ID: 1119770707

View in Genome Browser
Species Human (GRCh38)
Location 14:77219203-77219225
Sequence CTCAGCAATGAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119770707_1119770711 -3 Left 1119770707 14:77219203-77219225 CCTTCCTCTTTCTCATTGCTGAG 0: 1
1: 0
2: 1
3: 54
4: 452
Right 1119770711 14:77219223-77219245 GAGGTCTTCAAGGCACATTCTGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119770707 Original CRISPR CTCAGCAATGAGAAAGAGGA AGG (reversed) Intronic
900487870 1:2932026-2932048 CTCAGCCTTGAGGGAGAGGAGGG - Intergenic
900907918 1:5573801-5573823 CTCAGCAAGAAGAATGAGGTAGG + Intergenic
902160890 1:14529621-14529643 CTCAGCAGTCAGGAAGAGAAAGG + Intergenic
903021471 1:20398247-20398269 CCCAGGAATGATAATGAGGATGG + Intergenic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904885161 1:33732194-33732216 CTCAGCAATAAGACAAAAGAGGG + Intronic
905040522 1:34953329-34953351 ATCAGAAATGAGAAAGATTATGG + Intergenic
905120310 1:35676764-35676786 CTCAGTTGTGAGAAAGATGATGG + Intergenic
905322598 1:37128521-37128543 ATCAGCAACGAGAGAGATGAAGG - Intergenic
905668272 1:39775348-39775370 CTCAGAGATGAGACAGAGGAGGG + Intronic
906039919 1:42780775-42780797 CTTAGCAGAGATAAAGAGGAGGG - Intronic
906270047 1:44470217-44470239 CTCAAGAGTGACAAAGAGGAAGG + Intronic
906277984 1:44532301-44532323 CTCAGCAATGAGACAAGGTAGGG - Intronic
906863641 1:49391182-49391204 ATCAGAAATGAGAATGAAGAAGG + Intronic
906987486 1:50700184-50700206 TGTAGCAATGAGAAAGAGAAAGG - Intronic
907247468 1:53117165-53117187 CGCAGCAGTGAGACAGTGGAAGG + Intronic
907282446 1:53359934-53359956 CTGAGCAAAGAGGTAGAGGAGGG - Intergenic
909078830 1:71085225-71085247 TTCAGCAAAGAGACAGAGAAAGG - Intergenic
910156133 1:84222562-84222584 CACATAAATGAGAAAGAGAAAGG - Intronic
911092768 1:94030875-94030897 TTCACCAATGAGAGAGGGGAGGG - Intronic
912040536 1:105384074-105384096 CTCAGAACTGAGAGAGAGCATGG - Intergenic
912520109 1:110239356-110239378 CTCAGCCAAGAGAAGGAGGTGGG - Intronic
913940199 1:125096235-125096257 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
914918626 1:151833065-151833087 ATGAGTAGTGAGAAAGAGGAGGG + Intergenic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915563602 1:156701638-156701660 CACAGCAATGAAAGAGAGCAGGG + Intronic
915718896 1:157969185-157969207 CTCTGCCATGAGCAAGAGGCAGG + Intergenic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916662207 1:166933103-166933125 GTTAGCAAGGAAAAAGAGGAAGG - Intronic
920284177 1:204867964-204867986 CTCAGCACTGAGTAGGAGGTAGG - Intronic
922067970 1:222162534-222162556 CTCAGGAAAGATAAAGATGAAGG - Intergenic
922069267 1:222174883-222174905 CTCAGCGAAGACAAAGATGAAGG - Intergenic
922939821 1:229452865-229452887 CACAGCAACGAGAAATAGGAGGG + Intronic
924358298 1:243208062-243208084 CTGAGCAATATGAAAAAGGAAGG - Intronic
924582835 1:245336273-245336295 CTCAGAAAGAAGAGAGAGGAAGG + Intronic
924928090 1:248703015-248703037 GTAAGCAATGAGAATGAGCAAGG - Intergenic
924945298 1:248842507-248842529 CTGAGCAATGAGTACGAGGGAGG + Intronic
1062907318 10:1187571-1187593 CTCCGCAAAGAGAAAGGAGAGGG - Intronic
1063157786 10:3396190-3396212 CCCATCAGTGAGACAGAGGACGG - Intergenic
1063163006 10:3433466-3433488 CTCAAGAATGAGACAGGGGAAGG + Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1066540058 10:36436753-36436775 CCCAGAAATGACAAAGAGGTTGG - Intergenic
1067376574 10:45732867-45732889 CTCAGCAATTAGAGAGAAGGAGG + Intronic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067522804 10:47020854-47020876 GTCTGCAATGAAAAAAAGGAAGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067884269 10:50073558-50073580 CTCAGCAATTAGAGAGAAGGAGG + Intronic
1068385422 10:56319903-56319925 CCCACCAATCAGAATGAGGATGG - Intergenic
1069108727 10:64416017-64416039 CTCAGCAGGGAAAAAAAGGAAGG - Intergenic
1069420504 10:68242297-68242319 GTGAGTAATGAGAAAAAGGAGGG - Intergenic
1070616051 10:77969989-77970011 CTCAGAAAAGAGAAGCAGGATGG - Intronic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1071658033 10:87470365-87470387 CTCAGCAAGGAGAATGTGGCAGG + Intergenic
1072701700 10:97646710-97646732 ATCAGCAATGACAAGGAGGAGGG - Intronic
1073620912 10:105047450-105047472 TGCAGCAATGATAAAGAAGAGGG - Intronic
1073873385 10:107892106-107892128 GTCAGTAATGAGAAAGTAGAAGG - Intergenic
