ID: 1119776300

View in Genome Browser
Species Human (GRCh38)
Location 14:77250952-77250974
Sequence CCCTTTCCAGGCATGCGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119776289_1119776300 19 Left 1119776289 14:77250910-77250932 CCCATCATCTTACCCAGAACCTG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1119776290_1119776300 18 Left 1119776290 14:77250911-77250933 CCATCATCTTACCCAGAACCTGA 0: 1
1: 0
2: 1
3: 10
4: 233
Right 1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1119776293_1119776300 0 Left 1119776293 14:77250929-77250951 CCTGATGTCTTTTGTTCCCAGCC 0: 1
1: 0
2: 0
3: 36
4: 429
Right 1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1119776291_1119776300 7 Left 1119776291 14:77250922-77250944 CCCAGAACCTGATGTCTTTTGTT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1119776292_1119776300 6 Left 1119776292 14:77250923-77250945 CCAGAACCTGATGTCTTTTGTTC 0: 1
1: 0
2: 1
3: 14
4: 223
Right 1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119776300 Original CRISPR CCCTTTCCAGGCATGCGCTT TGG Intronic
903543856 1:24111489-24111511 CCCTTGCCAGTCATGAGCTGAGG + Intronic
906913719 1:49984063-49984085 CCCTTGCCTGGCATGGACTTAGG - Intronic
907492027 1:54814523-54814545 CCCTTTCCAGATCTGGGCTTCGG - Intronic
917062294 1:171054450-171054472 ACCTTTCTAGGCATTGGCTTAGG + Intronic
919881783 1:201905813-201905835 CACTTTCCAGGCACTCGCCTAGG + Intronic
922544509 1:226445874-226445896 CCCTTACCTGGCATGGCCTTAGG - Intergenic
1065696504 10:28385532-28385554 CCCTTGCCTTGCATGCGCTTAGG + Intergenic
1066995776 10:42561644-42561666 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1067066764 10:43108368-43108390 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1067804973 10:49386088-49386110 CCCTCTCCATGCATGCGACTGGG - Intronic
1070144522 10:73764129-73764151 CCCTCTCCAGGCATGGGCCCTGG - Intronic
1073148879 10:101298348-101298370 CCCTTTCCACGGATGTGCCTTGG + Intergenic
1076480468 10:130781901-130781923 ACATTGCCAGGCATGCGCATAGG + Intergenic
1079172034 11:18105778-18105800 CCCTCCCCAGGCGTGCGCTGCGG - Intronic
1079183985 11:18220414-18220436 CCCTTGGCAGGCATGACCTTGGG - Intronic
1080500943 11:32870457-32870479 CCCTTTTCAGGAATGAGTTTGGG - Intergenic
1080863461 11:36171367-36171389 ACCCTTCCAGACATGGGCTTAGG - Intronic
1087429552 11:98035260-98035282 ACCTTTCCAGACATTGGCTTAGG + Intergenic
1087743175 11:101912924-101912946 CCCTTGCCTGGCATGGCCTTAGG - Intronic
1091825719 12:3511244-3511266 CCCCTTCCAGACATGCCCATGGG + Intronic
1093241736 12:16685015-16685037 CCCTTTCCAGGGATTCATTTTGG + Intergenic
1093313445 12:17619563-17619585 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1099496409 12:83352389-83352411 TCCTTTCCAGCCATGCACTCTGG + Intergenic
1101247444 12:102897892-102897914 CCCTTTCCAAGAATGGGCTGTGG + Intronic
1102840451 12:116114328-116114350 AGCTCTCCAGGCATGCGCTGTGG + Intronic
1103257500 12:119554660-119554682 CCCTTTCCTGGCATGGCCTTAGG - Intergenic
1103446088 12:120996252-120996274 CCCTCTCCAGGTGTGCGCTATGG + Exonic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1106925027 13:34605061-34605083 CCCTTGCCAGTCATGCGAGTGGG - Intergenic
1108563637 13:51672121-51672143 ACCTTTCTAGGCATTGGCTTAGG - Intronic
1108686459 13:52823645-52823667 CCCTTTCCAGAGATGGGTTTAGG - Intergenic
1111208154 13:85039743-85039765 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1112624632 13:101090035-101090057 CCCTTTCCAGTCATGAGTGTGGG + Intronic
1116786445 14:49293907-49293929 CCCTTCCCAGGCAGGCCCTTAGG + Intergenic
1119569542 14:75658277-75658299 CCCTTGCCTGGCATGGCCTTAGG - Intronic
