ID: 1119772236

View in Genome Browser
Species Human (GRCh38)
Location 14:77227435-77227457
Sequence CAAAATGATGAGATGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119772235_1119772236 -1 Left 1119772235 14:77227413-77227435 CCATTAGGTGGGAGAGGAAACAC 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1119772236 14:77227435-77227457 CAAAATGATGAGATGTAGTCAGG 0: 1
1: 0
2: 2
3: 14
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119772236 Original CRISPR CAAAATGATGAGATGTAGTC AGG Intronic
902181858 1:14695494-14695516 AAAAAAGATGGAATGTAGTCTGG - Intronic
903156521 1:21447435-21447457 TAAAATGATGAGTGGTTGTCAGG - Intronic
905301773 1:36990544-36990566 CAAATTAATGAGAGCTAGTCTGG - Intronic
905826632 1:41030537-41030559 CCAAATGTTGAGAAGGAGTCAGG - Intronic
908686907 1:66730882-66730904 CTAAAGGATGAGTTGGAGTCAGG - Intronic
909074088 1:71032117-71032139 ATAAAGGATGAGTTGTAGTCTGG - Intronic
913347776 1:117825483-117825505 CAAAATGATGAGAGATAGAATGG + Intergenic
913601189 1:120422412-120422434 TAAAATGATGAGTGGTTGTCAGG - Intergenic
913993045 1:143633258-143633280 TAAAATGATGAGTGGTTGTCAGG + Intergenic
914191752 1:145418169-145418191 TAAAATGATGAGTGGTTGTCAGG + Intergenic
914589677 1:149096170-149096192 TAAAATGATGAGTGGTTGTCAGG + Intronic
915766532 1:158367948-158367970 CAAGGTGTTGGGATGTAGTCGGG - Intergenic
917862917 1:179165101-179165123 CTACATGATGAGATGAAGTGAGG + Intronic
918511678 1:185319457-185319479 CTACATGATGAGATGAAGTGAGG - Intergenic
921822265 1:219630782-219630804 CAGAATGATCATATGTCGTCAGG + Intergenic
922453940 1:225759157-225759179 AAAAAAGATGAGATTTAGCCTGG + Intergenic
924482327 1:244448149-244448171 TAAAATTATGGGAAGTAGTCTGG + Intronic
1067930240 10:50553523-50553545 GAATATGATGAGATGTAGCTTGG - Intronic
1068263087 10:54608645-54608667 CAAAATGATGTGACTTAGTCTGG + Intronic
1068440461 10:57048950-57048972 AAATATGTTGAAATGTAGTCAGG + Intergenic
1068821758 10:61385011-61385033 CAACATGATGATAAGTAGCCTGG + Intergenic
1070466369 10:76727658-76727680 CAAAAAGAGGAGATTTAGGCTGG - Intergenic
1070868783 10:79729349-79729371 AAACATCATGAGATGTAGTATGG + Intergenic
1071312011 10:84352002-84352024 CAAAATGGTGACTTGTAGGCTGG + Intronic
1071635697 10:87251568-87251590 AAACATCATGAGATGTAGTATGG + Intergenic
1071659545 10:87486408-87486430 AAACATCATGAGATGTAGTATGG - Intergenic
1073110323 10:101059507-101059529 CAGAATGATGAGCTGGAGTGTGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080794992 11:35554850-35554872 CACAAGGAACAGATGTAGTCAGG + Intergenic
1082714788 11:56598999-56599021 CAAAATGAAGAAATGTAGCTTGG - Intergenic
1085668437 11:78438221-78438243 CAAACAGATGAGTTGTAATCAGG + Intronic
1087000004 11:93408414-93408436 CAAAATGAAGAGAGGTATGCTGG + Exonic
1087222687 11:95563487-95563509 CCAAATGATTAGATCTAGTAAGG - Intergenic
1087244725 11:95821087-95821109 CAAAATCATGAGATCTGGACAGG + Intronic
1088387020 11:109270068-109270090 AAAAATGATGAAATGTACTTTGG - Intergenic
1088518706 11:110669490-110669512 CAAAATGAGGAGATGTGAACTGG + Intronic
1089195502 11:116692087-116692109 GAAAAGGATGAGATGGAGTCAGG - Intergenic
1090698333 11:129271286-129271308 GAAAAAAGTGAGATGTAGTCAGG + Intronic