1073949713 10:108793446-108793468 CTTAGCAATGAATTAGAGGAGGG + Intergenic
1074114289 10:110443993-110444015 CTCAGCTCAGAGAAAGAAGAGGG + Intergenic
1075138967 10:119814526-119814548 GGCAGCAATGAGAAACAGGAAGG - Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1079533917 11:21487532-21487554 CACACAAATGAGAAAGAGGAAGG + Intronic
1080254500 11:30274342-30274364 CTCAAAAGTGAGAAAGAGAATGG - Intergenic
1080317220 11:30963938-30963960 AACAGCAATGAGAATTAGGAAGG - Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1081711819 11:45221737-45221759 CTGAGCAGTAAGAAATAGGAAGG + Intronic
1083266793 11:61550594-61550616 CTCAGCAAAGAGGAAGGGGCTGG + Intronic
1084786881 11:71447917-71447939 CTCAGCACTGACAAAGAGGGAGG + Intronic
1085029369 11:73260330-73260352 CTCTGCAAAGACAAAGAGGATGG - Intergenic
1085740514 11:79074648-79074670 CTCAGCAATGTTAAAGAGTATGG - Intronic
1087790163 11:102397586-102397608 TTCAGCATGGAGTAAGAGGAGGG + Exonic
1088453715 11:110011252-110011274 CTCAGAAAGGATAAAGATGATGG + Intergenic
1089169872 11:116504513-116504535 CTCAGCGGGGAGAAAAAGGAAGG + Intergenic
1089812667 11:121144436-121144458 GTCAGCTAAGAGAGAGAGGAAGG + Intronic
1090373734 11:126274778-126274800 CTCAGCAATGAGGAAAAATAGGG + Intronic
1090409206 11:126496044-126496066 CTCTGCAATCAGACATAGGAGGG - Intronic
1090469622 11:126968799-126968821 CTCTGCAGTGAGAAAGGGGCAGG + Intronic
1091027819 11:132157878-132157900 CTCAGGATTGAGGAAGAGGACGG - Intronic
1091086113 11:132723654-132723676 GTGGGCAATGAGAAAGAGAAAGG - Intronic
1091716429 12:2780583-2780605 CTCTGAAATGATACAGAGGAGGG + Intergenic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093999404 12:25678656-25678678 CTGACCAGTGTGAAAGAGGATGG + Intergenic
1095975914 12:47941180-47941202 TTCAGCAACTAGAAAGATGAAGG + Intronic
1096246127 12:49987974-49987996 CTCAGCAAATTGACAGAGGATGG - Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1098152153 12:67557830-67557852 CTGAGGAATGGGAAATAGGAAGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1100731673 12:97477720-97477742 CTCTGCAATGAGGAAGAGAAAGG + Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1102704387 12:114868575-114868597 CTCAGAAGTGAGAGTGAGGAGGG + Intergenic
1106038108 13:26063936-26063958 CTCAACAGTGAGAAACATGAAGG + Intergenic
1107126864 13:36855967-36855989 AACAGCGATGAGATAGAGGAGGG - Intronic
1108460248 13:50658864-50658886 CTTAGCAATCAGAAAGAGTGAGG - Intronic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110857964 13:80317654-80317676 CTCAGGAATAAGATAGAGCAAGG + Intergenic
1111557923 13:89905676-89905698 CTGAGCAATGAGTAAAAGGCAGG - Intergenic
1111944282 13:94647495-94647517 CAAAGGAATGAGAAAGGGGATGG + Intergenic
1111948890 13:94694072-94694094 CACAGCAAAGAGAAAGAGAGAGG + Intergenic
1113045827 13:106153435-106153457 GTCAGCACTGACAAAGATGAGGG + Intergenic
1113289679 13:108890877-108890899 TTCAGCAGAGAGTAAGAGGAAGG - Intronic
1113532823 13:111041806-111041828 CTGAGAAGTGAGGAAGAGGAGGG - Intergenic
1113811831 13:113147385-113147407 CTCATCAATGAGGAAAACGAGGG + Exonic
1115967266 14:38904894-38904916 CTCTGAAAAGAGAAAGAGGGAGG - Intergenic
1115968660 14:38921526-38921548 CTTAGGAATGAGAAATAGAATGG + Intergenic
1116289553 14:43015459-43015481 ATCAGCACAGTGAAAGAGGAAGG - Intergenic
1117897433 14:60502253-60502275 CTCAGCAATGGGGAATAGGAAGG + Intronic
1118306121 14:64657089-64657111 CTCTGTAATGTGAAAGAGAAAGG + Intergenic
1118435721 14:65769492-65769514 GTAACCAATGAGAAAGTGGATGG + Intergenic
1118837783 14:69488690-69488712 TTCAGCATTGATAAAGAAGAAGG + Intronic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1119817525 14:77583293-77583315 CTTAGCCATGAAAAAAAGGAGGG + Intronic
1120293719 14:82611010-82611032 CTCAGCAGTGAGAACGATGAAGG + Intergenic
1121018907 14:90567015-90567037 CTCATCAATTTGAAAGGGGAAGG + Intronic
1121193987 14:92053800-92053822 CCCAGCAATCAGAAAGAGAAAGG - Exonic
1121528232 14:94634245-94634267 CTCAGCAATAGGAAAGTGCATGG - Intergenic
1121566406 14:94913253-94913275 CTAAGCAGTGGGAAAGAAGAAGG + Intergenic
1121716914 14:96083038-96083060 CTCAGAACTGCCAAAGAGGATGG - Intronic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1122760059 14:104017157-104017179 CTCAGCTGTGCGCAAGAGGAAGG + Intronic
1122998386 14:105277753-105277775 CTCAAAAAAGAGAAAGAAGATGG - Intronic
