ID: 1119783588

View in Genome Browser
Species Human (GRCh38)
Location 14:77296024-77296046
Sequence CAGAGAAAACAGAAGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 446}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119783584_1119783588 -2 Left 1119783584 14:77296003-77296025 CCTAGAGAAGCTGGGGTTAGCCA 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG 0: 1
1: 0
2: 2
3: 38
4: 446
1119783580_1119783588 10 Left 1119783580 14:77295991-77296013 CCTATGCTGATGCCTAGAGAAGC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG 0: 1
1: 0
2: 2
3: 38
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119783588 Original CRISPR CAGAGAAAACAGAAGGGTGC AGG Intronic
900136314 1:1118571-1118593 CCGAGAACACGAAAGGGTGCAGG + Intergenic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
902129100 1:14243208-14243230 CAAAGAAAAGAGAAAGATGCTGG - Intergenic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
904337760 1:29809323-29809345 AAGAGAAGACAGCTGGGTGCAGG - Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
904496289 1:30888663-30888685 CCCAGCAAACAGGAGGGTGCGGG - Intronic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
906092942 1:43198154-43198176 CAAAGAAAACAGTAGGGGGTGGG - Intronic
906112272 1:43331977-43331999 CAGAGAAAACGGAGGAGGGCCGG - Intergenic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
906922981 1:50084581-50084603 CATACAAGACAGAAGGGGGCAGG - Intronic
907177465 1:52538364-52538386 CTGAGAAAAAAAAAGGGAGCTGG + Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907845945 1:58206956-58206978 CTGAGAGAGCAGAAGTGTGCAGG - Intronic
908623801 1:66016984-66017006 CAGAGAAAACAACAGAGTGTGGG + Intronic
908661919 1:66445860-66445882 GAGAGAGAAGAGGAGGGTGCTGG + Intergenic
909748181 1:79125464-79125486 GAAAGAAAACACAAGTGTGCAGG + Intergenic
910110967 1:83683072-83683094 CAGAGAAAGCATAAAGGAGCTGG + Intergenic
910910399 1:92227977-92227999 AAGAGAAAAGAGAATGGAGCAGG - Intronic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
911751266 1:101500387-101500409 AAGAGGAAACGTAAGGGTGCAGG + Intergenic
911808506 1:102243098-102243120 AGGAGAAAACAGAAGGGTTGGGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
913545112 1:119860363-119860385 CAGTGAGAACAGCAGGGTTCTGG - Intergenic
914735502 1:150412535-150412557 AAGAGAAAACACAAGGTAGCAGG + Intronic
915171141 1:153977896-153977918 CAGAGAAACCAGAAGCTTGACGG - Intergenic
916083464 1:161251572-161251594 AAGAGGAAAGACAAGGGTGCAGG + Intergenic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
918194357 1:182207625-182207647 AGGAGAAAACAGGAGGGTGCGGG - Intergenic
918317248 1:183332283-183332305 CAGAGAACACACAAAGGAGCAGG - Intronic
919743918 1:200996762-200996784 AAGAGAAGACAGAATGGTGTGGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920306253 1:205020062-205020084 CAGAGCACAAAGGAGGGTGCTGG - Exonic
920949937 1:210563174-210563196 GAGGGAATACAGAAGGGTACTGG + Intronic
921203925 1:212831943-212831965 AACAGAAAACAGCAGGGTGGGGG - Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924887827 1:248238996-248239018 CAGAGAAAAAAGGAAGGTGTGGG - Exonic
1062937887 10:1401393-1401415 CAGAGAAGACAGCTGGGTTCTGG + Intronic
1063480053 10:6367507-6367529 AAGGGAGAAGAGAAGGGTGCAGG + Intergenic
1063870901 10:10416702-10416724 CAGAGACAACAGAAATGTTCTGG + Intergenic
1064768143 10:18695850-18695872 CAGAGAAAACAAGAGAGTTCTGG - Intergenic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065170184 10:23019212-23019234 CAGAGTAAAAAGTGGGGTGCAGG + Intronic
1065640332 10:27775949-27775971 TAGAGAAAACAGAATGTTACAGG + Intergenic