1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG + Intronic
1120022694 14:79548592-79548614 CCCTTTCCTTCCATGAGCTTAGG + Intronic
1121176340 14:91893381-91893403 TCCTTTCCAGGCTTGCACATGGG - Intronic
1121428305 14:93869165-93869187 CCCTCACCTGGCATGGGCTTAGG - Intergenic
1123103796 14:105826384-105826406 ACCCTTCCAGGCATTGGCTTAGG - Intergenic
1127653978 15:61038215-61038237 GCCTTCCCAGACTTGCGCTTTGG - Intronic
1128061620 15:64739047-64739069 CCCTTTCCAGGCACGGCTTTGGG + Intergenic
1128203974 15:65834122-65834144 CCAGTTCCAGGCATGCATTTAGG + Intronic
1128710785 15:69869910-69869932 CCCTTTCCAGAAAGGCGCTAGGG + Intergenic
1133521389 16:6561189-6561211 ACCTTTCCAGTCATTTGCTTGGG - Intronic
1136398322 16:30004935-30004957 CCCTCTCCAGGGAGGCGCCTGGG - Intronic
1137728930 16:50675963-50675985 CACTTCCGAGGCATGGGCTTGGG + Intronic
1138587603 16:57981053-57981075 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1140454487 16:75097021-75097043 CACCTTCCAGGAAGGCGCTTAGG - Intronic
1143996381 17:11009973-11009995 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1145286476 17:21509895-21509917 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1145391138 17:22456423-22456445 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1145392233 17:22464522-22464544 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1146011321 17:29197040-29197062 CCCTTGCCAGGCACGCTCTGTGG - Intergenic
1146495452 17:33318208-33318230 CCATTTCCAGACATGCTCTTTGG + Intronic
1147925133 17:43941346-43941368 CCCCTTCCAGGCCTGCTCTTGGG - Intronic
1152509191 17:80773714-80773736 CCTCCTCCAGGCAGGCGCTTGGG + Intronic
1152757377 17:82092629-82092651 ACCTCTCCAGGCATGGGCGTAGG + Intronic
1152980267 18:269471-269493 CCCTTGCTTGGCATGGGCTTAGG - Intergenic
1154199225 18:12287782-12287804 CCCCTCCCAGGAATGAGCTTTGG + Intergenic
1154975548 18:21454016-21454038 CCCTTTCCAGGGATGAGTCTTGG + Intronic
1155109376 18:22698911-22698933 ACATTTCCAGGCATGGGCTCAGG - Intergenic
1162043742 19:7985520-7985542 CCATCTCCAGGCAGGGGCTTTGG - Intronic
1166741723 19:45118518-45118540 CCCTTCCCAGGGATGTGCTAAGG + Intronic
1168252904 19:55150671-55150693 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
925505870 2:4563217-4563239 ACCTTTCTAGGCATTGGCTTAGG + Intergenic
926418003 2:12669726-12669748 CCTTTTCTAGGCATGGGGTTGGG + Intergenic
929325403 2:40604715-40604737 CACTTTTAAGGCATGTGCTTTGG - Intronic
930026850 2:47034298-47034320 CCCTATCCAGGCCTGGGTTTCGG + Intronic
930469935 2:51799762-51799784 ACCTTTCCAGACATTGGCTTAGG + Intergenic
932341279 2:70964000-70964022 CCCTTTCCAGTTATTTGCTTCGG + Intronic
933035731 2:77395063-77395085 CCCTTGCCTGGCATGGCCTTTGG + Intronic
933537720 2:83597386-83597408 CACTTTCCAGCCATGCTCCTTGG + Intergenic
938721970 2:134075429-134075451 CCCTTGGCAGGCATGAGATTTGG - Intergenic
939802032 2:146721702-146721724 CCCTTGGCAGGCATGAGATTCGG + Intergenic
939956816 2:148534266-148534288 CCCTTTTCATGCATGTGGTTGGG - Intergenic
942044422 2:172091001-172091023 CCCCTTCCAGGCCTGAGATTGGG + Intergenic
944417694 2:199495372-199495394 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
945964296 2:216169633-216169655 CCCTTGCCTGGCATGGCCTTAGG + Intronic
947392227 2:229651119-229651141 TCCTTTCCTGGGATGCCCTTGGG - Intronic
1170102274 20:12715272-12715294 TCATTTCCTGGCATGGGCTTTGG - Intergenic
1173443365 20:43096711-43096733 CCCTCTCCAGCCAGGCCCTTGGG - Intronic
1177024404 21:15904579-15904601 ACAGTTCCAGGCTTGCGCTTGGG - Intergenic
1177276458 21:18918633-18918655 CCCTTGCCTGGCATGGTCTTAGG - Intergenic