1124200709 15:27676770-27676792 CTCAGCACTGAGAAGACGGACGG - Intergenic
1124559627 15:30759507-30759529 CTCAGCCATGTGAAAGGGAATGG - Intronic
1124671624 15:31646199-31646221 CTCAGCCATGTGAAAGGGAATGG + Intronic
1125178643 15:36855996-36856018 CTCAGCAATGACAGAGATGATGG + Intergenic
1125531849 15:40418640-40418662 CTCACCCAAGAGAAAGAGGTGGG - Exonic
1126490133 15:49227775-49227797 CTCATGAATAAGAAAGAGAAAGG - Intronic
1126549504 15:49910986-49911008 CACACCAATGAGGAAGAGAAAGG + Intronic
1127455093 15:59149730-59149752 CTGAGGGATGAGAGAGAGGAAGG + Intronic
1127552674 15:60056515-60056537 CTCAGCAAATAGAAAGATGTTGG - Intronic
1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG + Intergenic
1128821910 15:70664280-70664302 CCCTGCAATGAGAAAGATGCTGG + Intronic
1129254818 15:74328240-74328262 GGCAGCAAGGAGGAAGAGGAAGG + Intronic
1129718833 15:77866747-77866769 CTCAGCAATGAGACAGAGTCAGG - Intergenic
1130102747 15:80906248-80906270 CCCAGAAAAGAGCAAGAGGAGGG + Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130831612 15:87606912-87606934 TTCAGTAAGGACAAAGAGGAGGG + Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131360168 15:91783734-91783756 CTTAGGCATGGGAAAGAGGAAGG - Intergenic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131692438 15:94841735-94841757 GTGAGCAATGAGCAAGTGGAAGG - Intergenic
1131712338 15:95069350-95069372 CTCAGCCATCTCAAAGAGGAGGG + Intergenic
1132767624 16:1542426-1542448 CTCAGCATTGAGGAAGGGGCAGG - Intronic
1133084257 16:3349541-3349563 CTAAGCATGGAGACAGAGGATGG + Intergenic
1134074931 16:11284004-11284026 AGCAGGAAGGAGAAAGAGGAGGG + Intronic
1134445858 16:14331075-14331097 CTAAGCATTGAGAGAAAGGAAGG - Intergenic
1134634958 16:15785151-15785173 CTAAGAAATTAGAAAAAGGAGGG - Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135273282 16:21087035-21087057 CTCAGCATTCAGTAAGAAGAGGG + Exonic
1136016003 16:27401729-27401751 CTCAGGAATAAGAAACAGGCTGG + Intergenic
1136401752 16:30023115-30023137 CCCAGCATTTACAAAGAGGAGGG - Intronic
1136698368 16:32107364-32107386 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1136798872 16:33050661-33050683 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1138993088 16:62415970-62415992 CACAGAAATGAGAAAGAGAAAGG - Intergenic
1139130064 16:64132315-64132337 CTCACCAAGGAGAAACAGGGAGG + Intergenic
1139130985 16:64144779-64144801 CTCAGGAATGAGTCAGAGGGTGG + Intergenic
1139223466 16:65210020-65210042 CACAGCGATGAGAAAGAAGATGG - Intergenic
1139714778 16:68804042-68804064 CTAAGCAATAAGAAGGAGAAAGG + Intronic
1140194396 16:72844867-72844889 CTCGGAAATGAGGAAGGGGAGGG - Intronic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1142529358 17:568589-568611 CCCAGCAAAAAGGAAGAGGAAGG - Intronic
1143932420 17:10443609-10443631 CTCATGAATGAGAAAGAAAAAGG + Intronic
1144233445 17:13232474-13232496 GTCAGCAATGGGAAAGAGTCAGG + Intergenic
1144431464 17:15196022-15196044 CTAAGCAAAAAGCAAGAGGAAGG + Intergenic
1144798297 17:17907447-17907469 ATCATCAATGAGACGGAGGAAGG - Exonic
1145073740 17:19833859-19833881 CTCAGAGAAGAGAAAGAGAAAGG + Intronic
1145915801 17:28573369-28573391 TGCAGCAATGAGAGAGGGGAAGG + Exonic
1147460205 17:40563549-40563571 CCCAGCAAGGAGCAAGAGGTGGG - Intronic
1147655789 17:42090171-42090193 ATCAGCCATGAGAAGGAGGAGGG - Intergenic
1148313615 17:46671915-46671937 CTCAGCTATGAGAATAAGCACGG + Intronic
1148777041 17:50101773-50101795 CCCAGGAATGAGAAGGAGGAGGG - Intronic
1148806402 17:50266222-50266244 CTCAGCTAGGAGAGAGAGAAAGG - Intergenic
1149022930 17:51991145-51991167 GACAGCAATGAGAAAAATGATGG + Intronic
1149735927 17:58993455-58993477 CTCAGCAATAAAAAAGAAGGAGG + Intronic
1150135290 17:62692094-62692116 CTCAGCTGTGGGCAAGAGGAGGG - Exonic
1150988509 17:70227559-70227581 CTCAGCAAGGAGAATGAGAAGGG + Intergenic
1151124888 17:71833755-71833777 CTCAGCAAAAAGACATAGGAAGG + Intergenic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152392182 17:80009614-80009636 CACAGCTATGAGAAAGAGGGAGG + Intronic
1152493045 17:80650736-80650758 CTCAACCATGAGGGAGAGGAAGG - Intronic
1153467263 18:5402320-5402342 AACAGAAATGAGAAACAGGAAGG + Intronic
1153571410 18:6476944-6476966 CTCATAAATGAGAAAGAGCAGGG + Intergenic
1154450377 18:14470857-14470879 ATGAGCAATAAGACAGAGGATGG + Intergenic