1065712281 10:28530187-28530209 GAGAGAGAACAGAGGAGTGCGGG + Intergenic
1066067112 10:31770449-31770471 CAGAACAAACAGAAATGTGCAGG + Intergenic
1066292871 10:34029795-34029817 CAGAGAAAACAGAAAATAGCAGG + Intergenic
1066574545 10:36810994-36811016 CAGAGAGAACAAAAAGGGGCCGG + Intergenic
1067273384 10:44811980-44812002 CAGAGATAAAAGAAGGGTCTGGG + Intergenic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067549455 10:47223599-47223621 CAGAGAGGACAGAAGCTTGCTGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1070244856 10:74721236-74721258 CAGACAAAATAGAAGCCTGCCGG - Intergenic
1070466783 10:76732028-76732050 GAGAGGAAAAAGAAGGGGGCTGG - Intergenic
1070472755 10:76800422-76800444 CAGAGAAAACAGCAGGGCTTTGG - Intergenic
1070803233 10:79255559-79255581 CAGAGAAATAAGAGGGGAGCGGG - Intronic
1071154322 10:82671999-82672021 GAAAGAAAACAGAAGAGTTCAGG - Intronic
1071191295 10:83104548-83104570 TAGAGAAATCAGAAAAGTGCTGG - Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1072694192 10:97590851-97590873 AAGAGAAGACAGATGGGAGCAGG + Exonic
1073960840 10:108925524-108925546 CAGAGAAAGCAGGATGGTGTTGG + Intergenic
1075182136 10:120220835-120220857 CAGAGAGACCAGAGGTGTGCTGG - Intergenic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1077727765 11:4692713-4692735 CAGAGGAAAAGAAAGGGTGCTGG + Intronic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1079331297 11:19535193-19535215 CAGGGAAAACAGGAAGCTGCTGG + Intronic
1079582707 11:22086315-22086337 CAGAGAGAACTGAAGAGAGCTGG + Intergenic
1079901725 11:26195116-26195138 GAAAGAAAACAGAAAGGTGGTGG + Intergenic
1079916584 11:26375353-26375375 CTGAGAAAACAGACTGGTACTGG - Intronic
1080287753 11:30635916-30635938 CAGTGAAAACAGAAGTCTTCGGG - Intergenic
1080953154 11:37060349-37060371 CAGAGAAGGCAGATGGGTGGAGG + Intergenic
1081365690 11:42232296-42232318 CATAGAAAGCAGAAGGGATCTGG - Intergenic
1081543951 11:44056492-44056514 CAGATAACACAGCAGGGTGTAGG + Intronic
1081983363 11:47284131-47284153 CAAACAAAACAGAAAGGGGCAGG - Intronic
1082745298 11:56954652-56954674 CAGGCAAGACAGAAGAGTGCAGG + Intergenic
1083471117 11:62884679-62884701 CAGTGAAGACAGGTGGGTGCAGG + Exonic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085395510 11:76205296-76205318 CAGATAAGACAGCAGGGGGCAGG - Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1088735186 11:112722987-112723009 CAGAGAACAGAGACGGGAGCAGG + Intergenic
1089252329 11:117173929-117173951 CAGTGAAAACAGAAAGCTTCAGG + Intronic
1090352891 11:126118870-126118892 CAGAGAAGACAGAGAGGTGAGGG - Intergenic
1090691875 11:129192011-129192033 CAGAGAAGAAAAAGGGGTGCGGG + Intronic
1090878644 11:130814013-130814035 CAGATAAAACAAAAAGGTGGAGG + Intergenic
1091157073 11:133383912-133383934 GGGAGATAAGAGAAGGGTGCAGG + Intronic
1091705793 12:2692033-2692055 AAGTGAAAACAGAAAGGTGAGGG - Intronic
1092015703 12:5156534-5156556 CAAAGAAAACTGTTGGGTGCAGG + Intergenic
1092827339 12:12413494-12413516 CTGAGAAATCAGATGGTTGCCGG - Intronic
1093546217 12:20352237-20352259 CAGAGAAGACAGAAAGTTGCCGG + Intergenic
1093763352 12:22935297-22935319 CAGAGAAAAGAAAGGGGCGCTGG - Intergenic
1094269026 12:28590783-28590805 TAGAGAAAATACAAGGGTGAGGG - Intergenic
1095857433 12:46875390-46875412 CAGTGAAAACAGAAGCTTTCAGG - Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1098198421 12:68027419-68027441 CAGAGAAAATTGAGGGGTGGTGG + Intergenic
1100867293 12:98870471-98870493 CAAAGAAAAGAAAAGGGTGAGGG - Intronic
1101435061 12:104657556-104657578 CAGAGAAAAAACATGGGAGCGGG - Intronic