1178485229 21:33015113-33015135 CCCTTTCCATGCATGCCTTTAGG - Intergenic
1179595483 21:42440231-42440253 GCCTTTCCAGCTCTGCGCTTTGG + Intronic
1179957186 21:44748061-44748083 CCCTTGTCTGGCATGAGCTTAGG + Intergenic
1181235010 22:21443455-21443477 CCCTTTCCAGGCCTCTGCTCTGG + Intronic
1182843844 22:33414647-33414669 CCGTTTCCAGGCATGTGCTCTGG + Intronic
1184596371 22:45516617-45516639 CCCTCTCCAGCGATGCTCTTCGG - Intronic
1184691348 22:46118703-46118725 CCATATCCAGGCAGGCGCTGTGG + Intergenic
949112427 3:278254-278276 ACCTTTCCAGACATTCTCTTTGG + Intronic
949821910 3:8124955-8124977 CCCTTACCTGGCATGACCTTAGG + Intergenic
953742148 3:45547264-45547286 CCCTTTACAGGCAGGAGGTTTGG + Intronic
954105321 3:48406728-48406750 CCCTTTGCAGGGAAGCCCTTGGG - Intronic
954413760 3:50382925-50382947 CCCTTTCCAGGCGGGCGCAGGGG - Intronic
954669108 3:52278665-52278687 CCCTTTCCCGGCGTGCGCCGCGG - Intronic
958952954 3:100436179-100436201 CCCTTGCCTGGCATGGCCTTAGG + Intronic
959071833 3:101709104-101709126 CCCTTACCTGGCATGGCCTTGGG - Intergenic
959269672 3:104191977-104191999 CCCTCACCAGGCATGCGATGGGG + Intergenic
959804160 3:110530921-110530943 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
960337530 3:116436267-116436289 ACCTTTCCAGACATTGGCTTAGG + Intronic
961150919 3:124637107-124637129 CCCTTCCCTGGCTTGAGCTTTGG + Intronic
961744421 3:129054985-129055007 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
962446609 3:135471471-135471493 CCTTTTCCAGGCTTGCTTTTAGG - Intergenic
964731578 3:159872389-159872411 CCCTTTCCATGCCTGCCCTTTGG + Intronic
966135278 3:176691077-176691099 CCCTTCCCTGGCATGCCCATTGG - Intergenic
966182056 3:177197108-177197130 CCGTTTCCAGGTAAGCGCTGGGG - Intronic
967872864 3:194246521-194246543 TCCTTTCCAGGAATAGGCTTAGG + Intergenic
968640901 4:1713984-1714006 CCCTTGCCTGGCATGACCTTAGG - Intergenic
968763152 4:2452642-2452664 CCCTTTGCAGGCCTGCGGTCAGG + Intronic
971267654 4:25109214-25109236 CTCTTGCCAGGCGTGCTCTTGGG + Intergenic
972745985 4:41933392-41933414 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
974615029 4:64269570-64269592 CCCTTGCCATGCATGGCCTTAGG + Intergenic
975602783 4:76120394-76120416 CCCTTTACACTCATGCGGTTGGG - Intronic
976345472 4:83994538-83994560 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
976346100 4:84003353-84003375 TCTTTTCCAGGCATGGTCTTAGG - Intergenic
980423488 4:132594300-132594322 CCCTTGCCTGGCATGGACTTAGG + Intergenic
983691918 4:170481323-170481345 CCCTTTCCTTGCATGGCCTTAGG + Intergenic
984606053 4:181787275-181787297 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
986207239 5:5636392-5636414 CCCTTGCCTGGCATGGCCTTGGG + Intergenic
986316752 5:6594255-6594277 CCCTTGCCTGGCATGGCCTTGGG - Intergenic
987096843 5:14557810-14557832 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
996639622 5:125736530-125736552 CCCTTTCTAGACATTGGCTTAGG + Intergenic
998299362 5:141003115-141003137 CCCTTTCCTGGCATTTGCCTTGG + Intronic
998879633 5:146633015-146633037 CCCTTTCCACGCATGAGTATCGG - Intronic
1001291153 5:170462032-170462054 CCCCTTCTAGACATTCGCTTAGG + Intronic
1001875814 5:175199474-175199496 CACTTTCCAGGCATCAGCTCTGG + Intergenic
1002314496 5:178334319-178334341 CTCGATCCAGGCATGTGCTTTGG - Intronic
1003370596 6:5522241-5522263 CCCCTTCCAGGTCTGGGCTTGGG - Intronic
1003380122 6:5617362-5617384 CCCTTGGCAGCCATGCCCTTTGG - Intronic
1006420889 6:33933275-33933297 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1006903363 6:37516950-37516972 CCCGGTCCAGGCATGCCCTGTGG + Intergenic
1008546779 6:52590220-52590242 GCCTTTCCTGGCATGCCCTGGGG + Intergenic
