ID: 1119774489

View in Genome Browser
Species Human (GRCh38)
Location 14:77239914-77239936
Sequence GCCACCTTCAGAACAATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 152}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119774481_1119774489 12 Left 1119774481 14:77239879-77239901 CCTGCCTCCCTGTTGAGATGGGA 0: 1
1: 0
2: 4
3: 41
4: 242
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774475_1119774489 26 Left 1119774475 14:77239865-77239887 CCCATCCACCATGTCCTGCCTCC 0: 1
1: 0
2: 4
3: 32
4: 379
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774474_1119774489 27 Left 1119774474 14:77239864-77239886 CCCCATCCACCATGTCCTGCCTC 0: 1
1: 0
2: 5
3: 50
4: 543
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774482_1119774489 8 Left 1119774482 14:77239883-77239905 CCTCCCTGTTGAGATGGGAGCCT 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774484_1119774489 4 Left 1119774484 14:77239887-77239909 CCTGTTGAGATGGGAGCCTTTCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774476_1119774489 25 Left 1119774476 14:77239866-77239888 CCATCCACCATGTCCTGCCTCCC 0: 1
1: 0
2: 7
3: 104
4: 954
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774473_1119774489 30 Left 1119774473 14:77239861-77239883 CCTCCCCATCCACCATGTCCTGC 0: 1
1: 0
2: 3
3: 44
4: 513
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774483_1119774489 5 Left 1119774483 14:77239886-77239908 CCCTGTTGAGATGGGAGCCTTTC 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774478_1119774489 18 Left 1119774478 14:77239873-77239895 CCATGTCCTGCCTCCCTGTTGAG 0: 1
1: 0
2: 1
3: 34
4: 348
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1119774477_1119774489 21 Left 1119774477 14:77239870-77239892 CCACCATGTCCTGCCTCCCTGTT 0: 1
1: 0
2: 7
3: 112
4: 1065
Right 1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119774489 Original CRISPR GCCACCTTCAGAACAATCCA GGG Intronic
902017503 1:13320075-13320097 GCCACCAACAGGACAATGCATGG - Intronic
902131715 1:14267425-14267447 GCCACATTCAAAGCAATCCCAGG + Intergenic
902942176 1:19808438-19808460 ACCCCCATCAGAACAAGCCAAGG - Intergenic
903611336 1:24616050-24616072 GCCATCTGCAGAAAAATTCATGG - Intergenic
903758019 1:25676522-25676544 TCCACTTTCAGCACAGTCCAAGG - Intronic
903864490 1:26388440-26388462 GCCAGCTGCAGAGCACTCCAAGG + Intergenic
905395366 1:37663272-37663294 GCCACCTTCAGCATAAACCAGGG - Intergenic
906543004 1:46602579-46602601 ACCACATTCAGAGCCATCCAGGG - Intronic
907184939 1:52602391-52602413 GCCACCTCCGGAACAAGCCATGG + Exonic
908091809 1:60694054-60694076 GCCACATTCAAAACCATCCTTGG - Intergenic
908758972 1:67494639-67494661 GCCCTCTTCAGAAGAAGCCAAGG - Intergenic
912964682 1:114227428-114227450 GCAACCTTCAGAACATTCAGAGG + Intergenic
914426030 1:147577498-147577520 GATACCTCCAGAACATTCCACGG - Intronic