1102201245 12:111059469-111059491 CATAGAAAACAAAATGGTCCAGG - Intronic
1102454061 12:113060762-113060784 AGGAGAAAACAGAATGGGGCGGG - Intronic
1102790687 12:115642743-115642765 AAGAGGAAAGAGAAGTGTGCAGG - Intergenic
1103994583 12:124820777-124820799 CACAGAAAACAGTGGGGGGCAGG + Intronic
1104314308 12:127682746-127682768 CAGAAAAAAAAAAAGTGTGCCGG - Intergenic
1104393884 12:128415171-128415193 CCGAGAAACCAGAGAGGTGCGGG + Exonic
1105438995 13:20400284-20400306 GAGAGAAAACAGAAGGGCAGAGG - Intergenic
1105680201 13:22718150-22718172 CAGAGAAAACGGAAGCGAGATGG + Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106875151 13:34063851-34063873 CAGATAAAACAAAAAGGTGAAGG - Intergenic
1108304040 13:49113101-49113123 AGGAGAAAACAGAAGGGTAAGGG - Intronic
1109022447 13:57115484-57115506 CAGCGAAAACTGAATGGTACTGG - Intergenic
1109154481 13:58889207-58889229 TAGAGAAAACATTAGGGTGTTGG - Intergenic
1109323925 13:60845208-60845230 CATAGACAACAGAAGGATACAGG - Intergenic
1111240423 13:85466285-85466307 GAGAGAAAGCACTAGGGTGCTGG + Intergenic
1111928252 13:94485702-94485724 CAGAGAAAACAAAATGGGACAGG + Intergenic
1113641553 13:111961249-111961271 CAGAGAGACCAGTGGGGTGCAGG - Intergenic
1113699009 13:112369344-112369366 CAAGGAAAACAGATGAGTGCTGG + Intergenic
1114265319 14:21070067-21070089 CGGAGAAGAAAGAAGGTTGCCGG + Intronic
1115770534 14:36661312-36661334 CAAAGAAACCAGGAGGTTGCGGG - Intronic
1116204062 14:41838419-41838441 CAGATACTGCAGAAGGGTGCTGG - Intronic
1116722615 14:48519184-48519206 CAGAAACAAGAGAAGGGTACTGG + Intergenic
1117316696 14:54577766-54577788 CAGAGAAGACAGAATGGCGGGGG + Intronic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120748273 14:88173086-88173108 CAAACAAAACAGCATGGTGCTGG + Intergenic
1120993652 14:90398426-90398448 CAGAGAAAGCAGAAACGTGGAGG - Intronic
1121445945 14:93979009-93979031 CAGAGGAAAGAGAACTGTGCTGG + Intergenic
1121945275 14:98114812-98114834 CAGAGAACAGAGAGAGGTGCTGG - Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1124139793 15:27067356-27067378 GAGGGGACACAGAAGGGTGCGGG - Intronic
1124906894 15:33877516-33877538 GTGAGAAAACAAAAGGGGGCCGG + Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125860703 15:42996941-42996963 CAGTGAAATCAGTAGGGTGAAGG - Intronic
1125899548 15:43332167-43332189 CAGAGAAAACAGAAGCCATCAGG - Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1129453586 15:75664179-75664201 CAGTGTGAACACAAGGGTGCTGG + Intergenic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1131441501 15:92463213-92463235 AAGTGAAGAGAGAAGGGTGCAGG - Intronic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1131780411 15:95850545-95850567 CAGATAAAACAAAAGCGTGGAGG + Intergenic
1132626408 16:893735-893757 CAGGGAAAGCAGACGGGTGTGGG - Intronic
1133879824 16:9770862-9770884 CAGGGAAAACCGAAGGGAGCGGG - Intronic
1134136036 16:11676952-11676974 CAGAAAGAACGGAGGGGTGCGGG - Exonic
1135285650 16:21190567-21190589 CAGCGAAAACACAAGTGTACTGG - Intergenic
1136751467 16:32639061-32639083 CAGAGAGAACAGTGGGGTTCAGG - Intergenic
1137394205 16:48105585-48105607 CAGAGAAACCAGATGGGCACTGG + Intronic
1137998659 16:53249766-53249788 TAGAGAAAACATAATGCTGCAGG + Intronic
1138219769 16:55240682-55240704 CTGAGAAAACAGAAGGGACCTGG - Intergenic
1139194212 16:64899430-64899452 CAAAGAAAAGAGAAGGGTCAGGG + Intergenic
1139827502 16:69768792-69768814 AAGAGAAAACGGGAGGGAGCAGG - Intronic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1141152755 16:81575549-81575571 CAGAGTAAACACAAGGGCCCTGG + Intronic