1010388737 6:75312358-75312380 CCCTCTGCAGGCCTGCGCTTTGG + Intronic
1012437131 6:99226525-99226547 CTCTTTCCAGCCATGCCCTGGGG - Intergenic
1016025057 6:139278474-139278496 CCCCTGCCAGGCATGTGCTTTGG + Intronic
1016109648 6:140206429-140206451 CCCTCGCCAGGCATGCGATGCGG - Intergenic
1016163165 6:140907338-140907360 CCCTTGGCAGGCATGGGATTTGG - Intergenic
1018870981 6:167781965-167781987 TCCCTTCCAGGCATGCGAATGGG + Intergenic
1018956248 6:168412457-168412479 CCCTTTCCAGGCAGAGGATTCGG - Intergenic
1019019580 6:168906865-168906887 CCCTTTCCTGGCATTGCCTTAGG + Intergenic
1023067598 7:36393936-36393958 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1023206852 7:37759979-37760001 CACTTTCCAACCATGTGCTTGGG + Intronic
1023701692 7:42898169-42898191 CCCTTTCTAGACATTGGCTTAGG + Intergenic
1024148645 7:46543859-46543881 CCCTTGCCTGGCATGGTCTTAGG - Intergenic
1024675397 7:51633635-51633657 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1025164581 7:56701642-56701664 CCCTTGCCAGGCATGGTGTTGGG - Intergenic
1025705693 7:63860434-63860456 CCCTTGCCAGGCATGGTGTTAGG + Intergenic
1029364125 7:100106505-100106527 CCTTTTCCAGGTATTCGCTGTGG + Exonic
1031881923 7:127207848-127207870 CCCTTGCCTGGCATGGCCTTAGG - Intronic
1032358258 7:131230123-131230145 CCCTTGCCTGGCATGGCCTTGGG + Intronic
1032484186 7:132271173-132271195 TCCTTTCCAGGTGGGCGCTTAGG - Intronic
1035131750 7:156661085-156661107 CCCTTGCCGGGCATGGCCTTAGG + Intronic
1038028662 8:23616802-23616824 CCCTTTTGAGGCTTGCTCTTGGG + Intergenic
1039413710 8:37376260-37376282 CACTTTTGAGGCATGAGCTTAGG - Intergenic
1039636064 8:39167111-39167133 CCCCTTCCAGACATTGGCTTAGG - Intronic
1039759487 8:40558958-40558980 CCCTTTTCTGGCATGGCCTTAGG - Intronic
1040928975 8:52714446-52714468 CCGTTTCCCGGCATGCGCCGCGG - Intronic
1041293281 8:56328578-56328600 CCCTTTCTAGACATTGGCTTAGG - Intergenic
1041324544 8:56650989-56651011 ATCTTTCCAGGCTTGCACTTTGG + Intergenic
1042285552 8:67105954-67105976 CCTTTTGCAGGGATGCTCTTTGG + Exonic
1042558736 8:70056421-70056443 CTCTTTCCAGGCATGCTTATGGG + Intronic
1047518167 8:125573452-125573474 CTCTTTCCATGCTTGCCCTTGGG + Intergenic
1047826240 8:128579383-128579405 CCCTTCCCAGGCAAGGGCTATGG - Intergenic
1049667552 8:143853154-143853176 CCCTGTCCCGGCCTGCTCTTTGG + Intergenic
1051022059 9:12556524-12556546 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1051741015 9:20252222-20252244 GCCTTTCCAGACATACCCTTTGG - Intergenic
1054781964 9:69174099-69174121 CCCTTCCCCGGCAGGCGCGTGGG + Intronic
1057097810 9:92327868-92327890 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1059006569 9:110408632-110408654 CACTTGGCAGGCATGCACTTTGG + Exonic
1059278063 9:113111706-113111728 CCCTTTCCTGGGATACGCCTTGG + Intergenic
1061210528 9:129189769-129189791 CCCTTTCCAGGCTTGGTCTCAGG - Intergenic
1188437091 X:30173383-30173405 CCCTTCCCAGGCATGTAGTTTGG + Intergenic
1188861581 X:35263302-35263324 CACTTTCCAGGAATGCACCTTGG + Intergenic
1190410252 X:50130065-50130087 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1190875716 X:54458862-54458884 CCCTCTCCAGGCAGATGCTTTGG + Intronic
1191152556 X:57235356-57235378 CCCTTTCCTGGCATGCCTTTAGG + Intergenic
1193353392 X:80488232-80488254 CCCTTGCCTGGCATGGTCTTAGG - Intergenic
1193970513 X:88045610-88045632 ACTTTTCCAGGCATTGGCTTAGG + Intergenic
1195231527 X:102854288-102854310 ACCATTCCAGGCATTGGCTTGGG - Intergenic
1195240576 X:102947769-102947791 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1196911848 X:120491861-120491883 CCCTTGCCTGGCATGGCCTTAGG - Intergenic