1155249786 18:23943710-23943732 CTCAGCACTGAGACAGAGGGTGG - Intronic
1155497161 18:26454064-26454086 GTCTGGAATGAGGAAGAGGAGGG + Intergenic
1155506457 18:26538277-26538299 CTCTGTAAAGAGAAATAGGAAGG + Intronic
1156562792 18:38147612-38147634 CTCAGCACTGAGAGAGTGGAGGG - Intergenic
1157306653 18:46522224-46522246 CTCCCCGATGAGAAAGATGAAGG + Exonic
1157389096 18:47286416-47286438 CTAGTCAATTAGAAAGAGGAGGG - Intergenic
1159261841 18:66023743-66023765 CACAGCAATGAGAATGAGTAGGG + Intergenic
1159382070 18:67672995-67673017 CTCAGTAATGAGAAAAAGCTAGG + Intergenic
1159872220 18:73771317-73771339 CTCAGCAACAAGAGTGAGGAAGG - Intergenic
1159952085 18:74492033-74492055 CTGAGCAATGGCCAAGAGGATGG + Intergenic
1160379538 18:78441808-78441830 CACAGCAATAAGAAAGATCATGG + Intergenic
1161293880 19:3509782-3509804 CTCAGCCACGACAAAGAGCAGGG - Intronic
1161553138 19:4925472-4925494 CTCAGCCATGAAAAGGAGCAAGG - Intronic
1161582596 19:5088881-5088903 CTCAGCCATGAGAAGGAGCAAGG + Intronic
1162320165 19:9966840-9966862 GACACAAATGAGAAAGAGGAGGG + Intronic
1164551597 19:29216934-29216956 CTCAACAAAGAGAAAGACGGTGG + Intergenic
1164706451 19:30323678-30323700 CCCAACCATGAGAAGGAGGATGG - Intronic
1165638157 19:37361481-37361503 CACAGAAAAGAGAAAGAGAAAGG - Intronic
1165886289 19:39081325-39081347 CTTGGCAATGAGAAAGAAAATGG + Intergenic
1202672185 1_KI270709v1_random:65709-65731 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
925345077 2:3166297-3166319 CTCATCAGCGATAAAGAGGAAGG + Intergenic
926506666 2:13724457-13724479 CTCAACAATGAGGAAGAATATGG - Intergenic
927571567 2:24164969-24164991 CTCAGGAATAAGAAAGGAGAAGG + Intronic
929158860 2:38811758-38811780 CTCACCAATAAGAAAGACGTGGG - Intronic
929235625 2:39602509-39602531 CTCAGTAATAAGAAGGAGCAAGG - Intergenic
929324770 2:40595950-40595972 TTCAGGAATTAGAATGAGGAAGG + Intronic
929734615 2:44533735-44533757 CACACAAATGAGGAAGAGGAAGG + Intronic
929743773 2:44633712-44633734 CTCAGAAGTGACAAAGATGATGG - Intronic
930105604 2:47636810-47636832 CTCAGCAATGAAAAAGTTCATGG + Intergenic
931146880 2:59528728-59528750 CTCGGCAGAGAGAAACAGGAAGG + Intergenic
931922295 2:67033919-67033941 GTCAGAAATTAAAAAGAGGATGG + Intergenic
933269873 2:80221745-80221767 CTGAGCAATCAAAAAGATGAAGG + Intronic
933486120 2:82926200-82926222 GTCAGTAATGAGAATGAGCATGG + Intergenic
933805850 2:85997659-85997681 GTCAGCAACTAGAAAGAAGAAGG + Intergenic
933906508 2:86899118-86899140 CTCAGCATCGAGAAATAGAAGGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935688021 2:105702350-105702372 TACAGAAATGAGAAAGAGAAAGG + Intergenic
936761321 2:115787296-115787318 CTCAGAAATGACAGAGATGATGG + Intronic
937255826 2:120554805-120554827 CTCAGAAATGAAAGAGAGCAAGG + Intergenic
938338720 2:130521308-130521330 CTCAGCCAGGAGAAACGGGATGG - Exonic
938351120 2:130599442-130599464 CTCAGCCAGGAGAAACGGGATGG + Exonic
939803697 2:146745750-146745772 CTCAATAATGAGAAAGAGTTTGG + Intergenic
940205489 2:151197339-151197361 GTCAGCAGAGAGAAGGAGGAGGG + Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942791746 2:179768767-179768789 ACCAGCAATGTGGAAGAGGAGGG + Intronic
942865495 2:180669051-180669073 TTCAGACATGAGAAAAAGGATGG + Intergenic
944285749 2:197948105-197948127 ATGAGAAATGAGAAACAGGATGG + Intronic
944938496 2:204595444-204595466 AACAGCAATAAGAAACAGGATGG - Intronic
944978108 2:205080978-205081000 CACAGTGATGAGAGAGAGGAGGG - Intronic
946469203 2:219940662-219940684 CTCACCTAGGAGAAAGAGGAAGG - Intergenic
947648559 2:231764396-231764418 CTCAGAAATGTGTATGAGGATGG - Intronic
948670274 2:239564137-239564159 CTCAGAAATGAGAATGAACAGGG + Intergenic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1170159229 20:13295629-13295651 CCCAGGAAAGATAAAGAGGAAGG + Intronic
1170650305 20:18233764-18233786 CTCAGGAAAGAAAAAAAGGAAGG - Intergenic
1172007462 20:31827116-31827138 CACAGCAAAGAGAGAGAGGGGGG + Intronic
1172221574 20:33277766-33277788 GTCAGCACTGAGAGAGAGGGAGG - Intronic
1173318785 20:41968988-41969010 CACAGCCACCAGAAAGAGGAGGG + Intergenic
1173918534 20:46726969-46726991 CTCACCAATGAGATCGAGGAAGG - Exonic
1174006003 20:47411314-47411336 CTCAGCCAAGAAACAGAGGAAGG - Intergenic
1175289143 20:57862172-57862194 CTCTGCAAAGAGAAAAAAGATGG + Intergenic