1141369585 16:83474580-83474602 CAGAAAAAACAAGAGGGTGGGGG + Intronic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1203053601 16_KI270728v1_random:898316-898338 CAGAGAGAACAGTGGGGTTCAGG - Intergenic
1142922841 17:3206241-3206263 CAGAGCAAACAGGAAGGCGCAGG + Intergenic
1146118927 17:30172104-30172126 CAGAGAAAATAGAATGGTACAGG - Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147575453 17:41596350-41596372 CAGAGAACAGAGAAGAGTCCAGG + Intergenic
1148693884 17:49547873-49547895 CAGAGAAAACAGAAAAGGACAGG + Intergenic
1148785909 17:50146120-50146142 GAGAGACAACAGAGGGGTACAGG - Intronic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149013674 17:51884034-51884056 CAAAGAAAAAAGAAGGGTCAAGG - Intronic
1150269529 17:63854467-63854489 CTGAGTCAATAGAAGGGTGCTGG - Intergenic
1150864114 17:68831706-68831728 CAGAGAAAAAAAATCGGTGCTGG - Intergenic
1151178716 17:72310454-72310476 TAGAGAAACCAGAACTGTGCTGG - Intergenic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153177875 18:2399428-2399450 AAGACAAAACAGAAGGATTCTGG + Intergenic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1157052784 18:44187754-44187776 AAGAGAAAACAGAAGGTTTAGGG + Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1157644263 18:49251217-49251239 CAGTGAATACAGCAGTGTGCAGG + Intronic
1157820336 18:50762964-50762986 CAGAGAGAGAAGAAGGGTGAAGG - Intergenic
1159135730 18:64334864-64334886 AAGAAAGAACAGATGGGTGCTGG - Intergenic
1160037023 18:75310798-75310820 CAAAGAAAACAAAGAGGTGCAGG - Intergenic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1160881455 19:1322524-1322546 CTGAGAAGACAGGAGGGCGCTGG - Intergenic
1162467326 19:10850150-10850172 CACAGAAAACACAAGGCTGAGGG + Intronic
1162943516 19:14028462-14028484 CAGAGATAAGAGGAGGTTGCTGG + Intronic
1162998061 19:14348894-14348916 CACAGAAGACAGAATGGGGCTGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164692164 19:30219567-30219589 CTTACAAAACAGAAAGGTGCTGG + Intergenic
1164814021 19:31180385-31180407 CAGAGAAAACAGAAATGTCACGG - Intergenic
1164967388 19:32497171-32497193 AAGAGAAAACAGCTGGGTCCAGG + Intergenic
1165034623 19:33023805-33023827 AAAAGAAAACAGAAGAGCGCAGG + Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166024553 19:40069301-40069323 GAGAGAAAACAAGAGGGTGAGGG + Intronic
1166424140 19:42661222-42661244 CAGAGAAAACAACTGGGTGGTGG + Intronic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
1167001910 19:46750494-46750516 CAGAGAGATAAGAAGGATGCAGG - Intronic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168642670 19:58040441-58040463 CAGAGATACCAGAACTGTGCGGG - Exonic
1168677318 19:58288187-58288209 AAGAGAATAAAGAAGGGTGTGGG - Intronic
925055428 2:853525-853547 GAGAGAGAAGAGAAGGGTGAAGG - Intergenic
928415479 2:31088133-31088155 CAGAGAAAAAAGAGGGGCACAGG + Intronic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930791909 2:55341441-55341463 CAGAAAAAAAAAAAGGGGGCGGG - Intronic
930882803 2:56291453-56291475 CAGAGAAAATAGCAGTGTGGGGG + Intronic
930924634 2:56802257-56802279 CAGAGACAACTGCAGGGTTCTGG - Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931195969 2:60052632-60052654 CAGATAGAACAATAGGGTGCAGG - Intergenic
932196783 2:69790740-69790762 CAGAGAAAACAGAAAGGCATCGG - Intronic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
934783000 2:96984813-96984835 CATAAACAACAAAAGGGTGCAGG + Intronic
936866493 2:117080651-117080673 CAGAGATAACAGTATAGTGCAGG + Intergenic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938833352 2:135074540-135074562 CAGAGACAACTGAAGGTTCCTGG - Intronic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939441864 2:142260485-142260507 CACAGAGAAGAGAAAGGTGCTGG - Intergenic
