ID: 1119780831

View in Genome Browser
Species Human (GRCh38)
Location 14:77275897-77275919
Sequence CTACCTACTGGGTGGTGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119780831_1119780838 -7 Left 1119780831 14:77275897-77275919 CCTCCCCACCACCCAGTAGGTAG 0: 1
1: 0
2: 4
3: 23
4: 253
Right 1119780838 14:77275913-77275935 TAGGTAGCACAGCCTGTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 128
1119780831_1119780843 15 Left 1119780831 14:77275897-77275919 CCTCCCCACCACCCAGTAGGTAG 0: 1
1: 0
2: 4
3: 23
4: 253
Right 1119780843 14:77275935-77275957 GGACCAATATCCAGTCTCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 64
1119780831_1119780839 -6 Left 1119780831 14:77275897-77275919 CCTCCCCACCACCCAGTAGGTAG 0: 1
1: 0
2: 4
3: 23
4: 253
Right 1119780839 14:77275914-77275936 AGGTAGCACAGCCTGTCCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119780831 Original CRISPR CTACCTACTGGGTGGTGGGG AGG (reversed) Exonic
901083301 1:6595832-6595854 CTTGGTACTGGGTGATGGGGAGG - Intronic
901527058 1:9830223-9830245 CTCCCCACTGGGTGGTTGTGAGG + Intergenic
903212097 1:21824182-21824204 GTACCAGCTGGGTAGTGGGGAGG - Exonic
904595540 1:31642528-31642550 CTATGTAGTGGGTGGAGGGGAGG + Intronic
904940040 1:34159329-34159351 CAAGCTCCTGGGTGGGGGGGGGG - Intronic
905206194 1:36344090-36344112 CTGCCTCCCGGGGGGTGGGGGGG - Intronic
905826312 1:41028313-41028335 CGATCTCCTGGGGGGTGGGGAGG + Exonic
906850066 1:49238590-49238612 CCACCTATTGGGGAGTGGGGTGG + Intronic
906943216 1:50273880-50273902 ATACCCACTGGGTGTAGGGGTGG - Intergenic
907934325 1:59028623-59028645 CTACCTCCTGGATGGTTGGATGG + Intergenic
911175466 1:94813086-94813108 CTCTCTGCTGGGGGGTGGGGGGG + Intergenic
911889379 1:103347667-103347689 CTCCCTATGGGGTGGTGGTGGGG + Intergenic
914870663 1:151471134-151471156 CTAGCTACTGGGTACTCGGGAGG - Intergenic
914902697 1:151719865-151719887 TTTCCTACTTGGAGGTGGGGAGG + Intronic
915129570 1:153687388-153687410 CTCCCTACTGGGTGGTGCTGGGG - Intronic
915514349 1:156404086-156404108 CTACCTGGTAGGGGGTGGGGCGG - Intergenic
915541604 1:156570622-156570644 CCAGCTATTTGGTGGTGGGGGGG - Intronic
915592598 1:156879140-156879162 CAAGCTGCTGGCTGGTGGGGAGG + Exonic
915973200 1:160368098-160368120 CTATCTTCTGTGTGGTGGGGTGG + Intronic
915974345 1:160375186-160375208 CCAACTCGTGGGTGGTGGGGTGG + Intergenic
915974701 1:160377542-160377564 CTCCCAAGTAGGTGGTGGGGAGG - Intergenic
918943121 1:191026994-191027016 CTACCTAGTTCCTGGTGGGGAGG + Intergenic
919924038 1:202183109-202183131 CTACCTGGTGGGAGGTGGAGAGG - Intergenic