1176523180 21:7840729-7840751 CACACCAATGAGAAATAGGAGGG + Intergenic
1177155414 21:17496416-17496438 CTAAGCAATGAAAAAAAGAAAGG - Intergenic
1177187506 21:17814228-17814250 CTAAGGAATGGCAAAGAGGAAGG - Intronic
1178657200 21:34470741-34470763 CACACCAATGAGAAATAGGAGGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180288892 22:10778664-10778686 ACCATCTATGAGAAAGAGGACGG + Intergenic
1180874937 22:19170829-19170851 CTCAGCCATGGGAAAGAAGATGG - Intergenic
1181025545 22:20125413-20125435 CTCAGCATTCAGGAAGCGGATGG - Exonic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182381588 22:29894206-29894228 CTCACCATTGAGAAAGTGGGTGG + Intronic
1182898994 22:33882457-33882479 CTCAGCAGTGATAAAGGGGCAGG + Intronic
1183102569 22:35592987-35593009 ATCAGAAATGGGAAAGAGGGAGG + Intergenic
1183350536 22:37332292-37332314 CTTAGAAATGAGGAAGTGGAGGG + Intergenic
1184581667 22:45422177-45422199 CTTAGCCATGAGCATGAGGACGG - Intronic
949254368 3:2028018-2028040 CTCAGAAGTGAGTAAGAGCATGG - Intergenic
949302701 3:2602864-2602886 CTCAGCTTTGAGAAAAAGCAAGG + Intronic
949689994 3:6625335-6625357 ATCAGAAATGGGAAAAAGGAAGG + Intergenic
950772732 3:15325025-15325047 CTGAGCAATGAGGAAAAGGACGG + Intronic
950821334 3:15762598-15762620 TTCTGAAATGATAAAGAGGAAGG - Intronic
951068602 3:18297508-18297530 CACATAAATGAGAAAGAGAAAGG + Intronic
951567700 3:24027986-24028008 GTCAGCAATGGGCAAAAGGAAGG - Intergenic
952578053 3:34798532-34798554 ATAAACAATGAGAGAGAGGAAGG + Intergenic
952964156 3:38610709-38610731 CTCAGCTATGGGAAATGGGATGG - Intronic
953160337 3:40413942-40413964 CTCAGGAAGAAGAAAGAGCAAGG - Intronic
953465419 3:43115314-43115336 CCCAGCAATGAAAAAGAGCTTGG + Intergenic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
955208302 3:56917434-56917456 CTCAGGCTTGAGACAGAGGAAGG - Intronic
955631565 3:60980970-60980992 CTCAGCAGAGAGGAAGAGCAGGG - Intronic
956463876 3:69499886-69499908 GTCAGCAATGGGCAACAGGAAGG - Intronic
957323693 3:78664787-78664809 CACAGCAAGGAGAAAAATGAGGG - Intronic
957787142 3:84897696-84897718 CACACAAATGAGAAAGAGAAAGG - Intergenic
958761641 3:98316333-98316355 CTCAGCAAGGGGAAAGTGGCAGG + Intergenic
959421161 3:106130839-106130861 CTGACAAATGAGAAAGACGATGG - Intergenic
960004974 3:112772514-112772536 GTCAGGAATGAGGAAGAGGATGG - Intronic
962196152 3:133365407-133365429 CTCAGGAAAGAGAAAAGGGAGGG + Intronic
962432299 3:135330470-135330492 CGAGGCAATGAGAAAGGGGAGGG - Intergenic
964174613 3:153811258-153811280 CTCAGAAAAGAGAAAAAGCATGG + Intergenic
964222810 3:154366163-154366185 CTCAGCCATGACAAAAAGGGAGG + Intronic
965490095 3:169324682-169324704 CTCAGTAATGAGACAGAATAAGG - Intronic
966193081 3:177288775-177288797 TCCAGCAATGAGAAAGGGAAAGG - Intergenic
966330250 3:178803921-178803943 CTCAGCCCTGAGTAAAAGGAGGG - Intronic
966815416 3:183885995-183886017 CTCAGCAGTGGGAACGCGGATGG - Intergenic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967091355 3:186137464-186137486 CTCAGGAAAGAGAATGAGAATGG + Intronic
967123489 3:186404745-186404767 CTCAGCAGTGACAAACAGTATGG - Intergenic
967218442 3:187229343-187229365 GGCAGCAATGATAAAAAGGAGGG - Intronic
967401585 3:189068773-189068795 CTCAAAAAAGAGAAAAAGGAAGG + Intronic
968004931 3:195236331-195236353 CTCTGCCTGGAGAAAGAGGAGGG - Intronic
968638300 4:1695017-1695039 TCCAGCAAAGAGAAAGCGGATGG + Intronic
968844766 4:3034556-3034578 CTCATCAATCAGAAAAAGCAGGG - Intronic
968871554 4:3245253-3245275 CTCTCCGATGAGGAAGAGGAAGG - Intronic
968951989 4:3700114-3700136 CTCAGCAAAGACAAAGATGGAGG + Intergenic
971149874 4:24020725-24020747 CTCCGGAATGAGGATGAGGAAGG - Intergenic
972910164 4:43805785-43805807 CACAACAATGTGAAAGAGGTTGG - Intergenic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
975327310 4:73073671-73073693 TTCAGTAATGGGAAATAGGAGGG + Exonic
975411372 4:74054962-74054984 GTCAGTAAGGAGAAAGAGGTAGG + Intergenic
979243518 4:118471456-118471478 CTGAGCAATATGAAAAAGGAAGG + Intergenic
980394159 4:132187296-132187318 CTCAACAATAAGAAAGAGTTGGG + Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
981733118 4:147920858-147920880 CTCAGCAAAGATACAGAGAAAGG + Intronic
982304326 4:153914045-153914067 TACAGAAATGAGAAAGGGGAAGG - Intergenic
982995030 4:162332802-162332824 TTCAGAAATGAGAGAGAGGAAGG - Intergenic
