ID: 1119774258

View in Genome Browser
Species Human (GRCh38)
Location 14:77238821-77238843
Sequence CACTACCCACTTGAGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119774258_1119774270 17 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774270 14:77238861-77238883 GGGACTGGGACACCCCGGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 294
1119774258_1119774266 3 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774266 14:77238847-77238869 TGGTGCAGGATGGTGGGACTGGG 0: 1
1: 0
2: 1
3: 30
4: 323
1119774258_1119774271 27 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774271 14:77238871-77238893 CACCCCGGGGTGGCTCTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 170
1119774258_1119774262 -7 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774262 14:77238837-77238859 GGTAGTGAGTTGGTGCAGGATGG 0: 1
1: 0
2: 2
3: 8
4: 193
1119774258_1119774264 -3 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774264 14:77238841-77238863 GTGAGTTGGTGCAGGATGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 336
1119774258_1119774263 -4 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774263 14:77238840-77238862 AGTGAGTTGGTGCAGGATGGTGG 0: 1
1: 0
2: 0
3: 27
4: 384
1119774258_1119774265 2 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774265 14:77238846-77238868 TTGGTGCAGGATGGTGGGACTGG 0: 1
1: 0
2: 2
3: 17
4: 281
1119774258_1119774269 14 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774269 14:77238858-77238880 GGTGGGACTGGGACACCCCGGGG 0: 1
1: 0
2: 1
3: 22
4: 176
1119774258_1119774267 12 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774267 14:77238856-77238878 ATGGTGGGACTGGGACACCCCGG 0: 1
1: 1
2: 0
3: 10
4: 209
1119774258_1119774268 13 Left 1119774258 14:77238821-77238843 CCTGGGTCCTCAAGTGGGTAGTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1119774268 14:77238857-77238879 TGGTGGGACTGGGACACCCCGGG 0: 1
1: 0
2: 2
3: 29
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119774258 Original CRISPR CACTACCCACTTGAGGACCC AGG (reversed) Intronic
900316972 1:2061757-2061779 CACTGCCCACTCGGGGTCCCAGG + Intronic
900939293 1:5787454-5787476 CAGTCCCCACCTGAGGTCCCAGG - Intergenic
907306196 1:53514362-53514384 TTCTCCCCACTGGAGGACCCTGG - Intronic
907496182 1:54846313-54846335 CACTACCCTCCTGAGCAACCAGG - Intergenic
907510326 1:54953145-54953167 CACTGTCCACTTGATGACTCAGG + Intergenic
911396209 1:97314158-97314180 GAGAACCCACCTGAGGACCCAGG + Intronic
916678835 1:167086367-167086389 TACTACCCTCTTGAGGTCCAGGG + Intronic
919894361 1:201999747-201999769 CATTACCCTCCTGGGGACCCAGG - Intronic
922349655 1:224724747-224724769 CTCTTCCCACTTGAGGAAGCTGG + Intronic
923144321 1:231187242-231187264 TACTCCCCACTTGGGGAGCCTGG - Intronic
1063931682 10:11034940-11034962 CAGCACCCACTTGAGTACCAAGG - Intronic
1069918710 10:71803048-71803070 ACCTACTCACTTGAGGGCCCTGG + Exonic
1070485614 10:76928018-76928040 CACTACCCACATTAAGACCCTGG + Intronic
1076217903 10:128710766-128710788 CAGTTGCCACTTGAGGTCCCAGG + Intergenic