922984806 1:229857949-229857971 CTGGCTCCTGGGTGGTGGGAAGG + Intergenic
1063403770 10:5773158-5773180 CAACCTCCTGGGTGGTGGGGTGG - Intronic
1064174422 10:13061966-13061988 GTCCTTTCTGGGTGGTGGGGGGG - Intronic
1065869943 10:29947650-29947672 CTGCCTGCTGGGTGGAGGTGGGG + Intergenic
1068023012 10:51607657-51607679 CTACCTCCTGGGCAGCGGGGAGG - Intronic
1068500791 10:57838415-57838437 CTACCTATTGGATGGTCTGGGGG - Intergenic
1068910447 10:62374133-62374155 CTCCCGGCTGGGTGGCGGGGGGG + Intergenic
1070787516 10:79170595-79170617 GTACCTACTGGGAGGTAGGGCGG + Intronic
1072174323 10:92901883-92901905 CTAGCTACTGGGGGGTTGGTGGG + Intronic
1074186410 10:111102706-111102728 ATTCATACTGGGTGGTGGAGAGG - Intergenic
1075214922 10:120523955-120523977 CTTCCTGCTGGTTGGAGGGGAGG - Intronic
1075906850 10:126089051-126089073 CTGCCAACTGGGAGTTGGGGCGG - Intronic
1076477990 10:130766010-130766032 CTAGTTTCTGGGTGGGGGGGGGG + Intergenic
1076812832 10:132898207-132898229 CTCCCTGCTGGGAGATGGGGAGG - Intronic
1080244478 11:30164041-30164063 CCACAGACTGGGTAGTGGGGTGG + Intergenic
1081401867 11:42653152-42653174 CTAGCTACCTGGTGGTGGGGTGG - Intergenic
1081878749 11:46429426-46429448 CCACTTATTGGGAGGTGGGGGGG + Intronic
1083540126 11:63506590-63506612 CACACTCCTGGGTGGTGGGGTGG + Intronic
1084174443 11:67416020-67416042 CTACCTTCGGGGTGGGGGTGGGG + Intronic
1085460716 11:76691650-76691672 AGACCTACTGGGTGGGGGGAAGG - Intergenic
1087242486 11:95795029-95795051 ATACCCACTTGGAGGTGGGGGGG + Intronic
1089459562 11:118644673-118644695 CTACCTGCTGGGTCGTCGGTTGG - Intronic
1090244496 11:125206175-125206197 CTGTCTAGTGGGCGGTGGGGGGG + Intronic
1091973633 12:4808983-4809005 CTCCGTATTGTGTGGTGGGGCGG + Intronic
1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG + Intronic
1094735095 12:33225032-33225054 TAACAGACTGGGTGGTGGGGAGG - Intergenic
1095690598 12:45084262-45084284 GCACCTACTGGGGGGTGGGGTGG - Intergenic
1096870914 12:54591554-54591576 CTCCCTCCTGGGTGGTTGTGAGG - Intergenic
1097030683 12:56087366-56087388 CTGCCCAGTGGGTGGTGTGGAGG + Intronic
1097522742 12:60689193-60689215 CTTCCTCCTGGGTGGTGTTGAGG + Intergenic
1101375117 12:104164899-104164921 CTCCCTAGAGGTTGGTGGGGTGG - Intergenic
1101835048 12:108289175-108289197 CTGCCTCCTGGGTGGGGTGGGGG - Exonic
1104726058 12:131076470-131076492 CTACCTGGTGGGGAGTGGGGAGG + Intronic
1105635409 13:22211118-22211140 GAAACTCCTGGGTGGTGGGGTGG + Intergenic
1109451988 13:62528014-62528036 CTATCTATTGGGTGGGTGGGTGG - Intergenic
1112059800 13:95727029-95727051 CTGAAGACTGGGTGGTGGGGAGG + Intronic