983025942 4:162738318-162738340 CTCAGGAATGAGAATGAAGAAGG - Intergenic
983271989 4:165573250-165573272 CACAGGAATGAGAATGAGAAAGG - Intergenic
983631561 4:169854444-169854466 CTCAGTAATGAGAAGGCGGCAGG + Intergenic
985957274 5:3275070-3275092 CCCAGCCTTGATAAAGAGGAGGG - Intergenic
986042382 5:4005979-4006001 CTCAGCAAGGAGAAAGGTGGGGG - Intergenic
986533747 5:8764850-8764872 CTCAGTAATTTGAACGAGGAGGG + Intergenic
986597373 5:9437751-9437773 CTTACCAAGGAGAGAGAGGATGG + Exonic
986617657 5:9636545-9636567 CTAAGAAATGAGATAGATGAGGG - Intronic
987084846 5:14458766-14458788 CTCAGGAAGGACAAAGAGAAGGG - Intronic
987375777 5:17232824-17232846 CTCAGAAATGAGACAGCAGAAGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988190379 5:27923239-27923261 CTCAGCAAAGGGAGAAAGGAAGG - Intergenic
988662275 5:33284748-33284770 CGCAGAAGTGAGAAGGAGGATGG + Intergenic
988780017 5:34512100-34512122 CTCAGAAATCAGAGAGAGGGAGG + Intergenic
989169761 5:38462460-38462482 AACAGCAAAGAGAAAGAGCAGGG - Intronic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
989793350 5:45434621-45434643 CTGAACAATGACAAAGAGTATGG + Intronic
989823204 5:45820534-45820556 CTGATCCATGAGAAAGATGAAGG + Intergenic
990216498 5:53538018-53538040 CTCATCAGATAGAAAGAGGAAGG - Intergenic
991706446 5:69362887-69362909 CTCACTAATAACAAAGAGGATGG + Intronic
992310066 5:75488846-75488868 CTCAGAATAGAGAAAGAGGCTGG - Intronic
993022467 5:82607631-82607653 CTCACAAATGAGTAAGAGAAAGG + Intergenic
993095028 5:83471666-83471688 CTCAGCGAGAAGAAGGAGGAGGG - Exonic
993280797 5:85921709-85921731 CAGAGCACTGAGAAAGAGCAAGG + Intergenic
993835864 5:92819323-92819345 CTCTGCACAGAAAAAGAGGAGGG - Intergenic
994551801 5:101243208-101243230 CTAAGAAAGGAGAAAGAGAAGGG - Intergenic
994688285 5:102984093-102984115 CACACAAATGAGAAAGAGAAAGG + Intronic
995278522 5:110307012-110307034 CTCTGCCATTAGAAAGGGGAGGG - Intronic
995315893 5:110773783-110773805 CTCATCAGTGATCAAGAGGAAGG + Intergenic
997304420 5:132827262-132827284 TGCAGCAATGAGGAAGAGCAGGG - Intronic
997834504 5:137181395-137181417 ATCAGCAATGAGGACTAGGATGG + Intronic
997902025 5:137775527-137775549 TTCAGTAATGAGGGAGAGGATGG + Intergenic
998012342 5:138705323-138705345 CTCAGCCAGGACAAAGAGGGAGG + Intronic
998017263 5:138742302-138742324 CTCAGGAATGAGAAGGAGCCAGG + Intronic
998112418 5:139512463-139512485 CTAAGCAGTGAGAGAGAGTACGG - Intergenic
998376833 5:141696588-141696610 CTCAGCTGTGAGAACAAGGAAGG - Intergenic
999178727 5:149653412-149653434 CTCAGTTGTGAGATAGAGGAAGG - Intergenic
999422585 5:151457742-151457764 CACAGCAGAGAGAAAGAGAACGG + Intronic
1000018088 5:157296104-157296126 CACAGAACTGAGAAAAAGGAAGG + Intronic
1000116899 5:158162005-158162027 CTCAGAAATGAGCAAGAAGGTGG - Intergenic
1001144449 5:169171618-169171640 CTCAGTCCTGAGAAACAGGATGG + Intronic
1002316628 5:178348320-178348342 ATTAGCAATGAGGTAGAGGAGGG - Intronic
1002470384 5:179431475-179431497 CCCACCATTGGGAAAGAGGAAGG + Intergenic
1004258337 6:14085363-14085385 GTGGGCGATGAGAAAGAGGAAGG - Intergenic
1004517110 6:16329669-16329691 CTTTCCAATGAGAAAGGGGACGG - Intronic
1004522708 6:16377444-16377466 CACAGCAATGGGAAGGATGAGGG - Intronic
1004759921 6:18655334-18655356 TTAAGCAATGAGAAACAGGAGGG - Intergenic
1004813050 6:19280910-19280932 ATCAGCACTAAGCAAGAGGAAGG - Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1005816119 6:29554092-29554114 CTCAGGAATAAGAAAGTGAAGGG + Intergenic
1006050263 6:31336798-31336820 CTCAGCAATGTGGAAGGAGAAGG - Intronic
1006314047 6:33279885-33279907 CTCAGCAAGGAGCCACAGGAGGG + Intronic
1006419032 6:33921976-33921998 CCCAGTCAAGAGAAAGAGGAAGG + Intergenic
1006456476 6:34134863-34134885 ATTAGCAGTGAGAATGAGGAAGG - Intronic
1006635712 6:35459889-35459911 CTCATAAAGGAGAAAGAGGATGG - Intronic
1007042123 6:38732394-38732416 CTTAGCAAAGAAAAAGGGGAGGG + Intronic
1007954279 6:45902195-45902217 TTGAGCTATGAGAAAGTGGATGG - Exonic
1008041177 6:46800003-46800025 GGCAGCACTGATAAAGAGGATGG - Intronic
1008320767 6:50110814-50110836 CTCAGGAAAAAGAAAGATGAGGG - Intergenic
1010364558 6:75034191-75034213 CACAACAATGAAAAAGAGTAAGG + Intergenic
1011620960 6:89242141-89242163 ATCAACAATGAGAAATAGGCCGG - Intergenic
1012174854 6:96068571-96068593 CTAATCAATGCGATAGAGGAAGG - Intronic