1091227928 11:133968906-133968928 CAAATTTTTGAGATGTAGGCAGG + Intergenic
1091442250 12:520412-520434 CAAAATCAGGATATGTGGTCTGG - Intronic
1092752170 12:11728971-11728993 CAAAATGATAATATGTACTACGG + Intronic
1093682405 12:22017529-22017551 CAAAATCATGAGATGTGTTATGG - Intergenic
1095135060 12:38590525-38590547 CAAAATGACGAGATGTATTTTGG + Intergenic
1095596812 12:43968646-43968668 GAATAGGATGAGATGTAGCCTGG - Intronic
1095977685 12:47950949-47950971 CAAAAGGCTGAGATGAACTCTGG - Intergenic
1098392330 12:69982692-69982714 CACCATGATGAGAAGGAGTCTGG - Intergenic
1098893673 12:76033444-76033466 AAAAAAAATGAGATGTAATCTGG + Exonic
1099475018 12:83097745-83097767 CTAAATGACGAGATTTAATCTGG + Intronic
1101596989 12:106176720-106176742 CTACATGATGAGATGAAGTAAGG + Intergenic
1103324085 12:120108886-120108908 CAAAATGAAGAGCTGTAGAGCGG + Intronic
1105059458 12:133135250-133135272 ACAAAAGATGAGAGGTAGTCTGG - Intronic
1105865616 13:24456616-24456638 CAAAATAATGAAATGTAGGCCGG + Intronic
1106621252 13:31373153-31373175 CAAAATGACTAGAGGTGGTCAGG + Intergenic
1107100106 13:36581128-36581150 CAGAATGAGGAGATGTGGTTTGG - Intergenic
1108331403 13:49388598-49388620 CAAAAAGATGAGATGGAATGAGG + Intronic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109974959 13:69819203-69819225 AAGAATGATGAGATGAATTCAGG + Intronic
1110549453 13:76795834-76795856 CAAAATGAGAACATGTATTCTGG - Intergenic
1111065549 13:83087373-83087395 CAATGTGATGAGATGAAGTGAGG - Intergenic
1111802950 13:93002640-93002662 CAAAATTCTGAAATGGAGTCTGG - Intergenic
1111922621 13:94428253-94428275 CAAAATGGTGAGGTGTAATTAGG - Intergenic
1111960068 13:94800474-94800496 CAAAGTGGTAAGAGGTAGTCAGG - Intergenic
1112179936 13:97068677-97068699 CAAGCTGATGACATGTAGGCTGG - Intergenic
1112980631 13:105380513-105380535 AAAAATCATAAGATGTAGTTTGG - Intergenic
1114622547 14:24105148-24105170 CAAAATGAAGAGATGGGCTCTGG + Intronic
1115409345 14:33055166-33055188 AAAAATGCTGAGATGTTTTCTGG - Intronic
1115626734 14:35200926-35200948 CAAAATGATTAAATGTAATATGG - Intronic
1115801845 14:37003309-37003331 CTACATGATGAGATGAAGTGAGG + Intronic
1118130963 14:62963054-62963076 CTACATGATGAGATGAAGTAGGG - Intronic
1118792593 14:69108801-69108823 CACAATGATTAGCTTTAGTCGGG - Intronic
1119083260 14:71716899-71716921 CAAAAAGAAGAGAGGTAGTGAGG - Intronic
1119500571 14:75123556-75123578 CAAAATGATGTGAAGAAATCAGG + Intronic
1119772236 14:77227435-77227457 CAAAATGATGAGATGTAGTCAGG + Intronic
1120387045 14:83859418-83859440 GAAAAAGATGAGTTGTAGTCAGG + Intergenic
1120396086 14:83969051-83969073 CAATATTATGAGATATTGTCAGG - Intergenic
1120784156 14:88515561-88515583 CAAAATGATTACATGTCTTCAGG - Intronic
1125170177 15:36757820-36757842 CCACATGATGAGATGAAGTGAGG - Intronic
1126814521 15:52441688-52441710 CCAAATGAGGAGAAGAAGTCAGG - Intronic
1133435798 16:5778489-5778511 CAAAATGGTGAGATGTCCCCTGG - Intergenic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1137925455 16:52536431-52536453 CAAAAAGATGGGATGAAGGCTGG + Intronic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1140095104 16:71868382-71868404 CAAAGTGATGGGATGAAGACAGG + Intronic