1115654734 14:35432375-35432397 CTACTTGGTGGGGGGTGGGGGGG + Intergenic
1116614640 14:47119178-47119200 CCAGCTACGGGGTGGGGGGGGGG - Intronic
1117960124 14:61154199-61154221 CTCCCTGCTGGGTGGTGGGTTGG + Intergenic
1118777280 14:68980569-68980591 CTATGTGCTGGGTGCTGGGGTGG - Intergenic
1119676195 14:76556762-76556784 TAAATTACTGGGTGGTGGGGTGG + Intergenic
1119780831 14:77275897-77275919 CTACCTACTGGGTGGTGGGGAGG - Exonic
1120821083 14:88912553-88912575 CCACATACTGGGTGGGGGGAGGG - Intergenic
1122469113 14:101954223-101954245 CCAACTACTGGGTGGTGATGGGG - Intergenic
1122469197 14:101954739-101954761 CCAGCTACTGGGTGGTGATGGGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124206235 15:27723522-27723544 CTGCCTTCTTGGTGGTGGTGGGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124526078 15:30454294-30454316 GGACCTACTGGGGGGTTGGGGGG + Intergenic
1124772576 15:32553391-32553413 GGACCTACTGGGGGGTTGGGGGG - Intergenic
1125342105 15:38685410-38685432 CTTCCTACTGGGTGTGGGGCAGG - Intergenic
1128502023 15:68233293-68233315 ACACCTACGGGGGGGTGGGGGGG + Intronic
1130235538 15:82130076-82130098 CTACCCTCTTGGTGGTGGGGAGG - Intergenic
1131039020 15:89244830-89244852 CTACCTAGTAGGTGGTGTTGTGG + Intronic
1132335126 15:101043284-101043306 ATACCTAGTGGGAGGTGGGTGGG - Intronic
1132515605 16:364364-364386 CTGCCTTCTGGGTTGTGGGGAGG - Intergenic
1132662265 16:1066722-1066744 CATCCTCCTGGGTGGTGGTGTGG + Intergenic
1133425717 16:5687354-5687376 CTACCCACTAATTGGTGGGGAGG - Intergenic
1133900324 16:9968046-9968068 CTACCCACTGGGTTGTCTGGAGG - Intronic
1134380078 16:13716000-13716022 CTATCTTCTGGGTGGTTGTGAGG - Intergenic
1134390603 16:13816605-13816627 GTACATACTGGGTGGTGGGGTGG - Intergenic
1136247684 16:28984967-28984989 CTCCCCACTGGCGGGTGGGGTGG + Intronic
1136367071 16:29813789-29813811 CTGCCAACTGGGAGCTGGGGTGG - Exonic
1136710712 16:32234461-32234483 CTAATTTCTGGGTGCTGGGGTGG - Intergenic
1136757199 16:32694950-32694972 CTAATTTCTGGGTGCTGGGGTGG + Intergenic
1136810910 16:33175425-33175447 CTAATTTCTGGGTGCTGGGGTGG - Intergenic
1136817386 16:33285505-33285527 CTAATTTCTGGGTGCTGGGGTGG - Intronic
1136823950 16:33342034-33342056 CTAATTTCTGGGTGCTGGGGTGG - Intergenic
1138032217 16:53568675-53568697 CTTCCTTCTGGGTGTAGGGGAGG + Intergenic
1138421480 16:56902123-56902145 ATACCTGCTGGATGGTCGGGTGG + Intronic
1139166893 16:64576832-64576854 CTACCTCATGGGTGGAGTGGGGG + Intergenic
1139581845 16:67878457-67878479 CAGCCTAGTGGGTGGTGGGCTGG + Intronic
1140790499 16:78386629-78386651 CTACAGGCTGGGGGGTGGGGCGG - Intronic
