ID: 1119782253

View in Genome Browser
Species Human (GRCh38)
Location 14:77284314-77284336
Sequence ACAGGGCCCCATGTGGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119782246_1119782253 5 Left 1119782246 14:77284286-77284308 CCAAGTCTGTCTCCTCGCCAATA 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1119782253 14:77284314-77284336 ACAGGGCCCCATGTGGTTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 178
1119782249_1119782253 -7 Left 1119782249 14:77284298-77284320 CCTCGCCAATATGTCCACAGGGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1119782253 14:77284314-77284336 ACAGGGCCCCATGTGGTTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119782253 Original CRISPR ACAGGGCCCCATGTGGTTCC TGG Intronic
901710660 1:11112162-11112184 ACACTGTTCCATGTGGTTCCAGG + Intronic
902153962 1:14468396-14468418 TGAGAGCCCCATGTAGTTCCTGG - Intergenic
902603547 1:17556121-17556143 CCAGGCCCCCCTGTGTTTCCAGG - Intronic
902784768 1:18725799-18725821 TCAGGGCCCCTGGTGGGTCCTGG - Intronic
905018018 1:34790940-34790962 GCAGGGAAGCATGTGGTTCCAGG + Intronic
907443356 1:54491594-54491616 TCAGGGCCCTCTGTGGCTCCCGG - Intergenic
910653825 1:89599870-89599892 ACATAGCCCCATGCAGTTCCTGG + Intergenic
912391750 1:109307566-109307588 ACAGAGCCCCAAGTGGCACCTGG - Intergenic
913312647 1:117516987-117517009 ACAGGGCCACATAGGGTTGCAGG + Intronic
914340540 1:146756190-146756212 ATGGGCCCCCAAGTGGTTCCTGG + Intergenic
917702779 1:177597851-177597873 ACAGGTCCCCTTGCTGTTCCTGG + Intergenic
917970019 1:180200321-180200343 ACAGGGCCCCTTGAGTTTTCAGG - Exonic
920296407 1:204959955-204959977 ACAGAGCCCCATCAGCTTCCTGG + Intronic
922182029 1:223243102-223243124 ACAGGGAGCCCTGTGGCTCCAGG + Intronic
922677098 1:227559839-227559861 AGCGGGCCCGATGTGGTTTCGGG + Intergenic
1064159973 10:12936989-12937011 ACAGGTCCCCTTGTGCTGCCAGG - Intronic
1064987130 10:21222010-21222032 ACAGGCTCCCATTTGGTTCTCGG - Intergenic
1066010755 10:31191703-31191725 TCAGGGCCCCAAGGGGCTCCAGG - Intergenic
1067090470 10:43263779-43263801 AAAGGCACCCATGTGCTTCCTGG + Intronic
1069594952 10:69664431-69664453 ACAGGGCCCCATGGGGTACACGG + Intergenic
1074272862 10:111972120-111972142 ACTGGGATCCATGTGGGTCCTGG - Intergenic
1075064876 10:119282610-119282632 TCAAGGCCCCCTGTGGGTCCAGG + Intronic
1075451169 10:122552839-122552861 AAACAGCCCCAGGTGGTTCCAGG - Intergenic
1076574576 10:131455382-131455404 ACAGGGGACCAGGAGGTTCCTGG + Intergenic
1076763073 10:132615354-132615376 ACAGCATCCCATGTGCTTCCAGG - Intronic
1077479361 11:2806403-2806425 ACAGTGGCCCATGTGGCCCCAGG - Intronic
1078857889 11:15221329-15221351 CCAGGACCCCATGTGGAACCAGG - Intronic
1079356883 11:19737167-19737189 ACAGGGACTCCTGTGGTTCTGGG + Intronic
1082958091 11:58893181-58893203 CCAGGGCCCCCTGTGGACCCAGG - Intronic
1085023470 11:73223207-73223229 TCAGAGGCTCATGTGGTTCCTGG + Intronic