1140603086 16:76501457-76501479 TAAAATGATGACAGGAAGTCTGG - Intronic
1141305469 16:82859260-82859282 TAAACTGATCAGATGCAGTCGGG + Intronic
1146593244 17:34146887-34146909 CAGAATGATGAGCTTCAGTCAGG + Intronic
1147018337 17:37510490-37510512 CAAAAAGCTGAGATTTAGGCCGG + Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149115393 17:53088330-53088352 AAAAATGCTGAGATGTATTGAGG + Intergenic
1149924909 17:60693294-60693316 CAATTTGATCTGATGTAGTCTGG - Intronic
1152990132 18:355772-355794 CAAAAGGAAGAGAGATAGTCCGG + Intronic
1154476747 18:14767535-14767557 CTATGTGATGAGATGAAGTCAGG + Intronic
1155769531 18:29679372-29679394 TAAAATGATGAGTGGTTGTCAGG - Intergenic
1158788659 18:60747339-60747361 CAAAATCATGAGAAGTAGAGTGG - Intergenic
1158854520 18:61529803-61529825 CAAAATGAAGAAATCTTGTCTGG + Intronic
1159158432 18:64612943-64612965 TTAAATGATGAGCTGTAGACAGG - Intergenic
1162206419 19:9059574-9059596 AAAAAGGGTGAGATGTAGGCTGG + Intergenic
1163508291 19:17720738-17720760 TAAAATGATGAGGTGTGCTCTGG + Intronic
928426747 2:31185018-31185040 CAAAAAGATGAAATGTAGTCAGG - Intronic
929560153 2:42951513-42951535 CAAAATCATGTGATGGAGTAAGG + Intergenic
930576033 2:53149879-53149901 CAGAATGATGAGATGAATTAAGG + Intergenic
931474537 2:62573879-62573901 CTACATGATGAGATGAAGTGAGG - Intergenic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
932668257 2:73715053-73715075 CAAACTGTTCAGATGTAGTTGGG - Intergenic
938106448 2:128534212-128534234 CTACATGATGAGATGAAGTGAGG - Intergenic
938172844 2:129096810-129096832 CAAAATGGTGAGATGGGGCCGGG - Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
938420408 2:131141341-131141363 TAAAATGATAATAAGTAGTCCGG + Intronic
939458479 2:142468044-142468066 CTACATGATGAGATGAAGTGAGG - Intergenic
940184659 2:150970087-150970109 CAAAAGGTTTTGATGTAGTCAGG + Intergenic
940319743 2:152364186-152364208 GAAAATGACCAAATGTAGTCTGG - Intronic
942187422 2:173437720-173437742 CAATGTGATAAGATGTAGTAAGG + Intergenic
943208915 2:184937577-184937599 CAAAATGTCAAGCTGTAGTCAGG + Exonic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
945485236 2:210387768-210387790 CTAAAAGATGAGAGATAGTCAGG + Intergenic
945960350 2:216127720-216127742 CAACATGATGTGATGCAGGCTGG + Intronic
946489107 2:220130663-220130685 CACAATGGTGAGATGCAGCCTGG + Intergenic
948028349 2:234796674-234796696 CAAAAATGTGAGATGTAGGCTGG + Intergenic
1169625961 20:7569752-7569774 AAAAATGATTAAATGAAGTCTGG + Intergenic
1177256192 21:18665639-18665661 GAAAATGATGAGATTGAGTTTGG + Intergenic
1177293069 21:19140227-19140249 CAAAATGATGAAATCGACTCAGG - Intergenic
1177320899 21:19519200-19519222 TAAATAGATGAGATGTATTCAGG + Intergenic
1177463018 21:21437562-21437584 CAAAATGGGGAGATGAAGTGGGG - Intronic
1181152071 22:20891666-20891688 CAAAATGATGAGCTAGAGCCAGG + Intergenic
1182720703 22:32396621-32396643 CAAAATGCAGAGAAGTACTCAGG + Intronic
1183338338 22:37263997-37264019 CAACATCATAAGATGTACTCAGG + Intergenic
1183850030 22:40577900-40577922 TAAAAAGATCAGATGTAGGCCGG - Intronic
1184727111 22:46353575-46353597 GACAATGATGAGATGTGCTCAGG + Intronic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