1141166764 16:81666071-81666093 CTCCCCACTGGGGGATGGGGCGG + Intronic
1142014582 16:87738090-87738112 CTGCCCTCTGGGTGGTGGGTTGG - Intronic
1142329550 16:89442692-89442714 ATTCCTGGTGGGTGGTGGGGAGG - Intronic
1203059348 16_KI270728v1_random:955301-955323 CTAATTTCTGGGTGCTGGGGTGG + Intergenic
1143561781 17:7700856-7700878 CTTGAAACTGGGTGGTGGGGCGG - Intronic
1143625598 17:8108856-8108878 CTTCCTCCTGGGTGGGGAGGGGG - Intronic
1144292247 17:13837783-13837805 CTCCTTACTGTGGGGTGGGGTGG - Intergenic
1144711277 17:17403325-17403347 CTCCCTGATGGGTTGTGGGGAGG + Intergenic
1145231835 17:21178612-21178634 CTACTTACTGGGTGGGAGTGGGG + Intronic
1146884765 17:36463757-36463779 CTACCTATGGGGTGGTGGGGGGG - Intergenic
1147988923 17:44321692-44321714 CTACTCACAGGGTGGCGGGGAGG + Exonic
1148081560 17:44969806-44969828 CTCCCTCCTTGGTGGTGGTGGGG - Intergenic
1149333788 17:55613183-55613205 CTATCCACTGAGTGGTGGGTTGG - Intergenic
1149497787 17:57131211-57131233 CTAACTACTGGGTGCGGGGTGGG - Intergenic
1150708508 17:67509744-67509766 CCACATACTTGGGGGTGGGGAGG + Intronic
1151494841 17:74453215-74453237 CTGTCTACTGGGTGGACGGGAGG + Intergenic
1151741033 17:75982164-75982186 CTTCCTTCTGGGTGTGGGGGAGG - Intronic
1151882931 17:76905682-76905704 ATATCTACTGGGTGGAGGGAGGG - Intronic
1152079342 17:78176813-78176835 CTATCTAATGGGTGGGGGCGAGG - Intronic
1152284236 17:79403200-79403222 GGACATACAGGGTGGTGGGGAGG - Intronic
1152296385 17:79469579-79469601 GCACCTAAAGGGTGGTGGGGTGG - Intronic
1152537303 17:80958203-80958225 CCAGCTACTTGGTGGTGGGGGGG - Intronic
1155475630 18:26233925-26233947 CTACTTGCTGGATGGTGTGGAGG + Intronic
1156497286 18:37534272-37534294 CTGCATACTGGGTGCTGGGGAGG + Intronic
1157521441 18:48348157-48348179 CCACCTGCAGGGTGGAGGGGTGG + Intronic
1158088911 18:53687180-53687202 CCACCTGCTGGGTGGTGGCTTGG - Intergenic
1161164714 19:2780196-2780218 CTTCCTACTGGGGTGTGAGGAGG - Intronic
1161505935 19:4643505-4643527 CTGCCTGCTGGGTTGTGGCGGGG - Intronic
1161817640 19:6509642-6509664 CTACCGTCTGGGTGGGGAGGTGG - Intergenic
1162727911 19:12701030-12701052 CTACAAACGGGGAGGTGGGGGGG - Exonic
1164144220 19:22500616-22500638 CTTCCTGCTGGCTGGTGGGTGGG - Intronic
1164966837 19:32491988-32492010 ATACCTATTGGTTTGTGGGGTGG + Intergenic
1165132458 19:33641403-33641425 CTGCCCAGGGGGTGGTGGGGCGG - Intronic
1166995564 19:46718103-46718125 GGACCTACTGGGTGCTGGGTGGG + Intergenic
1167211324 19:48135895-48135917 CTCTCTCCTGGGTGGGGGGGAGG - Intronic
1168380844 19:55922064-55922086 TTACCTAGTGGGAGGTGAGGGGG + Intronic
1168541450 19:57214464-57214486 CCAGCTACTGGGGGGTGGTGAGG - Exonic