1085392634 11:76190242-76190264 ACAGAGCCACATATGGATCCAGG + Intronic
1085457597 11:76674085-76674107 TCAGGGGCCCATGTGGGTGCTGG - Intergenic
1086116760 11:83259674-83259696 ACAGGGTCTCATGTGTTGCCAGG + Exonic
1089369066 11:117941324-117941346 AGTGGGCCCCAGGTGGGTCCAGG - Intergenic
1090072039 11:123552076-123552098 ACAGGGCCCCATGTGTGATCAGG - Intronic
1090398958 11:126436211-126436233 ACAGGGGTCCATGTGCCTCCTGG + Intronic
1092103633 12:5905218-5905240 CCAGAGCCCCAGGTGGCTCCAGG - Intronic
1092191912 12:6527381-6527403 ACAGGGCCCCATCCGGGGCCAGG - Intronic
1094723878 12:33092477-33092499 ACTGGGCCCACTGTGGTCCCAGG - Intergenic
1096311650 12:50526291-50526313 TCAGGGGCCTATGTGTTTCCTGG + Intronic
1096981768 12:55732259-55732281 ACAGAGCTCCATGTGTTTGCTGG + Intergenic
1102192799 12:111001757-111001779 ACAGGATCCCATGAGGTTCTGGG - Intergenic
1103795851 12:123502640-123502662 CCTGGGCCCCATATGGTGCCTGG + Intronic
1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG + Intergenic
1104929509 12:132330141-132330163 CCAGGGCCCCCTGCTGTTCCCGG - Intergenic
1105457313 13:20553576-20553598 ACAGGGCCCCACTTTGCTCCAGG + Intergenic
1113920514 13:113906007-113906029 ACAGGGCTCTAGGTGGTACCTGG - Intergenic
1113939690 13:114012049-114012071 CCAGGCCCCAATGTGGTTGCTGG - Intronic
1114377037 14:22158143-22158165 ACTGGGCCACATATGTTTCCCGG - Intergenic
1116949889 14:50869956-50869978 ACGGTGCCCAATGTGGTACCTGG + Intronic
1118845096 14:69542026-69542048 ACATGGCCCCATGTGCTTGCAGG + Intergenic
1119196169 14:72718145-72718167 ACAGGAACCCAGGTGGTTTCTGG - Intronic
1119782253 14:77284314-77284336 ACAGGGCCCCATGTGGTTCCTGG + Intronic
1121850868 14:97219982-97220004 GCAGGGCCTCCTGTGATTCCAGG + Intergenic
1122267620 14:100554064-100554086 GCAGGGCCCCATGGGCTTCAGGG - Intronic
1124642210 15:31402667-31402689 ACAGAGCCCCAGGTGGAGCCTGG + Intronic
1126117865 15:45225318-45225340 CCAGGGCCCCATGGTGTACCTGG + Intergenic
1130690693 15:86079454-86079476 CCAGGGCCCCCTGAGGTCCCAGG - Intergenic
1130943100 15:88527955-88527977 ACATGGCTCCAAGTGGTTCTGGG + Intronic
1132932895 16:2467874-2467896 GCAGGGCCCCGGGGGGTTCCGGG - Intergenic
1136088454 16:27902150-27902172 CCAGAGCCAGATGTGGTTCCCGG - Intronic
1138491962 16:57382270-57382292 CCAGGGCCCTCTGTGCTTCCTGG - Exonic
1139531759 16:67545945-67545967 ACAGGCCCTCCTGTGCTTCCTGG + Exonic
1139960889 16:70716679-70716701 ACAGGGCCCCAAGCGGGCCCTGG + Intronic
1139993745 16:70961216-70961238 ATGGGCCCCCAAGTGGTTCCTGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142816890 17:2433520-2433542 CCACGGCCCTATGTTGTTCCTGG - Intronic
1143968402 17:10773993-10774015 ACAGGACCCCATGTAGTTTCTGG + Intergenic
1146470581 17:33121281-33121303 CCAAGGCCTGATGTGGTTCCTGG - Intronic
1147889450 17:43707024-43707046 ACAGGGCACCCGGTGGTTTCCGG - Intergenic
1147962511 17:44176831-44176853 ACAGAGCCACATGTTGCTCCAGG - Exonic