917016592 1:170538622-170538644 TCATCCTACAGAACAATCCAAGG - Intronic
918381546 1:183960693-183960715 GTCACATTCAGAGCAATCCTGGG - Intronic
918733199 1:188023765-188023787 GCCACATTCAAAGCCATCCAGGG + Intergenic
1066207064 10:33199752-33199774 ACCACCTCCAGAACTTTCCATGG - Intronic
1066371115 10:34819128-34819150 GCCCCCTTCAAAATATTCCAGGG + Intergenic
1069828387 10:71268124-71268146 TCCACATTCAGGAAAATCCAAGG + Intronic
1070678805 10:78434476-78434498 GCCCCCTGCAGACCACTCCACGG - Intergenic
1075279532 10:121127881-121127903 TCCCCCTTCACAGCAATCCATGG + Intergenic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1075518575 10:123129751-123129773 GGCACAATCAGAACAATCAAAGG - Intergenic
1075524140 10:123168485-123168507 GCCACCTTCAAAGCCATCCTGGG - Exonic
1076287766 10:129317078-129317100 GCCACATTCAGAGCCATCCTGGG - Intergenic
1081805900 11:45890447-45890469 GCCACATTCAGAGCCATCCTGGG + Intronic
1082735557 11:56851644-56851666 GACACCTTCAGATCCATCCATGG - Intergenic
1083958488 11:66000470-66000492 CCCATCTTCAGAACAGTCCTGGG - Exonic
1085226191 11:74923336-74923358 GCCACCATCAGCAAATTCCAAGG + Intronic
1086326298 11:85703835-85703857 GCCACTTTCAGAACAGTGGAAGG - Intronic
1091390267 12:122014-122036 GCCACGTTGAGAACAGTCCAGGG + Intronic
1096026966 12:48374754-48374776 CCCACCTTCACAACCAACCAGGG - Intergenic
1097389372 12:58990576-58990598 GCAAGCTTCATAACAATCCAAGG - Intergenic
1101428906 12:104610677-104610699 GTCAGTTTCAGAACAAGCCAGGG - Intronic
1102385703 12:112507679-112507701 GCCAAAGTCAGAAGAATCCAAGG - Exonic
1106079245 13:26486932-26486954 GCCACCACCAGAACAAGCCAGGG - Intergenic
1106434007 13:29708059-29708081 GACACCTTCAGAACAAGGCTGGG - Intergenic
1107677079 13:42808550-42808572 GCCACCTTAAGAAAAAGACATGG - Intergenic
1109238572 13:59854236-59854258 GGCATCTTCAGAAGACTCCAGGG - Intronic
1109257526 13:60101444-60101466 GCCACATTCAGAACCGTCCTGGG - Intronic
1110700123 13:78537359-78537381 GCTACCTTCAGAAATATCAAAGG + Intergenic
1116654070 14:47628940-47628962 CCCACCTCCAGAACTCTCCATGG + Intronic
1117278108 14:54209764-54209786 GCAAACTTCTGAAAAATCCAAGG + Intergenic
1117292708 14:54349102-54349124 GCCACCTTCAGTACAAAGAATGG + Intergenic
1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG + Intronic
1121051198 14:90819992-90820014 GTCACCTGGAGAACCATCCAGGG - Intergenic
1129603122 15:77011877-77011899 GCCAACTCCAGGACAATGCAAGG - Intronic
1129790688 15:78338964-78338986 GCCACCTCCAGAAGTTTCCAGGG + Intergenic
1130403307 15:83577250-83577272 GCCACATTCAGAGCCATCCTGGG + Intronic
1131228449 15:90643837-90643859 GCAACCCTCAGTACACTCCAGGG - Intronic
1132926704 16:2433508-2433530 GCCGCCCTCAGAACAAACCAAGG + Intronic
1135043808 16:19137969-19137991 GCCACATTCAAAACCATCCTGGG - Intronic
1135655454 16:24244508-24244530 GCCACCTTCAGAATAACAAACGG - Intergenic
1137802364 16:51273020-51273042 GCAATCTTCAGACCAATCCAGGG + Intergenic