928445136 2:31327434-31327456 CTACCACCTGGATGGTGGGGAGG - Intergenic
931039083 2:58276536-58276558 CTAGCTGCTTGGGGGTGGGGGGG - Intergenic
931081236 2:58773462-58773484 CTACCTCCTAGGTGGTTGTGAGG + Intergenic
932608001 2:73177156-73177178 CTTCCTCCTGGGAGGAGGGGCGG + Intergenic
932755621 2:74407225-74407247 CAACCTACCGGGTGCTGTGGTGG - Intergenic
933066815 2:77808149-77808171 GTACCCACTGGGTGGTGTGGGGG + Intergenic
933773110 2:85756035-85756057 CTTCCTGCTGGGGGTTGGGGTGG + Intronic
934025955 2:88001749-88001771 CTATCTATGGGGTGGAGGGGTGG + Intergenic
934869349 2:97847062-97847084 CCAGCTACTGGGGGGGGGGGGGG + Intronic
935535371 2:104287063-104287085 CTCCCTGCTGGGTTGTGGGTTGG - Intergenic
935553785 2:104485134-104485156 CAGCCTAATGGGTGGTGGGCAGG - Intergenic
937222133 2:120347711-120347733 CTGCCTGCTGCCTGGTGGGGTGG - Intronic
938812103 2:134863041-134863063 CGACCTCCTGGGAGGTAGGGGGG + Intronic
939085635 2:137715775-137715797 CTGCCTACAGGGAGGTGTGGAGG + Intergenic
939186978 2:138872339-138872361 CTCCCGTCTGGGAGGTGGGGGGG - Intergenic
939984235 2:148814310-148814332 CCAGCTACTGGGTGGGGTGGAGG + Intergenic
941066845 2:160913255-160913277 CTACTTATTGGGTGGGAGGGAGG - Intergenic
941488278 2:166109856-166109878 CTACTATGTGGGTGGTGGGGAGG + Intronic
941831616 2:169967267-169967289 CTACCAACTGTGTGTGGGGGGGG - Intronic
944311830 2:198242192-198242214 CTACCTAATGGGTGCTGTGAAGG + Intronic
946113405 2:217439854-217439876 TAAACTCCTGGGTGGTGGGGTGG - Intronic
946132853 2:217621232-217621254 CTACCTGCTGTGTGTTGGGCAGG - Intronic
946236329 2:218326728-218326750 TTTCCTGCTGGGTGGTGGGTAGG - Intronic
947095298 2:226560487-226560509 TTATCTACTGGGTAGTGGTGAGG - Intergenic
948493120 2:238326716-238326738 ATACCTAGTGGGTGGTTGGCTGG + Intronic
948745758 2:240092358-240092380 GGGCCTGCTGGGTGGTGGGGTGG - Intergenic
948946441 2:241222916-241222938 CTGCCACCTGGGGGGTGGGGAGG + Intronic
1169611604 20:7386858-7386880 CTCCCTAATGTGGGGTGGGGCGG - Intergenic
1170368225 20:15619878-15619900 CAACCAACTGAGAGGTGGGGAGG + Intronic
1170948068 20:20909856-20909878 CTGCGTACTGGGAGGAGGGGTGG - Intergenic
1171149404 20:22813965-22813987 GTGCCTATTGGTTGGTGGGGAGG - Intergenic
1172310376 20:33913441-33913463 CTACCTATTGGAATGTGGGGGGG - Intergenic
1172806068 20:37612731-37612753 CTACCTTCTGGGTTGTTGTGAGG + Intergenic
1174617172 20:51844380-51844402 CCAGCTACTGGGTGGGTGGGGGG + Intergenic
1174862525 20:54104403-54104425 CCAGCCACTGGGCGGTGGGGGGG + Intergenic
1175694954 20:61095475-61095497 CCATGAACTGGGTGGTGGGGAGG + Intergenic