1148736905 17:49870054-49870076 TCAGGGCCCCATGGGATTCCAGG + Intergenic
1148997894 17:51727515-51727537 ACAGTGGCTCATGTGGGTCCTGG + Intronic
1149814409 17:59708418-59708440 ACAGGGCCACATATGGTTTCTGG - Intronic
1150882288 17:69043843-69043865 ATCTGGCCCCTTGTGGTTCCTGG + Intronic
1152392192 17:80009646-80009668 ACCTGGCCCCCTGTGGTCCCCGG - Intronic
1152907524 17:82977005-82977027 TCAGGGCCCCAGGTGGCCCCAGG + Intronic
1153246158 18:3074354-3074376 ACAGGGCTCCATGTGCCTCTGGG - Intronic
1154108549 18:11546583-11546605 ACAGGTCCCTAGGTGGGTCCTGG + Intergenic
1157307699 18:46529066-46529088 ACAATGCCCCATGGAGTTCCTGG + Intronic
1161073389 19:2273536-2273558 CCAGGGCCCTCTGTGGTCCCAGG - Intronic
1161232224 19:3180063-3180085 ACAGGCCCCCATGGTCTTCCCGG + Exonic
1161468128 19:4443458-4443480 GCCCGGCCCCATGTGGTGCCTGG + Intronic
1162717756 19:12644565-12644587 ACAGGGACGCATGTGGGACCAGG + Intronic
1163391371 19:17032756-17032778 ACAGGGACAGATGTGGCTCCTGG - Intergenic
1166912001 19:46165545-46165567 ACAGGGCTCCATTTGGTGCGTGG + Intergenic
1167314800 19:48756999-48757021 ACAGGGCCCCATCTGGCCGCTGG - Exonic
927463481 2:23320108-23320130 ACAGGGCCTCAAGTGTTTCCTGG - Intergenic
927812447 2:26187580-26187602 ACAGGACCCGAGGTGGTTCTGGG - Exonic
928082567 2:28323925-28323947 TCACGGGCCCATGTGGTTCTTGG - Intronic
930162396 2:48171544-48171566 ACAAGGCTCCATGTGGCTGCTGG - Intergenic
933420648 2:82041845-82041867 ACAGGTTCCCATGTGGTGCTAGG - Intergenic
934686834 2:96327363-96327385 ACAGGGCACCATGTTTGTCCTGG + Exonic
937352263 2:121173556-121173578 ACAGGACTCCATGTGGTTCCTGG - Intergenic
939968357 2:148633289-148633311 CCAGGGCCAGATGTGGATCCAGG + Intergenic
941218160 2:162739555-162739577 ACTGGGCCCCATGTAGGACCTGG - Intronic
942436017 2:175977266-175977288 AAATAGCCCCATGTGGCTCCTGG - Intronic
942812646 2:180017112-180017134 CCAGGGGCCCAGGTGGTGCCGGG - Intergenic
943220546 2:185098709-185098731 ACAGGTCCCCATGTTGTTTTGGG + Intergenic
947348335 2:229217152-229217174 ACAGGGCTCCCTGTAGATCCTGG - Intronic
948704349 2:239779775-239779797 ACAGGGCCACACGTGGTCCAGGG - Intronic
948890509 2:240904997-240905019 ACATGGCCCCATGGGCATCCGGG - Intergenic
1169835190 20:9870069-9870091 ACAGGGCCACATGGGGTTCAGGG + Intergenic
1172080691 20:32338418-32338440 ACAGGCCTCCATTTGGTTCCTGG + Intergenic
1172718935 20:36984615-36984637 ACACAGCAGCATGTGGTTCCTGG - Intergenic
1173325797 20:42032442-42032464 ACAGATCCCCATGTTGATCCAGG + Intergenic
1173872255 20:46349376-46349398 CCAGGGGCCCATGAAGTTCCAGG + Intronic
1174359601 20:50019736-50019758 ACAGGGCCACACATGGTGCCAGG + Intergenic
1179375914 21:40849515-40849537 ACGGGGTCCCATCTGGTCCCAGG - Intergenic
1179563014 21:42228654-42228676 ACAGGGCCTTATGGGGTGCCAGG + Intronic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1179957724 21:44750526-44750548 GCAGGGCCTCATGGGGTTGCAGG - Intergenic