940033977 2:149293992-149294014 AAGAGAAAACAGAATGTTTCTGG + Intergenic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
941959731 2:171241740-171241762 AAGAGAAAAAAGGAGGGTGAGGG - Intergenic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944285193 2:197941737-197941759 GAGAGAAAGCAGAATGGTGAGGG - Intronic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944866536 2:203868004-203868026 AAGAAAAAACAGGAGAGTGCAGG - Exonic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
945959152 2:216114282-216114304 CAGAAGAAACAGAAGTGTCCAGG - Intronic
946307940 2:218866488-218866510 CAGGACAAACAGTAGGGTGCAGG - Intronic
947374285 2:229480064-229480086 CAGAAAAAATAGAAGAATGCAGG + Intronic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
948257270 2:236577461-236577483 CTGAGAATACTGAAGGCTGCTGG + Intronic
948889170 2:240898448-240898470 CAGAGAAACCAGACGTGTCCTGG + Intergenic
1169842965 20:9960151-9960173 CAGTGAAAACAGGAAGGTCCAGG - Intergenic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1172766875 20:37355752-37355774 GAGAAAAAAAAGAAGGGTGAGGG + Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173197317 20:40926428-40926450 CAGGGAAAAAGGAAGAGTGCTGG + Intergenic
1173507319 20:43598257-43598279 GACAGAAAATAGAAGGGTGGTGG + Intronic
1174294626 20:49536879-49536901 CAGAGAAAACACACAGATGCTGG + Intronic
1174398376 20:50261771-50261793 CAAACGAAACAGAAGGGTCCTGG - Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174543181 20:51305739-51305761 CAGAGATAACACAAAGGTGGGGG + Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1175475559 20:59271388-59271410 CAGAGAACCCAGAACAGTGCTGG + Intergenic
1175819794 20:61902632-61902654 CAGACAAAACAGAAGCGAGTGGG + Intronic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1177078411 21:16607713-16607735 CAGAGAAAACACAAGGGCTAAGG - Intergenic
1177296395 21:19181779-19181801 CAGGGAACCCAGGAGGGTGCTGG - Intergenic
1177500626 21:21950062-21950084 CAGACAAAACAAAAAGGTGGAGG - Intergenic
1177503684 21:21993483-21993505 CAGAGAAAACAGAATTATACAGG - Intergenic
1177833473 21:26166292-26166314 CACAGAAGACAGAAGGTGGCAGG - Intronic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178106095 21:29320912-29320934 CTGAGCAAACAGATGGGAGCAGG - Intronic
1179253644 21:39696719-39696741 CAGAGAAACAAGAAGGGAGGAGG - Intergenic
1179677815 21:42996333-42996355 AAGAGGAAACATCAGGGTGCAGG + Intronic
1180130751 21:45825464-45825486 GGGACAAGACAGAAGGGTGCTGG - Intronic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181778084 22:25174293-25174315 CAGAGAAGACAAACGGCTGCTGG - Exonic
1181862622 22:25830647-25830669 GAGAGCAAACAGAAGCGTGCAGG + Intronic
1182880011 22:33725108-33725130 AAGAGAAGACACAAGGGTGGGGG + Intronic
1183071224 22:35397837-35397859 CTGAGAAAACTCAAGGCTGCTGG - Intergenic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
1185059537 22:48599065-48599087 CAGTGAACGCAGGAGGGTGCTGG - Intronic
1185211692 22:49574184-49574206 CAGAGAAAACTGGAGAGTGATGG + Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949185849 3:1190657-1190679 AAGAGAAAGCAGAATGGTACAGG + Intronic
949231889 3:1759459-1759481 AATAGAAAACAAAAAGGTGCAGG + Intergenic
949449131 3:4166106-4166128 AAGAGGAAAGACAAGGGTGCAGG - Intronic
949478925 3:4474816-4474838 AAGAGAAAAAATAAGTGTGCAGG - Intergenic
949748020 3:7317568-7317590 TAGAGAAAACAGATTGGTTCTGG + Intronic
951601573 3:24381811-24381833 CAGAGAAAACAAAAAGGTCTCGG + Intronic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