1175718538 20:61271693-61271715 CAACCTCCAGGTTGGTGGGGTGG - Intronic
1175851227 20:62094317-62094339 CTACCTCTTGGGTGGTGTGTTGG + Intergenic
1176172436 20:63702006-63702028 CTGCCTAGTGGGTGACGGGGGGG - Intronic
1176238325 20:64064433-64064455 CTGCCTCCTGGGGGGTGGGGAGG + Intronic
1179557991 21:42192958-42192980 CTGTCTAATGGGGGGTGGGGTGG - Intergenic
1179828785 21:43983176-43983198 CTCCACACTGGGTGCTGGGGAGG + Exonic
1181494350 22:23279582-23279604 CCAGCTGCTGGCTGGTGGGGGGG - Intronic
1182243592 22:28936588-28936610 GTAGCTACTTGGTGGTGGGTGGG + Intronic
1182609036 22:31531233-31531255 CTACCTACTGGAGGCTGGGGAGG - Intronic
1182951793 22:34382920-34382942 ATACCTTCTGGTTTGTGGGGAGG + Intergenic
1183363409 22:37394599-37394621 CTGCCTACTGTGTGCCGGGGCGG - Intronic
1183375613 22:37463151-37463173 CGACCTCCTGGGTGGGGGGCAGG + Intergenic
1183720420 22:39558709-39558731 TTGCCTACTGGGTGGTGTTGTGG + Intergenic
1184004137 22:41696579-41696601 CTTCCTGCTGGTGGGTGGGGAGG + Exonic
1184875931 22:47275585-47275607 CTACCGCCTGAGTGGTGTGGGGG + Intergenic
950669432 3:14517259-14517281 GCACCCACTGTGTGGTGGGGTGG - Intronic
950797557 3:15522612-15522634 CTAGTTACTGGATGCTGGGGTGG + Intergenic
955081788 3:55664540-55664562 TTGCTTGCTGGGTGGTGGGGAGG + Intronic
956648165 3:71477208-71477230 CTACTTGCTAGGTGGTTGGGAGG - Intronic
957314081 3:78555188-78555210 CAACTTCCTGGGTGGTGGGGAGG + Intergenic
958954700 3:100455063-100455085 GGACCTACTGGAGGGTGGGGGGG - Intronic
960246442 3:115405213-115405235 ATACATACTGGGTGGGGGAGGGG + Intergenic
961000967 3:123373766-123373788 CTACCTGCGGGGGGGTCGGGGGG - Intronic
961553416 3:127681588-127681610 CTACCTTCTGGGTGTGGGGCAGG + Intergenic
967839952 3:193997263-193997285 CTGCTTACTGGATTGTGGGGAGG + Intergenic
967933326 3:194706565-194706587 CTTCCTGCTGTGTGGTGTGGAGG + Intergenic
970535330 4:17024447-17024469 CTACCTACTGGGTACTGTGCTGG - Intergenic
971299118 4:25427681-25427703 CTTCCTTATGGGTGGTGGGGTGG - Intergenic
972436617 4:39041448-39041470 CTGCCTACTGGGTGTGTGGGTGG - Intergenic
973212653 4:47634180-47634202 CTTCCTTCTGTGTTGTGGGGAGG + Intronic
977348786 4:95853190-95853212 CTTCCTTCTGGGTGATGGGCTGG + Intergenic
978942662 4:114456096-114456118 TGACCTATTGGGGGGTGGGGTGG - Intergenic
979837272 4:125386906-125386928 CCACATACTGGGTGGGAGGGTGG + Intronic
980580781 4:134747357-134747379 CTCTCTACTGGGTGGTGAGTGGG + Intergenic
982186240 4:152803520-152803542 CTAAATGGTGGGTGGTGGGGAGG + Intronic
982350356 4:154408759-154408781 ATCCCAACTGGGTGATGGGGTGG - Intronic
982547384 4:156751251-156751273 GTAACTACAGGGTGGTGAGGTGG + Intergenic
984078855 4:175216841-175216863 CTCTCTACTCGGTGGGGGGGGGG - Intergenic
986063060 5:4209726-4209748 CTGCCTACTGAGTGGTGTTGGGG + Intergenic
986216416 5:5723644-5723666 CTACCAACTGGGGGTTGGAGGGG + Intergenic
988432752 5:31138680-31138702 CTAGCTAATGAGGGGTGGGGTGG - Intergenic
989261398 5:39423526-39423548 GCACCTACTGGCTGTTGGGGAGG - Intronic
990287106 5:54310917-54310939 CTTCCTACTGGGGGTTGGCGGGG - Intergenic
990526895 5:56637101-56637123 CTATTTTTTGGGTGGTGGGGTGG - Intergenic
993770547 5:91919279-91919301 CCACAGACTGGGTGGGGGGGTGG + Intergenic
1000230352 5:159310190-159310212 CCATCTACTGGGTGCTGTGGGGG - Intergenic
1001508465 5:172299142-172299164 CTAGCTACTTGGTGCTGAGGTGG - Intergenic
1003945106 6:11068022-11068044 CTACATACTGTTTGGAGGGGAGG - Intergenic
1005512716 6:26525788-26525810 CTATTCACTGCGTGGTGGGGTGG + Intergenic
1005696171 6:28354717-28354739 CTACCTTTAGGGTGTTGGGGCGG + Intronic
1006114697 6:31769320-31769342 CTGCCTTCTGGCTGCTGGGGTGG + Intronic
1006522669 6:34581116-34581138 CTTCCTTCTGGGTGAGGGGGAGG - Intergenic
1007125164 6:39419763-39419785 TTTCCTGCTGGGTGGTGGGAGGG + Intronic
1007664197 6:43505029-43505051 CTCCCCATTGGGTTGTGGGGTGG - Exonic
1007717189 6:43864179-43864201 CTGGCTTCTGGGGGGTGGGGAGG - Intergenic
1007726670 6:43920975-43920997 CCCCATACTGGGTGGTGGTGGGG + Intergenic
1008507558 6:52245846-52245868 CTTCCTCCTGGGTAGAGGGGAGG + Intergenic
1010126700 6:72440818-72440840 CTACTTTGTGGGGGGTGGGGGGG - Intergenic
1014481525 6:121944423-121944445 CTTCCTACTGTGTAGTGGAGTGG - Intergenic
1016172966 6:141041930-141041952 CTACTTACAGGGAGGTGTGGAGG - Intergenic
1017993499 6:159510405-159510427 TGACCTACTGGGGGGTGGGGGGG + Intergenic
1018159538 6:161025031-161025053 ATAACTACTGGGTGGGTGGGTGG - Intronic
1019483597 7:1277346-1277368 CTTCCTACTGGGGGGGGGGAGGG - Intergenic
1019711021 7:2518381-2518403 GTACCCGCTGGGTGGTGTGGGGG - Intronic
1019714081 7:2530398-2530420 TCACCTTCTGGGGGGTGGGGGGG - Intergenic
1020086291 7:5312601-5312623 CCAGCTCCTTGGTGGTGGGGAGG + Exonic
1021276947 7:18663456-18663478 CTGCTTACTGGGGGGTGAGGGGG - Intronic
1022161065 7:27711787-27711809 CTACCTCCTGAATGGTTGGGAGG - Intergenic
1023185109 7:37524941-37524963 CTGCCTGCTGGGATGTGGGGAGG + Intergenic
1025208016 7:57004471-57004493 CCAGCTCCTTGGTGGTGGGGAGG - Intergenic
1025663937 7:63572404-63572426 CCAGCTCCTTGGTGGTGGGGAGG + Intergenic
1029213149 7:98925276-98925298 CTTCCTTCTGTGTGGTTGGGTGG + Intronic
1030771776 7:113484444-113484466 CCACGGACTGGGTGGTGGGGTGG - Intergenic
1031420037 7:121540274-121540296 GTAGCTATTGGGTGGTGGAGGGG + Intergenic