951915481 3:27796669-27796691 CTACATGATGAGATGCAGTGAGG - Intergenic
952303741 3:32127139-32127161 CAAATTGATGAGATGGAGTAGGG - Intronic
952657697 3:35806439-35806461 CAAAATGATAAGAAGTGTTCTGG + Intergenic
955476309 3:59340053-59340075 CAAGAAGAAGAGATGTGGTCTGG + Intergenic
959149029 3:102586213-102586235 CAAAATGATGATATGTGGTTAGG + Intergenic
959879541 3:111427879-111427901 CAACATCATGAGATTTAGGCAGG - Intronic
960056313 3:113278909-113278931 CACAATGAGGAAATGTAGTTTGG + Intronic
961245200 3:125445624-125445646 CAAAGTGCTGAGATATAGGCAGG - Intergenic
961804007 3:129475831-129475853 AAAAATGAAGAGAAGTAGTATGG + Intronic
963005481 3:140723023-140723045 AAAAATGATGAGATGTACAAGGG - Intergenic
964071867 3:152645260-152645282 CTACATGATGAGATGAAGTGAGG + Intergenic
964130302 3:153279429-153279451 CTAAATGATGAGCTAGAGTCTGG - Intergenic
964230997 3:154467863-154467885 CTAAATGATGAGAAGCAGCCAGG - Intergenic
964525219 3:157610060-157610082 CTAACTGAGGAGATGTACTCAGG - Intronic
964629378 3:158793543-158793565 CTACATGATGAGATGAAGTGAGG - Intronic
964659377 3:159103558-159103580 CAAAATGGTGAGCTTTAGTTTGG - Intronic
964825769 3:160826274-160826296 GAACATGATGAGTTGTAGTTTGG + Intronic
966093445 3:176168897-176168919 AAAAATCATGAGAGGTAGACCGG + Intergenic
966883961 3:184364521-184364543 CAAAATAAAGAGGTGTAGGCCGG - Intronic
967001240 3:185337260-185337282 CAAAATGATGTGATGAATCCTGG + Intronic
967490082 3:190080334-190080356 CAACATGATCAGATGTTGTGTGG - Intronic
970139249 4:12962563-12962585 AAAAATGATGAAATCTACTCTGG + Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
975110672 4:70619435-70619457 AAAAATGATTAGATGATGTCTGG + Intergenic
975447083 4:74478485-74478507 CAAAATGATGAGATGATGTCAGG + Intergenic
975985892 4:80201638-80201660 GAAGATTCTGAGATGTAGTCTGG + Intronic
977129782 4:93221583-93221605 TAAAATGATGAGAGATAGTTTGG + Intronic
979108398 4:116717516-116717538 GAAGATGATGAGAAGTAATCAGG + Intergenic
980662192 4:135876396-135876418 CTAAAGGATGAGAAGGAGTCAGG + Intergenic
980725284 4:136750943-136750965 CTACATGATGAGATGAAGTGAGG + Intergenic
981537288 4:145813231-145813253 CTACATGATGAGATGAAGTGAGG - Intronic
983515718 4:168654402-168654424 CAAAATGATGGACTGTAGCCAGG + Intronic
986339225 5:6775298-6775320 CAAAATGAGGAGATGTGGCAAGG + Intergenic
987503021 5:18737432-18737454 CAAAATTGTGAGAAGTTGTCTGG - Intergenic
989236888 5:39158410-39158432 CAAAATGGTGAGATTTTGTCAGG + Intronic
991989576 5:72324299-72324321 CAAAATGATGAAAGGTTGACAGG - Intronic
993907038 5:93634491-93634513 CAAACTGATGAGGTGGACTCAGG + Intronic
995256175 5:110049356-110049378 CAAAATGAGGAGCTGAAGTAGGG - Intergenic
999830202 5:155311633-155311655 CAAAATGTTCATATGTATTCTGG - Intergenic
1000656835 5:163889430-163889452 CAAAATGATGAGATGTGGGTAGG + Intergenic
1001857865 5:175028425-175028447 CAAATTGATGAGCTGTCATCTGG - Intergenic
1003696696 6:8413117-8413139 TAAACTGATGAGTTGAAGTCTGG - Exonic
1006525310 6:34599614-34599636 CTAAATGATGAGAGGAGGTCAGG - Intronic
1007640253 6:43332626-43332648 TAAAATGATAACATGTAGTAAGG - Intronic
1007963449 6:45982228-45982250 CAAACTGATAAGATGGAGTCAGG - Intronic
1008157703 6:48037106-48037128 CTACATGATGAGATGAAGTGAGG - Intronic
1008720761 6:54348413-54348435 CAATACAATGAGATTTAGTCAGG - Intronic
1008797698 6:55323986-55324008 CAACCTGATGAGATGTGGCCAGG - Intergenic
1011579881 6:88850038-88850060 AAATATGATGAGATATTGTCAGG - Intronic
1012305238 6:97647862-97647884 AGAAATGATGAAATGTACTCTGG - Intergenic
1012337085 6:98073571-98073593 CAAAATGAGGAAATGGAGTTGGG + Intergenic
1012990544 6:105921635-105921657 CTACATGATGAGATGAAGTGAGG + Intergenic
1014510365 6:122313673-122313695 CTATATGATGAGATGAAGTGAGG + Intergenic
1017413152 6:154191207-154191229 AAAAAAGATGAGAGGTTGTCAGG + Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1021033946 7:15773991-15774013 AAAAATGATGAAATGTGGTATGG - Intergenic
1021394595 7:20131710-20131732 CTACATGATGAGATGAAGTGAGG + Intergenic
1023486298 7:40690837-40690859 CAAAGTGCTGAGATATAGGCAGG + Intronic
1024099191 7:46011639-46011661 CAAAATACTGAGAAATAGTCAGG + Intergenic
1028328048 7:89550680-89550702 CAAAATGCTGAGAAGTTGGCTGG + Intergenic
1030376953 7:108763201-108763223 CAACATGAGGTGATGTAATCAGG + Intergenic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1030728356 7:112953830-112953852 CAAAATGCTGAAATTTAGGCAGG + Intergenic
1035815683 8:2537626-2537648 AGAAATGATGAGAAGTAGGCCGG - Intergenic
1037247522 8:16853063-16853085 AAAAATGATAAAATGTAGTGTGG + Intergenic
1045457862 8:102399571-102399593 TAAATTGATGAGATATAGGCTGG - Intronic
1046455221 8:114450437-114450459 CAACATGATGAGATGAGGTAAGG + Intergenic
1047083945 8:121495696-121495718 AAAAATCATGAGATGTATTTGGG - Intergenic
1047109770 8:121776593-121776615 CTAAGTGATGAGATGAAGTGAGG - Intergenic
1050007725 9:1150871-1150893 AAAAATTTTAAGATGTAGTCTGG + Intergenic
1051488864 9:17638491-17638513 CCAAATGATGAGGTGAAGACTGG + Intronic
1052602395 9:30651819-30651841 CAAAGTGATAAGATGAATTCAGG + Intergenic
1053036487 9:34831158-34831180 CACAATGAAGAGATGTAGAAGGG + Intergenic
1053380577 9:37646515-37646537 CAAATTAATGAGAAGTAGTATGG - Intronic
1053592342 9:39526872-39526894 CTAAATGATGATTTGTAGCCAGG - Intergenic
1054573959 9:66838407-66838429 CTAAATGATGATTTGTAGCCAGG + Intergenic
1054761482 9:69008205-69008227 CACAGTGCTGTGATGTAGTCAGG + Intronic
1055319904 9:75073181-75073203 CACCATGTGGAGATGTAGTCAGG + Intronic
1056869491 9:90264215-90264237 CAAAATGAGGAGAGGTAGGGTGG - Intergenic
1057856189 9:98602585-98602607 TAAAATGAGGAGTTGTAGGCTGG - Intronic
1061600785 9:131668831-131668853 CCAGATGATGAGATGTACCCTGG - Intronic
1061690336 9:132322404-132322426 CAGAAAGATGAGTAGTAGTCAGG - Intronic
1186143200 X:6598944-6598966 TAAATTGATGAGATATTGTCAGG - Intergenic
1188602074 X:31979350-31979372 CAAAATAATGAAATTTAGGCTGG - Intronic
1188664855 X:32806160-32806182 CCAAATGGTGTGCTGTAGTCAGG + Intronic
1189191904 X:39116768-39116790 CAAAATGACGAGGTGAAGGCAGG - Intergenic
1192708686 X:73556712-73556734 CAAAATGATGGGGTGTAATGAGG + Intergenic
1193273158 X:79552933-79552955 CAATATGATGAGAGGCAGTATGG - Intergenic
1195511926 X:105725688-105725710 GAAAATGATGAGATGTATTTTGG + Intronic
1195920627 X:109980030-109980052 CTACATGATGAGATGTAATGAGG + Intergenic
1199899925 X:152163020-152163042 CAAAATGATGGCATGCAGCCAGG + Intergenic