952600562 3:35076451-35076473 CAAACAAAACAGAATGGTACTGG + Intergenic
953412799 3:42699703-42699725 CAGAGAGCAGAGAAGGGTTCGGG + Intronic
953557208 3:43955777-43955799 TGGAGAAAACAGAAGGGCTCAGG + Intergenic
953668017 3:44940012-44940034 CACAGAGGCCAGAAGGGTGCTGG + Intronic
953831599 3:46302047-46302069 CAAAGAAACAACAAGGGTGCCGG - Intergenic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954363665 3:50135229-50135251 GAGAGAGACCAGAAGGGCGCAGG + Intergenic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
956105917 3:65818808-65818830 CAGAGAAGACTGGAGCGTGCAGG + Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
958687553 3:97419326-97419348 CAAACAAAACAGAAGGGGTCAGG + Intronic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
963073315 3:141323019-141323041 CAGACAAAACAGAAGGGTACAGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964479625 3:157128461-157128483 CAGAGATAACAGAGTGGTCCAGG + Intergenic
965389561 3:168088707-168088729 GAGAGAAACCAGAAGAGGGCAGG - Intronic
965529606 3:169757899-169757921 CAGAGGACACGGCAGGGTGCGGG + Intergenic
966016742 3:175148816-175148838 CAAACAAAACAGAATGGTACTGG - Intronic
966316869 3:178657166-178657188 CAGGGAAAACATATGGGTTCTGG - Intronic
967189500 3:186973330-186973352 CTCAGAAAACAGAAGAGGGCCGG - Intronic
967422781 3:189292539-189292561 CAGAAATAACAGAAGGATCCTGG + Intronic
967574767 3:191077058-191077080 CATAGAATACAGATGGGTGGGGG - Intergenic
968897103 4:3410819-3410841 AAAGGAAAACAGAAGGGTACAGG - Intronic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
969296478 4:6273132-6273154 CAGAGAGAACAGAATGGGGGTGG + Intronic
969321829 4:6417226-6417248 AAGAGAAAAGGGAAGGGTCCAGG + Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969948061 4:10805223-10805245 CAGACAGAACAGAAAGGTGGAGG + Intergenic
969976880 4:11112086-11112108 CAGAGGAAACAGATGGCTGTTGG - Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970110110 4:12628301-12628323 AAAAGAAAACAGGAGGGAGCAGG - Intergenic
971466731 4:26971618-26971640 TAGCCAAAACAGAAGGGTACTGG - Intronic
971841962 4:31864242-31864264 CACAGAAACCAAAAGGGAGCAGG + Intergenic
972913972 4:43853140-43853162 CAGAGACAATAGAAGTGTGTGGG + Intergenic
972998577 4:44915892-44915914 AAGAAACAACAGAAGGGTGATGG - Intergenic
973174129 4:47183489-47183511 TCCAGAAGACAGAAGGGTGCTGG - Intronic
973966437 4:56167298-56167320 AAGAGAAAACAGAAATGTGTAGG + Intergenic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
979295425 4:119027247-119027269 GGCAGAAGACAGAAGGGTGCAGG + Exonic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983222936 4:165060105-165060127 AAGAGAAAACAAAAGGTTCCTGG + Intergenic
983813101 4:172088806-172088828 CAGAGATAACAGCAGGGTAGGGG + Intronic
983998243 4:174211903-174211925 CAGATCAAACAGCAGGGAGCTGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
986023669 5:3829008-3829030 GAGAGAAAACAGCAGGGGGCAGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
987374435 5:17219759-17219781 CAGAGAAAACAGAAAGGGTTAGG - Intronic
988009388 5:25463207-25463229 CAGAGATCACATAAGGGTGTAGG + Intergenic
988140548 5:27233521-27233543 CAAAATAAACATAAGGGTGCGGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989419154 5:41215667-41215689 GTAAAAAAACAGAAGGGTGCAGG + Intronic
989995415 5:50823489-50823511 CAGATAATACAGAAAGGTACTGG - Intronic
990412743 5:55557284-55557306 CATAAAAAACAGAATGGGGCTGG - Intergenic
991001989 5:61792128-61792150 CAGAAAAAAGAGATGAGTGCTGG + Intergenic
991660941 5:68950066-68950088 CAGAGAATACATAAGTGTTCTGG + Intergenic
992632324 5:78693933-78693955 CAGAGAAAGCAAAATAGTGCGGG + Intronic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