1032703604 7:134403559-134403581 CCAGCTACTGGGGGGTGGGGAGG + Intergenic
1035830623 8:2690956-2690978 CTAACTACTGGGTGTTGGGGAGG - Intergenic
1035967932 8:4215298-4215320 GTAACTATTGGGTGGTGGGGAGG - Intronic
1036434193 8:8717753-8717775 CTACATACTGGGTGTTAGAGTGG + Intergenic
1037254259 8:16934549-16934571 CTACCTGCTAGGTGGGGTGGGGG + Intergenic
1044828285 8:96219857-96219879 CTGCCTCCTGGGTGGAGGGAAGG + Intergenic
1044952468 8:97447654-97447676 CTAACCAGTGGGTTGTGGGGAGG + Intergenic
1045841708 8:106589167-106589189 TTATCTACTGGGTGGTGAGCTGG + Intronic
1049488038 8:142876599-142876621 TTCCCCACTGGGTGGTGGAGAGG + Intronic
1053137576 9:35661054-35661076 CTACTTCCTGGGAGGTGGGGCGG + Exonic
1055083683 9:72292139-72292161 CAGCCTAATTGGTGGTGGGGAGG + Intergenic
1056165471 9:83936903-83936925 CCAGCCACTGTGTGGTGGGGAGG - Intergenic
1057646869 9:96884557-96884579 CTGCCTTCGGGGTTGTGGGGTGG - Intergenic
1059689656 9:116672799-116672821 CTTCCAACTGGGTGGTGTTGGGG + Intronic
1060183865 9:121552106-121552128 CCACCCTCTGGGTGCTGGGGAGG - Intergenic
1060236038 9:121863238-121863260 CTATCTACTGGGTTCTGTGGGGG + Intronic
1060701812 9:125759371-125759393 CTTCCTCCTGGCTGGTGGGCTGG + Intronic
1061136856 9:128739650-128739672 ATACCTACTGATTTGTGGGGAGG - Intronic
1061434794 9:130554402-130554424 CCAGCTACTCGGTGTTGGGGTGG + Intergenic
1061757777 9:132827360-132827382 CAACCTAATGGGTGATGGGATGG - Intronic
1062575275 9:137203857-137203879 CTTCATACAGGGTGGGGGGGGGG + Intronic
1062660330 9:137627822-137627844 CCAGCTACTTGGGGGTGGGGGGG - Intronic
1187277395 X:17828028-17828050 CTAACTTGTGGGAGGTGGGGAGG + Intronic
1188232844 X:27686822-27686844 CTACGGACTGGGTAGAGGGGTGG + Intronic
1188475060 X:30583269-30583291 ATATCAACTGGGTGGTGGTGTGG - Intergenic
1189305611 X:39984651-39984673 CTAGCTACATGGTTGTGGGGTGG - Intergenic
1190011819 X:46791623-46791645 CCAGCTACTGGGTGGGGGGAGGG + Intergenic
1190149851 X:47936426-47936448 CTTCCTGCTGAGGGGTGGGGCGG - Intronic
1190581029 X:51893426-51893448 CGACCTGGTTGGTGGTGGGGTGG + Intronic
1191682533 X:63856034-63856056 CTACCTCCTGGATGGTAGAGAGG + Intergenic
1198462704 X:136878628-136878650 CCAGCTACTGGGGGGGGGGGGGG + Intronic
1198750183 X:139931725-139931747 CTTCGGGCTGGGTGGTGGGGGGG - Intronic
1200073268 X:153539231-153539253 TCAGCTCCTGGGTGGTGGGGAGG - Intronic
1200290322 X:154865695-154865717 ATATCTACTGTGTGGGGGGGCGG - Intronic
1201862331 Y:18612708-18612730 GTACCTGCTGGGTGGTGTGGGGG - Intergenic
1201870992 Y:18707672-18707694 GTACCTGCTGGGTGGTGTGGGGG + Intergenic