1140208394 16:72951772-72951794 GCCACCTTGAGAACAATCTATGG + Intronic
1141146043 16:81530746-81530768 GCCTCCTCCAGATCCATCCAAGG + Intronic
1141275348 16:82582902-82582924 TCACCTTTCAGAACAATCCAAGG + Intergenic
1142109301 16:88322773-88322795 CCCACCTTCAGGAGAATCCGTGG + Intergenic
1142182700 16:88678954-88678976 GCCAGCTCCAGCAGAATCCAGGG + Intronic
1143054129 17:4149918-4149940 GCCTGCTTCAGAACAGTCCCCGG - Exonic
1144334151 17:14254465-14254487 GGCACCATCAGCACAACCCAGGG - Intergenic
1144564485 17:16348785-16348807 GCCCCTTTCAGCACCATCCAGGG + Intronic
1147686062 17:42287618-42287640 TCTACCTTCAGAAAAGTCCAGGG - Exonic
1152029159 17:77830975-77830997 ACCACCTCCAGAGAAATCCAAGG + Intergenic
1157117376 18:44874784-44874806 ACCATCTGCAGAACAATCCTGGG + Intronic
1157319068 18:46620361-46620383 GCAACCTTCAGAACATTCCCCGG - Intronic
1158065145 18:53398109-53398131 TCCAACTTCTGAAGAATCCAGGG + Intronic
1158668558 18:59454677-59454699 CCCACCCTCAGAGCCATCCAAGG - Intronic
1160083756 18:75754643-75754665 TCCACCTTCAGAACTGTGCATGG + Intergenic
1160624863 18:80196724-80196746 CCCCCCTCCAGAAGAATCCAGGG - Intronic
1161745074 19:6052773-6052795 TACACCTTCAAAATAATCCATGG + Intronic
1161930722 19:7337696-7337718 GCAATCTTCACAACCATCCAAGG - Intergenic
1163365574 19:16874184-16874206 GCCACCTTCAGCTCATTCCTGGG + Intronic
1165999140 19:39867399-39867421 GCCACCATGAGAACAAGCCTGGG + Intronic
1166953479 19:46446174-46446196 GCCACCTTCAGAGCCATCCTGGG + Intergenic
929561854 2:42961148-42961170 GCCACTTCCAGAACTTTCCAGGG + Intergenic
930650049 2:53955313-53955335 GCCACATTCAAAACAATCCTGGG - Intronic
931684353 2:64780932-64780954 GCCTCCTTCAGAACAATTTGAGG + Intergenic
933554455 2:83814548-83814570 GCCAGCTTCAGAACTATCTATGG + Intergenic
935290277 2:101604416-101604438 GCACCCTTCAGAACTCTCCAGGG + Intergenic
935608273 2:104992903-104992925 GCCACCTCCACAAAAATGCAAGG + Intergenic
936258820 2:110939716-110939738 GCCACATTCAAAGCCATCCAGGG - Intronic
937708253 2:124946820-124946842 GCCACATTCAAAGCTATCCAGGG + Intergenic
938884306 2:135627654-135627676 TCCACCTTCAGGTTAATCCATGG - Intronic
940265377 2:151830409-151830431 GCCACATTCAAAACCATCCTAGG + Intergenic
940452732 2:153860372-153860394 GCAAAGTTCAGAACAATCGAGGG + Intergenic
941379017 2:164768355-164768377 GCCACATTCAAAACCATCCTGGG - Intronic
941461960 2:165782446-165782468 GCCACATTCAAAGCCATCCAGGG + Intronic
941807470 2:169723504-169723526 GCCACATTCAAAGCAATCCTGGG - Intronic
947914721 2:233823716-233823738 GCCATCCCCAGAAGAATCCAGGG - Intronic
948559208 2:238839544-238839566 GCCAGTTCCAGAAAAATCCAGGG - Intergenic
948709818 2:239818711-239818733 GGCACCTTCACAACCATCCAGGG + Intergenic
948879851 2:240851087-240851109 GCCACCTGCAGCACAGTCCATGG - Intergenic
1169970905 20:11268539-11268561 GCCACATTCAAAGCAATCCTGGG - Intergenic
1170926222 20:20726865-20726887 GACACCATCAGAACAAGTCAAGG + Intergenic