1180604288 22:17044947-17044969 AGAGGGCTACATCTGGTTCCTGG + Intergenic
1181359278 22:22322583-22322605 GCAGGGCCTCATGGGCTTCCTGG - Intergenic
1181369379 22:22404335-22404357 GCAGGGCCTCATGGGCTTCCTGG - Intergenic
1181601130 22:23952447-23952469 ACAGGGCCCAGTCTGCTTCCGGG + Intergenic
1181672361 22:24431663-24431685 ATAGGGCCCCATGAGGGTTCAGG + Intronic
1183730060 22:39613412-39613434 AGAGGGCCTCATGTGATTCGTGG + Intronic
1183966813 22:41447120-41447142 ACCCGGCCCCAGGTGGTCCCCGG - Intergenic
1184968547 22:47998741-47998763 CCAGGCTCCCGTGTGGTTCCTGG + Intergenic
1185178849 22:49347837-49347859 ACAGGGCCCTCTCTGGGTCCTGG + Intergenic
950351111 3:12354201-12354223 AAAGGGACCCATGTAGTACCAGG + Intronic
951041338 3:17991867-17991889 CCTGGGCCACATGTGGTCCCTGG - Intronic
953164459 3:40452767-40452789 ACAGGGGCCAATCTGGTTACAGG + Intergenic
953802043 3:46031692-46031714 AAAGGTCCCCCTGTGGTTCGTGG - Intergenic
954855216 3:53638430-53638452 ACCGGGCACCATGCTGTTCCTGG + Intronic
956116289 3:65922293-65922315 ATAGGGTCACATGTGGTTCCAGG - Intronic
959222308 3:103536163-103536185 AGAGGGTCCCATGTTTTTCCAGG + Intergenic
961114650 3:124318320-124318342 AGAGGGCACCCTGTGGTTCATGG + Intronic
962070130 3:132024787-132024809 AAAGTGCCCCATGAGGTACCTGG + Intronic
965743443 3:171900624-171900646 ACGTGGCCCCATCTGGTTTCAGG - Intronic
966135866 3:176697502-176697524 ACAGGGCGCCAGGAGATTCCAGG - Intergenic
968260574 3:197320373-197320395 ACAGAGCACCATTTGGTTCTTGG + Intergenic
970540013 4:17068277-17068299 AAAGTGCCCCATGTAGTTGCTGG + Intergenic
971233168 4:24817289-24817311 ACAGGGGGCCATGGTGTTCCAGG + Intronic
971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG + Exonic
971419802 4:26464929-26464951 GGAGGGCCCCATGTGTTTACCGG + Intergenic
977525674 4:98143080-98143102 ACTGAGGCCCATGTGGGTCCTGG - Exonic
980620711 4:135299216-135299238 ACATGGCCATATGTGGTTGCAGG + Intergenic
982193485 4:152883295-152883317 ACAGGGCCCTATGTTCTACCAGG + Intronic
983014948 4:162602084-162602106 ACAAGGACCCTTGTGCTTCCTGG + Intergenic
986606210 5:9525664-9525686 AAATGCCCCCATTTGGTTCCAGG + Intronic
986897328 5:12385681-12385703 ACAGGGCCCAATGTGGAGCCAGG - Intergenic
988982791 5:36588272-36588294 TCAGGGCCCAGTGTGGTCCCAGG - Intergenic
989200477 5:38757966-38757988 TCAGGGACCCATTTGTTTCCTGG + Intergenic
989252326 5:39332080-39332102 ACATGGGACCATCTGGTTCCTGG + Intronic
1001650264 5:173310965-173310987 ACAGGGCTCCTTCTGGCTCCCGG - Intergenic
1002425487 5:179172250-179172272 ACATGTCCCCATGTTGTCCCTGG + Intronic
1003390295 6:5707781-5707803 ACAGAGCCCCATCTTGTCCCTGG + Intronic
1003684850 6:8292295-8292317 AAAGGGCTCCATGTGGACCCTGG - Intergenic
1003760183 6:9171218-9171240 ACAGGGCCCCCTGTTCTCCCAGG - Intergenic
1005267540 6:24127391-24127413 ACAGGTCCCCATTTGTTTGCAGG - Intronic
1006797629 6:36741705-36741727 ACAGCACCCCATGGGGTCCCCGG + Exonic