994888047 5:105592012-105592034 CAGAGGACAAAGAAGGGTACAGG - Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995449666 5:112286697-112286719 GAAAGAGAACAGAAGGTTGCTGG - Intronic
995843016 5:116462618-116462640 CAAAGAAATCAGAAGGGCACTGG + Intronic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
999169336 5:149580355-149580377 AAGAGAAAAACCAAGGGTGCCGG - Intronic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1001742866 5:174068242-174068264 AAGAGAGAAAAGAAGGGAGCAGG + Intronic
1002759690 6:191933-191955 CCCAGAAGACAGAGGGGTGCTGG + Intergenic
1004601417 6:17153970-17153992 CAGAGAAAGCAGAAGCGTTTGGG - Intergenic
1004943333 6:20584953-20584975 CAGAGAAAGCAGAAAACTGCAGG - Intronic
1005391412 6:25337616-25337638 TAGAGAAAACACAAGTGTGAAGG + Intronic
1005602489 6:27442125-27442147 CTGAGAAAATAGAAGGGCACGGG - Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1009423707 6:63491147-63491169 CATAGAGAAGAGAAAGGTGCTGG - Intergenic
1011512064 6:88112437-88112459 CTGAGACAACAGAAGGGTTTTGG - Intergenic
1011757987 6:90525177-90525199 CAGAGAAAACAGAAAGTTAAAGG + Intronic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1014488214 6:122027890-122027912 CAGACAGAACAGAAGTGAGCAGG + Intergenic
1014952051 6:127567890-127567912 CAGAGATAAAAGAATGGGGCAGG + Intronic
1015276570 6:131388544-131388566 CAGAGAAAACAGAAGTCCTCGGG + Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018716612 6:166537884-166537906 CAGAGAAATCAGCATTGTGCTGG + Intronic
1019388432 7:771707-771729 CAGATAACACAGCAGGGTCCAGG + Intronic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020913195 7:14159246-14159268 CAGAGAAAACAGTACAGTGTGGG - Intronic
1021536007 7:21705434-21705456 CAGAGCAAACAGCTGGTTGCTGG - Intronic
1022095142 7:27135705-27135727 CAAAGGCAACAGAATGGTGCAGG - Intronic
1022321487 7:29292173-29292195 CAGAGAAGAATTAAGGGTGCTGG - Intronic
1022493387 7:30837758-30837780 CAGAGAAAACAGGAGGGCCCAGG + Intronic
1024088195 7:45914635-45914657 CAGAGCCCTCAGAAGGGTGCAGG - Intronic
1024185485 7:46944335-46944357 CAGTGGAAACAGAAGTGAGCAGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024508130 7:50180571-50180593 GAGAGAAAAAAAAAGAGTGCAGG - Intergenic
1024532481 7:50405412-50405434 CAGAGAAGACAGATCTGTGCAGG - Intergenic
1024944102 7:54791761-54791783 AAGAAAATACAGAATGGTGCAGG - Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1027416621 7:77980925-77980947 TTTAGAAAACAGAGGGGTGCTGG + Intergenic
1028150207 7:87363556-87363578 CAGAGTACACAGGAGGGAGCTGG + Intronic
1028492512 7:91427974-91427996 GAGAGAAAACATAAGGTGGCTGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030329083 7:108253854-108253876 CAGGGATGACAGAAGGTTGCTGG + Intronic
1030923642 7:115423677-115423699 CACAGAAGTCAGATGGGTGCTGG - Intergenic
1031862638 7:126999024-126999046 CAAATAAAACAGCAGGGTGCTGG + Intronic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032284204 7:130528566-130528588 GAGAGAATGCAGGAGGGTGCAGG + Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1032759053 7:134920928-134920950 CAGAGAAAACAAAAGGCTCAAGG - Intronic
1032851298 7:135797851-135797873 TAAAGAAAACTGAAGGGTTCTGG - Intergenic
1033551488 7:142451871-142451893 GAGAGAAAACATGAGGGTGGGGG - Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034449601 7:151130174-151130196 CACATAAAACAGAAAGGAGCAGG - Intronic
1035073013 7:156158592-156158614 GCGAGAAGACAGAAGGCTGCAGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1038423616 8:27450924-27450946 AAGAGGACACAGATGGGTGCAGG - Intronic