1173701000 20:45071524-45071546 GCCACCTTCAGACTAATTTATGG - Intronic
1173931202 20:46820883-46820905 GCCACCTTCAGCACACCCTAGGG - Intergenic
1174300991 20:49582146-49582168 GCCACCATGAGAACAAACCTGGG + Intergenic
1178105410 21:29313513-29313535 CCCAAATTCAGAACAATGCAAGG + Intronic
1179437134 21:41369704-41369726 GCCACCTTCGGTAGAAGCCAGGG + Intronic
1179560605 21:42213688-42213710 CCCACCTTCTGAACACTCTAAGG - Intronic
1181266832 22:21635423-21635445 GCCACCTCCACCACAATCCCTGG - Intronic
1182911367 22:33987346-33987368 GCCCCCTTCAAAACTCTCCAGGG + Intergenic
1184235069 22:43179002-43179024 GCCACCTCCAGAACCAGTCAGGG - Intronic
950688476 3:14636415-14636437 GTAAACTTCAGCACAATCCATGG + Intergenic
953480534 3:43247838-43247860 GCCACCCTCTGCACAAACCAGGG + Intergenic
954692533 3:52403256-52403278 CCCTCCATCAGACCAATCCAAGG - Exonic
955026668 3:55174201-55174223 GCCATCTTCAGAACACAGCAAGG - Intergenic
955141754 3:56276898-56276920 GCCACATTCAAAACCATCCTGGG + Intronic
955641479 3:61090318-61090340 GCAACTTTCATAACAATCCTTGG - Intronic
956084393 3:65594917-65594939 GCCAACATCAGAATAATGCATGG + Intronic
960031723 3:113060721-113060743 ACCATCTTCAGAACAGTCCAAGG + Intergenic
961263395 3:125620560-125620582 GCCACATTCAAAACCATCCTAGG - Intergenic
962072607 3:132047254-132047276 GCCACCATGAGAACAAGCCCAGG + Intronic
964817077 3:160728743-160728765 ACCACCTTCACAGCAATCCTGGG + Intergenic
966498092 3:180603140-180603162 GCCACCTTTAGAGCAATTCATGG + Exonic
967614879 3:191552956-191552978 GCCACCTTCAGAAACATCGAAGG + Intergenic
969670912 4:8589806-8589828 GCCTGCTCCAGAACATTCCATGG - Intronic
976200948 4:82578239-82578261 GCCAAAGTCAGAAGAATCCAAGG + Intergenic
976671200 4:87656045-87656067 GCAACCTTCACTACAATACATGG + Intronic
977564308 4:98566283-98566305 GCCACTTTCAGAAAAATGCTGGG - Intronic
980592428 4:134908009-134908031 GGCACCTTCAGACTAATCCTGGG - Intergenic
981237371 4:142434953-142434975 GCCACATTCAAAGCAATCCTGGG + Intronic
981410485 4:144424650-144424672 ATCACCCTCAGAACTATCCATGG + Intergenic
983591098 4:169412348-169412370 TCCACCTTCAGAAGAAACAAAGG - Intronic
984657933 4:182339837-182339859 GACTTCTTTAGAACAATCCAAGG - Intronic
987847136 5:23301675-23301697 GCCACAGTCAGAAGAATCCAAGG + Intergenic
989808690 5:45645492-45645514 GCCACATTGAAAATAATCCATGG + Exonic
992378361 5:76212132-76212154 GCCACCCTCAGAACCTTCCTCGG + Intronic
993337534 5:86679650-86679672 GCCCCCTTCAGTTCATTCCAAGG + Intergenic
996728180 5:126691182-126691204 GCAGCCTTCAGAAAACTCCATGG + Intergenic
997718101 5:136057095-136057117 GCCACTGTCAGAACCATGCAAGG + Intronic
1005356310 6:24986983-24987005 GCCGCCTTCAAAACCATCCTGGG + Intronic
1005718983 6:28582187-28582209 GCCACATTCAGAACTGTCCTGGG - Intronic
1007413610 6:41679340-41679362 GCCACTTTCAGATCCCTCCAGGG + Intergenic
1009450659 6:63796320-63796342 TGCCCCTTCAGAACAATCCGAGG - Intronic