1007334119 6:41139146-41139168 ACAGGTCCCACTGTGATTCCTGG - Intergenic
1007387634 6:41530466-41530488 ACAGTGCCCTATGTGGGCCCTGG - Intergenic
1008222248 6:48869148-48869170 ACAGGCCCCCATGCGGGTCAGGG - Intergenic
1008663416 6:53693081-53693103 AGAGGGCCCCATGTGGCACTTGG + Intergenic
1010396595 6:75400015-75400037 GCAGGAACCCATCTGGTTCCTGG + Intronic
1013386313 6:109635350-109635372 ACAAGGTCCCATGTCTTTCCAGG - Intronic
1015856088 6:137625947-137625969 ACAGGTCCCCTTGTGGCTGCGGG - Intergenic
1017022192 6:150149210-150149232 ACAGGGCCACATGTGAATTCAGG - Intronic
1018632615 6:165834131-165834153 GGAGGGCTCCATGTGGTCCCAGG - Intronic
1018982103 6:168609166-168609188 AGAGGGCGGAATGTGGTTCCGGG + Intronic
1029597446 7:101545352-101545374 CCAGGGCCCCGTGGGCTTCCTGG + Exonic
1029620036 7:101684655-101684677 TCAGGGCTCCATGTGGCCCCAGG + Intergenic
1029991259 7:104964718-104964740 ATCCAGCCCCATGTGGTTCCTGG - Intergenic
1035575613 8:702848-702870 ACAGGCTTCCATCTGGTTCCCGG - Intronic
1035953111 8:4045508-4045530 ACAGGGCCCCATGATGTCCCTGG - Intronic
1040013497 8:42681760-42681782 ACAGTGCCCCATCTGCTTCTGGG + Intergenic
1040326113 8:46342441-46342463 ACAGGGCCGCAGGTTGTCCCTGG + Intergenic
1040562895 8:48540416-48540438 TCTTTGCCCCATGTGGTTCCTGG + Intergenic
1041863777 8:62544729-62544751 TCAGTGCCCCATGTTGTTCAAGG - Intronic
1042005725 8:64177884-64177906 ACAGGTCACCATGTTGTTTCAGG - Intergenic
1042530609 8:69811117-69811139 CCAGAGCCCTTTGTGGTTCCTGG - Intronic
1046626693 8:116583442-116583464 ACAAGGCCACTTGTGGCTCCAGG - Intergenic
1051824057 9:21198934-21198956 ACCGGGCACCATGCTGTTCCTGG - Intergenic
1052865138 9:33460295-33460317 ACAGGGCCACATGAGGTGGCAGG + Intergenic
1057045521 9:91883458-91883480 AAAGGGCCCCATGTGGCTAGTGG - Intronic
1057206842 9:93178538-93178560 GCAGGGCCTCAAGGGGTTCCGGG - Intergenic
1057447217 9:95125154-95125176 CCAGGGCCCCATCGGTTTCCAGG + Exonic
1057568350 9:96184566-96184588 ACAAAGCCCCATGTGCTGCCTGG - Intergenic
1060251405 9:121989194-121989216 GCCGGGCCCCACGTGCTTCCAGG - Exonic
1061284241 9:129613261-129613283 ACAGGACCCCATGAGCTTCCTGG + Intronic
1062028387 9:134350944-134350966 ACAGGGCCTCTTGTGGGTGCTGG - Intronic
1062030431 9:134359710-134359732 CCAGGGCCACACGTGGCTCCAGG - Intronic
1186456030 X:9710590-9710612 ACAGGGACCCATTAGGTACCGGG - Intronic
1187392632 X:18896032-18896054 ACAGGGGCCCCTGTGCTTCATGG - Intronic
1187564618 X:20436064-20436086 ACAGAGTCCCCTGTGATTCCCGG + Intergenic
1190031621 X:46978565-46978587 ACTATGCCCCATGTGATTCCGGG - Intronic
1191831472 X:65420201-65420223 ATAGGGGCCAATGTGGTGCCAGG - Intronic
1195107960 X:101618134-101618156 ACAGGGCCACTTCTGGTTTCTGG - Intergenic
1195199998 X:102539478-102539500 CCAAGGCCCCATGTGGATCCAGG + Intergenic
1198113502 X:133523312-133523334 ACTGAGCCCCATGTGCTTGCTGG + Intergenic
1200248932 X:154541980-154542002 GCAGGGGCCCAGCTGGTTCCTGG + Intronic