1012228209 6:96729515-96729537 TTTAGCAATGAGAATGAAGAAGG + Intergenic
1012604254 6:101137711-101137733 CTCAGCAATGAGATAAAAAATGG + Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1013579732 6:111521567-111521589 CTCAGAATTGACAAAGATGACGG - Intergenic
1013603932 6:111730888-111730910 ACCAGCAAAGAGAAACAGGAAGG + Intronic
1014024090 6:116624610-116624632 CTCAGAAAGTAGAAAGAGGCAGG + Intronic
1014769011 6:125440079-125440101 CTGAGCAAGGAAATAGAGGAAGG - Intergenic
1014917657 6:127171712-127171734 TTTAGCAATCAAAAAGAGGAAGG - Intronic
1015755379 6:136600814-136600836 CTCATGAAAGAGAAAGATGAAGG + Intronic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1017017227 6:150111354-150111376 CTTAGCAGTGAGACAGAGGTAGG - Intergenic
1017051913 6:150401380-150401402 CTGAGTAATGAAGAAGAGGAAGG + Exonic
1017061271 6:150487344-150487366 CTCAGCAATGTGAAACTAGAAGG + Intergenic
1017518800 6:155183221-155183243 CTCAGCCCTGAGAAAAAGGAAGG - Exonic
1017625073 6:156339733-156339755 CTTAGAGATGAGAAAGAGGAGGG + Intergenic
1017996243 6:159534036-159534058 CTCAGCAAACAGAGTGAGGATGG + Intergenic
1018598550 6:165512160-165512182 CACAGAAATCAGAAAGAGAAAGG - Intronic
1018604297 6:165580763-165580785 CTACCCAATGAGAAAGAAGATGG + Intronic
1018729401 6:166637404-166637426 GCCAGGAATGAGGAAGAGGAGGG - Intronic
1019881416 7:3864705-3864727 CTTAGTAACGGGAAAGAGGAAGG + Intronic
1020474621 7:8581158-8581180 AACAGGAATGAGAAAGAGAATGG - Intronic
1020828129 7:13057916-13057938 CTGAGCAAAGTGAAAGAGAAAGG - Intergenic
1021897916 7:25255062-25255084 ATCAACCATGTGAAAGAGGATGG - Intergenic
1023766413 7:43515186-43515208 CTCAGAAGAGAGAAAGAGGCTGG + Intronic
1023860892 7:44217252-44217274 CTCAGCAAAAAGAGAGAGGAGGG + Exonic
1024805096 7:53130185-53130207 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
1025258047 7:57398822-57398844 CTCAGCAAAGATAGTGAGGATGG + Intergenic
1025481073 7:60983555-60983577 AACTGCAAGGAGAAAGAGGATGG - Intergenic
1026241884 7:68582880-68582902 CTCAGCTATGACAAAGATGTTGG - Intergenic
1027332032 7:77107254-77107276 TACAGCAATGAGAAGGAGAAGGG - Intergenic
1028294728 7:89114399-89114421 CTCAGTAATGACAAAGAGCCTGG - Intronic
1028671455 7:93405429-93405451 GTCACAAATGAGAAAGAGAAAGG - Intergenic
1029199835 7:98831724-98831746 CTCAGCCAAGAGAAAGACTAGGG + Intergenic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029783743 7:102764071-102764093 TACAGCAATGAGAAGGAGAAGGG + Intronic
1029833868 7:103289202-103289224 GTCAGGAATGAGTTAGAGGAGGG + Intergenic
1032780554 7:135162181-135162203 GTCAGCTCTGGGAAAGAGGAGGG + Intronic
1032931089 7:136671846-136671868 CTATACAATGAGAAAGAGAAAGG - Intergenic
1033470617 7:141645596-141645618 ATCAGAAATAAGAAAGACGATGG - Intronic
1033862724 7:145647692-145647714 CTAAGCATTGAAAAAGAGGTAGG - Intergenic
1034615353 7:152411514-152411536 ACCATCTATGAGAAAGAGGAGGG + Intronic
1034937005 7:155206732-155206754 AGCAGGAGTGAGAAAGAGGAGGG + Intergenic
1035652809 8:1281595-1281617 CTCCCCAATGAGAATGAGGACGG - Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036659403 8:10698304-10698326 CTGACCAATGACACAGAGGAAGG - Intronic
1037289371 8:17335183-17335205 CTCAGCGCTGACAGAGAGGAGGG + Intronic
1037500609 8:19482131-19482153 CTCAGCGCTGAAAGAGAGGAAGG - Intronic
1037674596 8:21042827-21042849 CTCATCAGGGAGAAAGATGATGG - Intergenic
1037881843 8:22577322-22577344 CTCACCCATGAGAGAGGGGAGGG + Intergenic
1039162356 8:34636681-34636703 CTAAACATTGTGAAAGAGGATGG - Intergenic
1039445200 8:37625638-37625660 GTCAGGAGAGAGAAAGAGGAGGG - Intergenic
1041268021 8:56083784-56083806 TTCAGCAGTGAGGGAGAGGAGGG + Intergenic
1041428299 8:57748563-57748585 CTCAGCTATTAAAAAGAGAAAGG - Intergenic
1041617002 8:59918905-59918927 CTCAGCTAATAGAAAGGGGATGG - Intergenic
1041847858 8:62352222-62352244 CTCAGCAATGGGAAGGAGTCAGG - Intronic
1042515783 8:69657418-69657440 CACAGCACTGACAATGAGGATGG - Intronic
1043329534 8:79097967-79097989 ATCAGCAGTGAGACTGAGGAGGG + Intergenic
1043854194 8:85245772-85245794 CTGAGCAGCGAGAAAGAGGAGGG - Exonic
1044058393 8:87601339-87601361 CTTAGTAATGACAAAGAGAAAGG - Intronic
1044164778 8:88968062-88968084 CCCAAAAATGAGAAACAGGAAGG - Intergenic
1044315420 8:90745020-90745042 CTAAGCAAAAAGAAAGAGGCTGG - Intronic
1045076015 8:98569111-98569133 CTGAGCAAGGAAAAAGAGCAAGG + Intronic
