGAGGAGGACGG - Intergenic
1036232336 8:7009788-7009810 GACTAGGAGAAGGAGGAGGACGG - Intronic
1036401235 8:8410328-8410350 TGGTTGGAGAAGTAGGAGGAAGG - Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037714019 8:21381743-21381765 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038234314 8:25737153-25737175 GAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1039691304 8:39867669-39867691 GAGAAGAAGAAGGAGGGGGAAGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039884400 8:41646960-41646982 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041441015 8:57896998-57897020 AAGCAGGAGAAGGAGGAGGATGG - Intergenic
1041755336 8:61307463-61307485 AAGATGAAGAAGTATGAGGAAGG + Intronic
1042130425 8:65582480-65582502 AAGAAGAAGAAGGAGGAGAAGGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042937346 8:74073226-74073248 CAGGAGAAGAAGCTGAAGGAGGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044394620 8:91696187-91696209 TGGAAGAAGAAGTAGGAGAAGGG - Intergenic
1044661626 8:94597008-94597030 CATTAGAAGAAGTTGGGTGAAGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1045597985 8:103678536-103678558 CATGAGAATAAGTAGGAGTATGG + Intronic
1045951461 8:107856029-107856051 CAGATGAAGAAGCTGGAGGATGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046216492 8:111154086-111154108 AAGTAGATGAAGTAGTAGGAAGG - Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050139703 9:2504545-2504567 CTGAAGAAGAGGTAGGACGAAGG - Intergenic
1050233741 9:3556354-3556376 TAGTAGAAGAGGTTGGAGGTGGG + Intergenic
1050475942 9:6041107-6041129 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050734470 9:8747628-8747650 CAGAAGAAGAAATAGAATGAAGG + Intronic
1050826334 9:9951105-9951127 TAGAATAAGATGTAGGAGGAGGG + Intronic
1051516713 9:17937922-17937944 AAGTAACAGAAGTATGAGGAGGG + Intergenic
1052814666 9:33092251-33092273 AAGGAGGAGAAGTAGAAGGAGGG - Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053161603 9:35817335-35817357 CAGTAGCAGACGTAGGGGCAGGG - Exonic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1055192533 9:73542936-73542958 TAGTAGAAGAAATAGGGTGAGGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1056236970 9:84604361-84604383 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058144132 9:101392156-101392178 CAGCAGAAGCAGTAGTAAGAGGG + Intronic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058944768 9:109846107-109846129 CATTGGAAGAATGAGGAGGAAGG + Intronic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1061245001 9:129397087-129397109 CAGAGGAATAAATAGGAGGATGG + Intergenic
1062014839 9:134286161-134286183 CAGTAGGCGAGGAAGGAGGATGG - Intergenic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062343277 9:136103306-136103328 CACTGGAAGAAGGTGGAGGAGGG - Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185540500 X:899418-899440 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186183778 X:6998896-6998918 CAGATGAATAAGTAGGAGAAAGG + Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1187025805 X:15434227-15434249 AGATAGAAGAAGGAGGAGGAAGG + Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187830249 X:23374013-23374035 GAGTAGAAGAAGTGGGAAGGGGG + Intronic
1188068808 X:25694902-25694924 CAATACAAGAGGTGGGAGGACGG - Intergenic
1188113373 X:26217044-26217066 CAGGAGAATGAGTAGGAGAACGG - Intronic
1188153306 X:26707175-26707197 CAGTATAAAAAGTATGAGGAAGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189930759 X:46006717-46006739 CAGTTGATAAAGTAGGAGCAGGG - Intergenic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192141670 X:68651665-68651687 CAGCTGAAGAGGTATGAGGAGGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192847999 X:74925493-74925515 GAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193168922 X:78314185-78314207 ATGTGGAAGAATTAGGAGGAAGG + Intronic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197129225 X:122985121-122985143 GAGTAGACTAAGGAGGAGGAGGG + Intergenic
1197327049 X:125106874-125106896 GAGTAGTAGGAGTAGGAGAAAGG + Intergenic
1198216707 X:134562044-134562066 CAGGTGAAGATGTAGGAGGAGGG - Intergenic
1198446927 X:136726638-136726660 CAGTAGAAAATGTGGGAGGAAGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200002511 X:153069324-153069346 AAGTAGGAGGAGGAGGAGGAAGG + Intergenic
1200005213 X:153080686-153080708 AAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic