ID: 1119773969

View in Genome Browser
Species Human (GRCh38)
Location 14:77237240-77237262
Sequence CTAAGTAGCAGCAGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119773969_1119773972 6 Left 1119773969 14:77237240-77237262 CCTGCTGAGCTGCTGCTACTTAG 0: 1
1: 0
2: 0
3: 7
4: 145
Right 1119773972 14:77237269-77237291 TGGCCCTGCCCACCCCTGCTAGG 0: 1
1: 0
2: 11
3: 66
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119773969 Original CRISPR CTAAGTAGCAGCAGCTCAGC AGG (reversed) Intronic
900800493 1:4734190-4734212 CTAAGAAGGAGCATCTGAGCGGG - Intronic
901770304 1:11526814-11526836 CCAAGGAGCAGCAGCACACCCGG + Exonic
905269380 1:36777089-36777111 CTTAATTACAGCAGCTCAGCGGG - Intergenic
906031121 1:42720924-42720946 ATAGGTAGCTGCAGCTGAGCTGG - Intergenic
906946733 1:50300907-50300929 ATAAGATGCAGCAGCTCATCTGG + Intergenic
907305406 1:53510133-53510155 GTAAGTCGGAGCAGGTCAGCTGG - Intronic
908721198 1:67128093-67128115 ATAAGTAGCAGCAACTAAGCTGG + Intronic
913670845 1:121096145-121096167 CCACGTAGCAGCGGCTCAGTTGG + Exonic
914022609 1:143883568-143883590 CCACGTAGCAGCGGCTCAGTGGG + Intergenic
914661095 1:149791510-149791532 CCACGTAGCAGCGGCTCAGTGGG + Exonic
915226405 1:154414887-154414909 CAAAGTAGCAGCATTTGAGCTGG + Intronic
919090060 1:192967747-192967769 CTAAGAAGGAGCAACTCAGAGGG + Intergenic
920316844 1:205082565-205082587 CTCAGTAGAATTAGCTCAGCTGG + Intergenic
922088292 1:222371571-222371593 ATAAGGAGCAACAGCTCAGTGGG + Intergenic
922107765 1:222527187-222527209 CTAACTGGCATCAGCTCTGCTGG + Intronic
922804477 1:228378343-228378365 CCGCGTAGCAGCGGCTCAGCCGG - Exonic
922857217 1:228785189-228785211 CTGAATAGCAGCATCTCAGATGG + Intergenic
1065017279 10:21473799-21473821 ATAAGAAGCAGCAACCCAGCCGG + Intergenic
1069664597 10:70146174-70146196 AGCAGCAGCAGCAGCTCAGCAGG + Exonic
1069823405 10:71240927-71240949 CTAATTACAAGAAGCTCAGCAGG - Intronic
1072386577 10:94936606-94936628 GGAAGGAGCCGCAGCTCAGCAGG + Intergenic
1073363517 10:102918636-102918658 CACCGCAGCAGCAGCTCAGCAGG - Exonic
1074715113 10:116211240-116211262 ATAAGGAGCAGCAGCTGAGCCGG + Intronic
1076353148 10:129832468-129832490 CTAAGTACCAGAAACTCAGTAGG + Intergenic
1078092892 11:8278268-8278290 CTAGGTAGCAGCAGCTATGGAGG - Intergenic
1078669466 11:13352118-13352140 CTAAGTAGGAGCATCTAAGGAGG + Intronic
1079764778 11:24378362-24378384 CTAAGAAGCAGCAACACAGGAGG + Intergenic
1080918517 11:36685210-36685232 CTCAGAAGCAGCAGCTCCACGGG - Intergenic
1081250535 11:40826390-40826412 AAAAGTAGCTGCAGCTCATCAGG - Intronic
1083764698 11:64836243-64836265 CTCAGGAGCAGGAGCTCTGCAGG - Exonic
1085037657 11:73309581-73309603 CTAAGCAGCATGAACTCAGCAGG + Exonic
1091462968 12:659657-659679 ATGGGTAGCAGCAGCACAGCTGG - Intronic
1095710222 12:45280232-45280254 CTAAGTTGCTGCTTCTCAGCTGG + Intronic
1096001521 12:48134358-48134380 CTCAGTAGCAGCAGATCTGGAGG + Intronic
1103388446 12:120552495-120552517 CTAGGTAGCAGAGGCTCAACGGG + Exonic
1103694046 12:122799780-122799802 CTTAGTAGCTGCAGCACTGCAGG + Intronic
1108580643 13:51825605-51825627 CAAAAAAGAAGCAGCTCAGCAGG - Intergenic
1111462240 13:88560421-88560443 CTAATCAGCAGCATCTCAACTGG + Intergenic
1113958488 13:114112373-114112395 CGAAGGAGCAGAAGCTCTGCGGG + Intronic
1114253072 14:20978132-20978154 CAGAGTAGCAGCAGCTGGGCCGG - Intergenic
1116478740 14:45371943-45371965 ATAAGTAGTAGCTTCTCAGCCGG - Intergenic
1119389833 14:74283665-74283687 CTAGCTAGAAGCAGCTCAGAGGG - Intergenic
1119773969 14:77237240-77237262 CTAAGTAGCAGCAGCTCAGCAGG - Intronic
1120096216 14:80390856-80390878 CTAAGAAGCATCAGCCCAGAGGG + Intergenic
1120521285 14:85530573-85530595 CAGCGTAGCAGCAGCTCGGCCGG - Intronic
1120920571 14:89751812-89751834 CTCAGTAGCTGGAGCTGAGCAGG + Intergenic
1121729038 14:96173689-96173711 CTGTGTAGCTGCAGCTCAGAGGG + Intergenic
1123886141 15:24729876-24729898 CTAAGCAGCAGCAACTCTCCTGG - Intergenic
1125540487 15:40467151-40467173 GCAAGTGGCTGCAGCTCAGCAGG - Exonic
1126315403 15:47364306-47364328 ATGAGCAGCAGGAGCTCAGCTGG + Intronic
1133550387 16:6848757-6848779 CCAAGTAGAAGAAACTCAGCAGG + Intronic
1135942112 16:26830928-26830950 CTAAGTGGCTGCAGCTGTGCAGG + Intergenic
1137714252 16:50588473-50588495 AAATGAAGCAGCAGCTCAGCAGG + Intronic
1138960777 16:62026370-62026392 GTAAGTAGCATCAGCACTGCAGG - Intronic
1139259700 16:65579718-65579740 CTCAGCAGCAGCACCTGAGCAGG - Intergenic
1139404122 16:66704909-66704931 GTAATTAGCAGAAGCCCAGCCGG + Intergenic
1142787217 17:2233670-2233692 CTGAGTAGCAGCATCTGTGCCGG - Intronic
1143791407 17:9298913-9298935 CTAAGTAGCAGCAGCAGATGTGG + Intronic
1144159889 17:12547689-12547711 CTAGTAAGTAGCAGCTCAGCCGG + Intergenic
1144680738 17:17192403-17192425 AAAAAAAGCAGCAGCTCAGCTGG - Exonic
1148717672 17:49727535-49727557 CTAAGTATCATCTGCACAGCTGG - Intronic
1149575299 17:57707669-57707691 CACAGAAGCAGCAGCTGAGCTGG - Intergenic
1149590565 17:57826867-57826889 TTCAGAAGCAGCAGCTCAGCTGG + Intergenic
1149932454 17:60769584-60769606 CTCAGTAGGAGCAGCTAGGCAGG + Intronic
1151381978 17:73732123-73732145 CTCAGTAGCAGCATCTGAGATGG - Intergenic
1151641330 17:75397004-75397026 CTGAGTAGCAGCAGGAAAGCAGG - Intronic
1152097043 17:78278439-78278461 CTTACCAGCAGCAGCTCTGCTGG + Intergenic
1157846642 18:51009597-51009619 ATGAGTAACAGGAGCTCAGCTGG - Intronic
1158785175 18:60703124-60703146 CTAAGCAGCAGCAGAACACCAGG - Intergenic
1160262562 18:77308499-77308521 CTAAGTCTCAGCGGCACAGCTGG - Intergenic
1160619108 18:80158483-80158505 GTAGGAAGCAGCAGCTCTGCTGG - Exonic
1162375864 19:10305056-10305078 GGCAGAAGCAGCAGCTCAGCAGG + Exonic
1163327423 19:16614173-16614195 CAAAGTAGAAGCAGCTGAGAAGG + Intronic
1163610400 19:18298117-18298139 GTAAGTACCAGCTGCTCAGGAGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166328534 19:42065745-42065767 AGCAGCAGCAGCAGCTCAGCCGG + Exonic
1166941988 19:46372899-46372921 CTCAGGAGCAGGAGCCCAGCAGG + Intronic
1167944462 19:52976951-52976973 CTGAGCAGGAGCAGCTGAGCGGG + Intergenic
925409619 2:3632421-3632443 CTCAGGAGCAGCAGCCCTGCCGG - Intronic
935037498 2:99392987-99393009 AGAAGTAGAAGCAGCTCAGGGGG + Exonic
939060517 2:137416289-137416311 TTATGTAGCAGCTCCTCAGCTGG + Intronic
939961941 2:148572818-148572840 TTAAGTTTCTGCAGCTCAGCTGG + Intergenic
946009638 2:216554448-216554470 CAAAGAAGCCACAGCTCAGCAGG - Intronic
1169640314 20:7743841-7743863 ATTACTAGCAGAAGCTCAGCAGG - Intergenic
1170700418 20:18698644-18698666 CTGAGCAGCAGCATCACAGCTGG - Intronic
1172168760 20:32915961-32915983 CTAGGTAACAGCAGCTGGGCAGG - Intronic
1172670360 20:36630755-36630777 CTCAGGGGCAGCAGCTCAGAGGG + Intronic
1173111669 20:40196757-40196779 CTAGTTGGAAGCAGCTCAGCAGG + Intergenic
1173620842 20:44434718-44434740 CTAAACAGCATCAGCTCAGGTGG + Intergenic
1174086180 20:48009279-48009301 CTAAATAGAAGCATGTCAGCTGG - Intergenic
1180918078 22:19503548-19503570 ATTGCTAGCAGCAGCTCAGCAGG - Intronic
1182027111 22:27128797-27128819 CTGAGCAGCAGCAGAACAGCAGG - Intergenic
1182577699 22:31284291-31284313 GCCATTAGCAGCAGCTCAGCTGG - Intronic
1183458899 22:37937718-37937740 ATAAGCAGCAGCAGTTAAGCTGG - Intronic
1183826540 22:40392523-40392545 GTGAGTAGTAGCAGCTCTGCAGG + Intronic
1184179892 22:42813702-42813724 CTAAGCAGGAGCAACTCAGTAGG + Intronic
1184821929 22:46915846-46915868 CTGAGTAGGAGCAGCTCTTCGGG + Intronic
950367266 3:12496234-12496256 CTAAGCAGCAACAGCACAGGAGG - Intronic
951462013 3:22961410-22961432 CCAAGTAGCAGCAGTTGGGCTGG + Intergenic
954846219 3:53559952-53559974 CCAAGAAGCAGCAGCACAGGCGG - Intronic
955984146 3:64555691-64555713 CCAGGTAGCAGCAGATGAGCAGG + Intronic
956471399 3:69570766-69570788 CCACGTAGCTTCAGCTCAGCAGG - Intergenic
961128558 3:124444126-124444148 CTGAGGAGCAGCATCTCAACTGG + Intronic
963280442 3:143379557-143379579 GTAGGTAGCAGCAGTTCAGGAGG + Intronic
964158778 3:153620405-153620427 CTAAGTAGATGCAAATCAGCAGG + Intergenic
965994438 3:174862552-174862574 TGAGGTAGCAGGAGCTCAGCAGG - Intronic
970833111 4:20366635-20366657 CTAAGTAATAGGAGCTCAGTAGG + Intronic
975664238 4:76719049-76719071 CAAATGAGGAGCAGCTCAGCAGG - Intronic
976408689 4:84687975-84687997 CTGAGTTGCAGCTGCTCAGGAGG - Intronic
983089050 4:163482486-163482508 CTAAGTTTCAGCAGATCAGTGGG - Intergenic
983760041 4:171394582-171394604 CTTGTTAGCAGAAGCTCAGCAGG + Intergenic
988776831 5:34484719-34484741 TTAAGAATCAGCAGCACAGCAGG + Intergenic
989650531 5:43684024-43684046 CTAAGAAGGATCAGCTCAGATGG - Intronic
990112373 5:52343413-52343435 CTAAGTGGCAGCATCTCATCGGG - Intergenic
995995361 5:118291785-118291807 GTAAGTAGTGGCAGCACAGCGGG + Intergenic
997656317 5:135557506-135557528 CCAAACAGCAGCAGCACAGCTGG - Intergenic
997891550 5:137681548-137681570 CTAAGTATGAGGAGCTCTGCAGG + Intronic
999684911 5:154093799-154093821 CTGGGTAGCAGTAGCTCAGTAGG - Intronic
1000288419 5:159847406-159847428 ATCGGTAGCAGCAGCCCAGCTGG + Intergenic
1004991433 6:21142545-21142567 CTCATTGGCAGCAACTCAGCAGG + Intronic
1007090665 6:39182873-39182895 CTAAAACGCAGCAGCTCAGCTGG + Intergenic
1011576780 6:88809924-88809946 CTAAGTCGCAGCTACTCAGGAGG + Intronic
1012183587 6:96186310-96186332 CTAATTAGCACCAGCTTTGCTGG - Intronic
1013543983 6:111137656-111137678 CTTAGTTGCACCAGTTCAGCAGG + Intronic
1015591920 6:134830426-134830448 CTATGTACCAGCAGCTCTGGGGG - Intergenic
1016023420 6:139259494-139259516 CCAAGTAGCAGCTCCTCATCTGG + Intronic
1017849631 6:158294061-158294083 CTAATTAGAAGCAGGTCATCGGG + Intronic
1018916173 6:168133919-168133941 CTGAGAACCAGCAGGTCAGCAGG - Intergenic
1019686546 7:2384991-2385013 CTGGGTGGCTGCAGCTCAGCAGG + Intergenic
1023343887 7:39251656-39251678 CTCAGAAACAGGAGCTCAGCTGG - Intronic
1028905740 7:96152248-96152270 CTATGTAGCAGCAGGAGAGCTGG + Intronic
1032476352 7:132214017-132214039 CTCAGTATCAGCAGATGAGCTGG + Intronic
1035531372 8:354240-354262 CTAAGAAGCAGTGTCTCAGCCGG - Intergenic
1037601965 8:20404506-20404528 CTGAGTACCAGGAACTCAGCAGG - Intergenic
1038199988 8:25402935-25402957 TTAAGTAGCAGCAGGTTAGGAGG - Intronic
1040386166 8:46916371-46916393 CTAAGAAGCAGCAAAGCAGCCGG + Intergenic
1043385163 8:79741476-79741498 CTTGGTAGCAGCTGCTGAGCAGG - Intergenic
1046160322 8:110354524-110354546 CAAAGAAGCAGCAGCTCAGATGG + Intergenic
1046744319 8:117860785-117860807 CAAATTAGCAGAAGCTGAGCTGG + Intronic
1048607763 8:135987274-135987296 CTAGGTCAGAGCAGCTCAGCAGG + Intergenic
1048814348 8:138317897-138317919 CTAAGTAGCAGCTGCTCCTGTGG - Intronic
1049628871 8:143640642-143640664 CTAAGAAGCAACACCTCAGCCGG + Intronic
1050732670 9:8727303-8727325 CTAGGTAGCTACAGCTCTGCTGG + Intronic
1051697740 9:19788186-19788208 AGGAGTAGCAGCAACTCAGCGGG - Intergenic
1056196769 9:84236770-84236792 CCATGTAGCATCAGCTCGGCTGG + Intergenic
1058573989 9:106380369-106380391 CTAAATAGCCACAGCTCTGCTGG + Intergenic
1059389700 9:113991210-113991232 CTGCTGAGCAGCAGCTCAGCTGG - Intronic
1060912676 9:127363288-127363310 AAAAGTTGCAGGAGCTCAGCAGG - Intronic
1061492243 9:130952078-130952100 CTTTGTACCAGCAGCTGAGCTGG + Intergenic
1187119405 X:16389100-16389122 GTCATTAGCAGAAGCTCAGCTGG - Intergenic
1197408328 X:126083826-126083848 CTCAGAAGCAGCAGCTCGGAGGG - Intergenic
1200215273 X:154365506-154365528 CTGAGCACCAGCAGCTCGGCTGG + Intronic
1201416869 Y:13755652-13755674 CTAAGAAGCAGCCACTCTGCTGG + Intergenic