1040737449 8:50526167-50526189 CAGAGAACACAGAAGAGTTCAGG - Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041940564 8:63382532-63382554 AGGAGAAAAATGAAGGGTGCAGG + Intergenic
1042472611 8:69208714-69208736 CTGAGAAATCTGAAGGGAGCTGG - Intergenic
1044609767 8:94080133-94080155 CAGAGAAGCCAGAATGGTGTTGG + Intergenic
1044855369 8:96469907-96469929 CAGAAAAAATAGAAAGGTGGTGG - Intergenic
1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG + Intergenic
1046137359 8:110045967-110045989 CAGAGAAAAAAGAATGGTTCTGG + Intergenic
1047255807 8:123212690-123212712 CAGGGGAAAGAGAATGGTGCTGG + Intergenic
1047498959 8:125428075-125428097 CAGAGAAACTACAAGGGTGGTGG - Intergenic
1047520923 8:125594792-125594814 CAGATTAAATAGAAGAGTGCTGG + Intergenic
1048456614 8:134584247-134584269 CAGAGAAAGCTGCAGGGTGGAGG - Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1049051594 8:140201214-140201236 AAGAGAAAACAGAAACCTGCGGG + Intronic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1051923070 9:22290656-22290678 CAGAGAGAACAAAAAGGTGAAGG - Intergenic
1055416113 9:76085272-76085294 CAGAACAAACAGCAGGGTTCAGG - Intronic
1056226304 9:84498704-84498726 CAGAGAAAACAGCAGAGTTCAGG + Intergenic
1056282511 9:85055689-85055711 CAGAGGCATCAGAAGGGTTCAGG + Intergenic
1057060451 9:91999342-91999364 CTGAGAAATCAGGAGGCTGCTGG - Intergenic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1057719164 9:97518418-97518440 CAGAAACAACAGAAGTGTGTTGG - Intronic
1058565714 9:106283008-106283030 TAGAGAAAGCTAAAGGGTGCTGG - Intergenic
1058934052 9:109751373-109751395 CTGAGAAAACTGAAGTGAGCAGG - Intronic
1059192728 9:112342193-112342215 CTGAGAAACTAGAAGGCTGCTGG - Intergenic
1059282329 9:113145562-113145584 CAGAGAGAACAGAAGGGACAGGG + Intergenic
1059569771 9:115422372-115422394 AAGAGAAATCAGAATGGTACAGG - Intergenic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060540486 9:124426820-124426842 CAGAGGGGACAGAAGGGTTCTGG - Intergenic
1060747076 9:126144636-126144658 CACAAAAAAAAGAAGGCTGCAGG + Intergenic
1062111273 9:134783321-134783343 CAGAGAAAGCCGGTGGGTGCTGG + Intronic
1062113828 9:134796965-134796987 CAGAGAAAACAGGCGGGTTTTGG - Intronic
1062306765 9:135911777-135911799 AAGAGAAGGCAGCAGGGTGCAGG + Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1185865564 X:3620767-3620789 CAGTGATAACTGAAGGGTGCAGG + Intronic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1187764711 X:22628411-22628433 GAGAAGAAACAGAAGGGTTCAGG - Intergenic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1188595319 X:31893408-31893430 CAGACAAAACTGTAGGGTTCTGG - Intronic
1188767404 X:34112441-34112463 CAGAGATAACGGAGGGGTGGGGG - Intergenic
1189722540 X:43934763-43934785 AAAAGAAAAGAGAAGGCTGCAGG - Intergenic
1189857548 X:45238455-45238477 GAGAGGAAACAGAACGGGGCAGG + Intergenic
1191625946 X:63271688-63271710 CAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1191644344 X:63464130-63464152 AAGAGAAAACAGAAAAATGCAGG - Intergenic
1193046057 X:77055704-77055726 TAGAAAAAACACTAGGGTGCAGG + Intergenic
1193575440 X:83189987-83190009 AACAGAAAACAAAAGGGAGCAGG - Intergenic
1194296979 X:92138052-92138074 CAGTGAGAACACATGGGTGCAGG - Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199784067 X:151088639-151088661 AAGACAAACCAGAAGAGTGCTGG - Intergenic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1200614490 Y:5362627-5362649 CAGTGAGAACACATGGGTGCAGG - Intronic
1200798137 Y:7360708-7360730 CAGTGATAGCTGAAGGGTGCAGG - Intergenic
1201011534 Y:9551754-9551776 CAAAGAAAATAAAAGGGTCCTGG - Intergenic