1010396449 6:75398269-75398291 ACCAGCTTCAAAACAATCAAGGG - Intronic
1010544395 6:77132106-77132128 ACCACCTTATGAACAATCTAGGG + Intergenic
1011787732 6:90865614-90865636 GCCAGCTCCAGGAAAATCCATGG + Intergenic
1012519965 6:100109626-100109648 GCCACCTTAAGAAGGTTCCATGG - Intergenic
1015091190 6:129361599-129361621 GCTGCCTTCAGAACAATCCCAGG - Intronic
1016337137 6:143018955-143018977 GCCACCTGGAGAAAAACCCAAGG - Intergenic
1017350755 6:153438985-153439007 GCCACATTCTGAACAATCAGGGG + Intergenic
1031603246 7:123738954-123738976 GCCACCTTCAAAGCCATCCTGGG + Intronic
1033713418 7:143974172-143974194 GTCAGCTTCAGAACAAGCCAGGG + Intergenic
1034340285 7:150348522-150348544 GTCAGTTTCAGAACAATCCATGG - Intergenic
1035346527 7:158203527-158203549 GCCACATAGAGAACAATCCAGGG - Intronic
1036759735 8:11499531-11499553 GCAGCCTTCAGCACAAGCCACGG - Intronic
1037380613 8:18281466-18281488 GCCACATTCAAAGCAATCCTGGG + Intergenic
1042747428 8:72122398-72122420 TCCACCTTCAGGCCTATCCAGGG - Intergenic
1044243902 8:89918660-89918682 GACACCTGCAGAATAATCAAGGG - Intronic
1046773301 8:118137826-118137848 GCCACATTCAAAGCCATCCAGGG + Intergenic
1047224169 8:122942722-122942744 GCCACCTTGAGAAGTTTCCAGGG + Intronic
1047408400 8:124604285-124604307 GCCACATTCAAAACCATCCTGGG + Intronic
1047434787 8:124827226-124827248 GCAACCTCCAGAATAAACCATGG - Intergenic
1053225380 9:36350858-36350880 GCCACATTCAGAGCCATCCTGGG - Intronic
1055800249 9:80027419-80027441 GTCACCATCAGAAATATCCATGG - Intergenic
1055915523 9:81396405-81396427 CCAAACTTCAGAAGAATCCAAGG - Intergenic
1056381814 9:86062928-86062950 GAGACCTTCAGAAAGATCCAGGG - Intronic
1058200932 9:102039527-102039549 GCCACATTCAAAGCCATCCAGGG + Intergenic
1058278833 9:103085202-103085224 ACCACATTCAGAACTATCCTGGG + Intergenic
1060620563 9:125062052-125062074 GTCACTTTCAGAATAATGCAAGG - Intronic
1062276545 9:135733986-135734008 GCCACCTTCAAAACACACCTTGG + Intronic
1062589399 9:137266673-137266695 GACACCCCCAGAACAAGCCACGG - Intronic
1186270722 X:7884927-7884949 GTCTCCTTCAGAACAAGCAATGG + Intergenic
1187413548 X:19072099-19072121 GCCACATTCAAAACCATCCTGGG - Intronic
1188416688 X:29944054-29944076 GCCATCTTAAGCACAATCGAGGG + Intronic
1188504071 X:30862280-30862302 ACCACATTCAGAACACTTCATGG + Intronic
1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG + Intergenic
1193311944 X:80020928-80020950 GCAACCTGCAAAAGAATCCAGGG + Intronic
1195053089 X:101116230-101116252 GCCTCATTCAGAGCAATCCTGGG - Intronic
1200275767 X:154730875-154730897 GCCATCTTCAGGACAATCACAGG - Intronic
1201792746 Y:17860036-17860058 TCCACCTTCAGAATCACCCAAGG + Intergenic
1201808808 Y:18045950-18045972 TCCACCTTCAGAATCACCCAAGG - Intergenic
1202354281 Y:24029286-24029308 TCCACCTTCAGAATCACCCAAGG + Intergenic
1202516498 Y:25640826-25640848 TCCACCTTCAGAATCACCCAAGG - Intergenic