1077054424 11:583956-583978 CAGTAGCCACTTGAGGACCATGG - Intronic
1077544751 11:3164555-3164577 CAAGACCCTCTTGAGGACTCAGG + Intronic
1081176136 11:39928842-39928864 CATTCCCCAGTTGAGGACCATGG + Intergenic
1081252280 11:40850604-40850626 CAGGACCCACTTGAGGAGGCAGG + Intronic
1081805346 11:45886925-45886947 CTCTGCCCACCTGAGGACCTGGG - Intronic
1083876454 11:65526502-65526524 CCCTACCGCCCTGAGGACCCTGG - Intronic
1084483537 11:69435270-69435292 CACATCCCCCTTGAGGTCCCAGG - Intergenic
1085514834 11:77106017-77106039 CCCCACCCACCTGAGAACCCAGG + Intronic
1089905465 11:122033426-122033448 CACCACCTCCTTGAGGACCAAGG - Intergenic
1096005700 12:48169269-48169291 CACCACTGACTTGAGGACCTTGG + Intronic
1096091366 12:48904038-48904060 CCCTACCCAGTGGAGGACCGCGG - Intronic
1101633872 12:106521318-106521340 CACTACCCACTTGGCGGTCCAGG - Intronic
1102510398 12:113411403-113411425 CCCTCCCCACTCCAGGACCCTGG + Intronic
1105512579 13:21062477-21062499 CACTATCCATTTGAGGACTGTGG + Intergenic
1113592823 13:111512804-111512826 CCCTACCCACTGCCGGACCCAGG - Intergenic
1118522102 14:66596727-66596749 CTCTACACTCTTGGGGACCCAGG - Intronic
1119029039 14:71177067-71177089 CGTTTCCCACTTCAGGACCCTGG - Intergenic
1119774258 14:77238821-77238843 CACTACCCACTTGAGGACCCAGG - Intronic
1121265688 14:92600988-92601010 CACTAGCCACATGTGGCCCCTGG - Intronic
1128699644 15:69794878-69794900 CACTACCCACTGAGTGACCCTGG + Intergenic
1128772200 15:70290951-70290973 CACTGCCCAGCTAAGGACCCTGG + Intergenic
1129468661 15:75738377-75738399 CCCTACTCACCTGGGGACCCCGG + Intergenic
1136143429 16:28301557-28301579 CACTTCCCACATGAGGAGCCTGG - Intronic
1139391486 16:66608639-66608661 CACAGCCCACTTGAGGTCACAGG - Intronic
1148871267 17:50660042-50660064 CACCACCAACTTGGGGACCCTGG - Intronic
1149701474 17:58658775-58658797 AACTTCCCACCTGAAGACCCAGG + Intronic
1159521684 18:69532744-69532766 CACTACCCTCCTGAGGAGCTGGG - Intronic
1161169425 19:2805548-2805570 CACAACCCACCTGTGGACCCAGG - Intronic
1164880815 19:31731418-31731440 CACCACCAACTTGGGGACACGGG - Intergenic
1167293051 19:48635078-48635100 CACGCCCCACTGGGGGACCCAGG + Intronic
1168113344 19:54207394-54207416 CACCACCTGCTTGCGGACCCTGG - Exonic
927961523 2:27243218-27243240 CACTCCCCACATCATGACCCGGG + Exonic
929823669 2:45293064-45293086 CACTACTCACTAGAGGTGCCAGG - Intergenic
934014648 2:87866798-87866820 AACTAGCCACGTGAGGCCCCTGG - Intergenic
940524569 2:154796505-154796527 CATTACTCAGTTGAGGATCCTGG + Intronic
940674149 2:156708363-156708385 AATTACCTACTTCAGGACCCAGG + Intergenic
948214245 2:236216797-236216819 CACTGCTCTCTTCAGGACCCAGG + Intronic
948783612 2:240339848-240339870 CACTCCCAACCTGAAGACCCCGG - Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1173749862 20:45468766-45468788 CACTTCCCACCTGAGGGCCCTGG - Intergenic
1175260091 20:57668785-57668807 CATGACCCACCTCAGGACCCTGG + Intronic
1183396167 22:37572039-37572061 CCCTGCCCACGTGAGGACGCAGG + Intronic
1184140295 22:42574456-42574478 CTCCACACCCTTGAGGACCCTGG - Intergenic
1184474097 22:44711384-44711406 GACTACCCCCTTGAGGCCCCAGG - Intronic
1185115828 22:48937315-48937337 CACCACTCACTGGAGGACCGAGG + Intergenic
1185294186 22:50045343-50045365 GACCACCCACTTGAGGATGCTGG + Exonic
954465714 3:50653499-50653521 CACTACCCATGGGAGAACCCTGG - Intergenic
956178790 3:66499716-66499738 CATTACCCACTGGAAGACCAAGG + Intronic
961239797 3:125400767-125400789 CACTGGCCACTTGAGGATGCTGG - Intergenic
964609611 3:158597921-158597943 CACTTCTCACTTGAGAACCTGGG + Intronic
968478049 4:821642-821664 AATTACTCCCTTGAGGACCCTGG + Intronic
971037936 4:22715496-22715518 CACTACACACTTGATGACTACGG - Intergenic
972336274 4:38109574-38109596 AACTACCCACTTGATGTCACTGG + Intronic
972364685 4:38363345-38363367 CACCACCCACTAGAAGCCCCAGG + Intergenic
972717063 4:41657053-41657075 CACCTCCCACCTGAGGCCCCAGG + Intronic
972986675 4:44773726-44773748 AATTACCCACTTGAGAACACAGG - Intergenic
975204805 4:71632759-71632781 CACTACAAACTTAAGAACCCAGG - Intergenic
979093445 4:116516687-116516709 AATTACCCACTTGAGAACACAGG + Intergenic
980002670 4:127508578-127508600 CACTGCCCACCTGATGACACTGG + Intergenic
981096545 4:140788157-140788179 CAGGACCCACTTGAGGAGGCAGG + Intergenic
985647137 5:1090278-1090300 CTCCACCAACTTTAGGACCCTGG + Intronic
991164096 5:63541490-63541512 CTCTACCTACCTCAGGACCCAGG - Intergenic
993571281 5:89542206-89542228 CACTACCCACTTCAGGAAAGGGG + Intergenic
995944299 5:117624335-117624357 CATTACCGACTTGAGGACTCAGG + Intergenic
1000252058 5:159505098-159505120 CACTGGCCACTTGAGGGGCCAGG - Intergenic
1000269570 5:159671172-159671194 CACTAAATATTTGAGGACCCTGG - Intergenic
1003620112 6:7692020-7692042 CACTCCACACCTGAGGACCATGG - Intergenic
1008250075 6:49229002-49229024 CACTAAACACTGGAGCACCCAGG - Intergenic
1009340401 6:62547463-62547485 TGCTACCCACATGATGACCCGGG - Intergenic
1017749719 6:157479974-157479996 CCCTACCCCCTCGAGGATCCTGG - Intronic
1021052148 7:16000559-16000581 CAATACCAACTTTAGGACCTGGG - Intergenic
1023057736 7:36303321-36303343 CACTTCTCCCCTGAGGACCCCGG + Intergenic
1023860239 7:44213998-44214020 CCTTTCCCACTTGAGGACCCTGG + Exonic
1035367370 7:158357877-158357899 CACCACCAACTAGAGGGCCCCGG + Intronic
1039382918 8:37102763-37102785 CACCTCCCTCTTGAGCACCCTGG + Intergenic
1039482245 8:37882891-37882913 CAAATCCCACTTTAGGACCCAGG - Intronic
1059512786 9:114864883-114864905 AGTGACCCACTTGAGGACCCAGG - Intergenic
1060009227 9:120028785-120028807 CACCATCCACATGAGAACCCAGG + Intergenic
1060968434 9:127724429-127724451 CACTGGGCACTTGAGGCCCCTGG + Intronic
1061061136 9:128250928-128250950 CCCTACTCACCTGGGGACCCCGG - Exonic
1193554697 X:82938959-82938981 CACTACCCACCTGATTACACTGG + Intergenic
1195418602 X:104647608-104647630 CACCACCGACTTGAGGATCTTGG + Intronic
1196343883 X:114629279-114629301 CATTACCCACTTTAGGAGTCGGG - Intronic
1197729637 X:129798680-129798702 GAAAACCCACTTGAGGAGCCTGG + Intergenic
1198210578 X:134512225-134512247 CCCTACCCACTTCAGGGCCTTGG - Intronic
1199129830 X:144171713-144171735 AACTAGCCACGTGAGGCCCCTGG + Intergenic
1199472151 X:148207183-148207205 CACTCCTCAAATGAGGACCCAGG + Intergenic