1045417108 8:101978350-101978372 GTCAGTAATGAGAGTGAGGATGG - Intronic
1045766800 8:105682032-105682054 CTCAGACATGAGAAAAATGAGGG + Intronic
1046365456 8:113225086-113225108 CTCAGTAATGGAAAAGAGCATGG - Intronic
1047189726 8:122667118-122667140 GTCAGAAAAGAGAGAGAGGAAGG - Intergenic
1047759658 8:127944889-127944911 CTCAGCCATGAGCACGGGGAGGG - Intergenic
1048078788 8:131102344-131102366 CTCAACAACGAGAAAGAAAAGGG - Intergenic
1048396358 8:134017908-134017930 CTGAGCAGTGGGAAAAAGGAAGG - Intergenic
1049033892 8:140059947-140059969 CTCAGAAATGATAAGGATGATGG - Intronic
1050890266 9:10816623-10816645 CTCAGAACTAAGAAAGATGATGG + Intergenic
1050984711 9:12067620-12067642 CACAGAAAAGAGAAAGAAGATGG + Intergenic
1051187770 9:14478658-14478680 CTCAGCCATTAAAAAGAGTAAGG - Intergenic
1051323428 9:15936518-15936540 CTCAGCAGAGAGCGAGAGGAGGG + Intronic
1051622400 9:19065167-19065189 TTCAGAAATGAGAGAGGGGAGGG - Intronic
1052392175 9:27893056-27893078 CTCAGCAGTCAGAAAGAGTGGGG + Intergenic
1052429251 9:28345813-28345835 CTCAGTAGTGACAATGAGGAAGG + Intronic
1052679231 9:31667793-31667815 TTCATCAATGAGAGAGAGAAAGG - Intergenic
1052975751 9:34408672-34408694 CTCCCCAAGGAGAGAGAGGAGGG - Intronic
1054734943 9:68741663-68741685 CTAAGCAAAGAGATAGAGAAGGG + Intronic
1054954340 9:70890972-70890994 TTCAGCAATGGGACACAGGAAGG + Intronic
1055112814 9:72576380-72576402 GTCAGAAAGGAGAAAGGGGAGGG - Intronic
1055302635 9:74898286-74898308 CTCAGCAAGGGGAAAAAGAAGGG - Intergenic
1055848750 9:80599292-80599314 CTCAGCACAGTGAAAGAGGGTGG - Intergenic
1056180430 9:84077054-84077076 CTCTGCTATGGAAAAGAGGAGGG + Intergenic
1056268395 9:84922751-84922773 CTCAAGGATGAGTAAGAGGAAGG - Intronic
1056502463 9:87223374-87223396 CACAGCAATGAGGAAGGGCACGG + Intergenic
1056673016 9:88647582-88647604 CTCAGCAGTGAGTAAGGGGTTGG + Intergenic
1057166375 9:92930167-92930189 CTCAGAAATGATAAAGATAATGG - Intergenic
1057354393 9:94322099-94322121 CTCAGCATGGAGCATGAGGAGGG - Intronic
1057842395 9:98496517-98496539 GTCAGCAAAGAGAAAGCAGAGGG + Intronic
1057938972 9:99264023-99264045 CTCAGCATTCAGTAATAGGAGGG - Intergenic
1059287536 9:113188039-113188061 CTCAGGAATGAGCCAGTGGAAGG + Intronic
1059703956 9:116802389-116802411 CTCGTCAGTGAGAAAGAGCATGG - Intronic
1059715821 9:116912410-116912432 CTTAGCACTGAGAATGAAGAAGG - Intronic
1059947136 9:119421096-119421118 TTTATTAATGAGAAAGAGGAAGG + Intergenic
1060187234 9:121571079-121571101 CTCAGGGAAGAGAAAGAGGAAGG - Intronic
1060289208 9:122284893-122284915 CTCAGCAATGAGGCTGAGGTGGG - Intronic
1060536811 9:124396467-124396489 CTGAGCAGTGAGAAAGATGTGGG - Intronic
1060566656 9:124598879-124598901 CTCAGCATTCAGGAAGCGGATGG + Intronic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1062002419 9:134223267-134223289 TTCAGCCATGAGAAGGAGCAAGG - Intergenic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1188064786 X:25645890-25645912 CTCAGCATTCAGGAAGCGGATGG + Intergenic
1188243106 X:27812055-27812077 CCCAGCAATGAGCAAGAGCCTGG + Intronic
1188736903 X:33727847-33727869 CTTGGCAATGAAAAACAGGACGG - Intergenic
1190614646 X:52217704-52217726 CTCTGCATTTGGAAAGAGGAGGG + Intergenic
1193878324 X:86891362-86891384 ATCACAAATCAGAAAGAGGAAGG + Intergenic
1193919777 X:87410786-87410808 CTCAGAAAACAGAAAGATGAGGG - Intergenic
1194472656 X:94316558-94316580 GGCAGAAATGAGAAAGAAGAAGG + Intergenic
1195801325 X:108715099-108715121 TCCAGAAATGACAAAGAGGATGG - Intergenic
1196068135 X:111488348-111488370 CTCTGCAAAGAAAAAAAGGAAGG - Intergenic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1196645994 X:118117382-118117404 CACAACATTAAGAAAGAGGAAGG + Intergenic
1196884462 X:120229632-120229654 GTCAGCAATGGCAAAGGGGAAGG - Intergenic
1196978505 X:121186154-121186176 CTCAGCAATGGGAAAAACTAAGG + Intergenic
1197438028 X:126456353-126456375 CTCTGCATTTGGAAAGAGGAGGG + Intergenic
1197524420 X:127544892-127544914 CTCTGCCATTGGAAAGAGGAGGG - Intergenic
1198075100 X:133186384-133186406 CTCAGCAATGTGAAAGAAGTGGG + Intergenic
1199253039 X:145686490-145686512 TACTGTAATGAGAAAGAGGAAGG - Intergenic
1199332207 X:146575555-146575577 CACACAAATGAGAAAGAGAAAGG + Intergenic
1199886627 X:152027326-152027348 CTCAGAACAGAGATAGAGGAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic