ID: 1119783733

View in Genome Browser
Species Human (GRCh38)
Location 14:77297043-77297065
Sequence TGGTGGGAATGGTGGGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 0, 3: 52, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119783725_1119783733 4 Left 1119783725 14:77297016-77297038 CCCACAAAGGCGTGACAATGTGT 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG 0: 1
1: 0
2: 0
3: 52
4: 422
1119783726_1119783733 3 Left 1119783726 14:77297017-77297039 CCACAAAGGCGTGACAATGTGTG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG 0: 1
1: 0
2: 0
3: 52
4: 422
1119783724_1119783733 5 Left 1119783724 14:77297015-77297037 CCCCACAAAGGCGTGACAATGTG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG 0: 1
1: 0
2: 0
3: 52
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119783733 Original CRISPR TGGTGGGAATGGTGGGAACT CGG Intronic
900229936 1:1551628-1551650 TGGTGGGCAGGATGGGAGCTCGG - Intronic
901950371 1:12740599-12740621 TGGAGGCAATGGTGCGATCTCGG + Intergenic
902336690 1:15758526-15758548 GGGTGGGAATGGGGGGGAATGGG - Intronic
902542737 1:17166211-17166233 TGGTGGGCATGGTGGGTGGTGGG - Intergenic
902609179 1:17587367-17587389 AGGTGGGCATGGCTGGAACTGGG - Intronic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
903609239 1:24597966-24597988 TGGTGGGGGTGGGGGGAACTTGG + Intronic
904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG + Intergenic
904590561 1:31613020-31613042 TGGTGGGAAAGGTGGGGAGCTGG - Intergenic
904622463 1:31783594-31783616 TGGTGGAAATGGCCTGAACTTGG + Intergenic
904947833 1:34212449-34212471 TGGTGGGAACGGGGGCAAGTTGG + Intronic
905278862 1:36836240-36836262 TGGTGGACATGGTGGGCACTGGG + Intronic
905901080 1:41582299-41582321 AGGTGGGGGTGATGGGAACTGGG + Exonic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
907212550 1:52835992-52836014 TGGAGGCAGTGGTGGGATCTTGG - Intergenic
907654177 1:56325459-56325481 TGGTGGGACTGATTGGATCTTGG - Intergenic
908883933 1:68765947-68765969 TGGGGGGAAGGGTGGGAGCGGGG + Intergenic
909094831 1:71273635-71273657 TGGAGGGAATGGTGAGAAAAAGG + Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
912491614 1:110065661-110065683 TGATGGGAATGATGGGGACAGGG - Intronic
912583082 1:110737578-110737600 TGGTGGGAATATTGGGAAGCTGG + Intergenic
912972342 1:114295321-114295343 TGGTGGGAGTGGGCGGGACTTGG - Intergenic
913324621 1:117615862-117615884 TGGTGTGTATGGTGGGGACGGGG + Intronic
915084017 1:153372243-153372265 TGGTGGTAATGGTGGTGACAAGG - Intergenic
915356297 1:155256861-155256883 TGATGGGAAGGGTAGGAACAGGG - Intronic
915471261 1:156126985-156127007 AGCTGGGAAGGGTGGGAACCTGG - Intronic
916530397 1:165651270-165651292 TGGTTGGAATGGTGGGATTTCGG + Intronic
916859388 1:168786614-168786636 TTGTGGGAATTGTGGTAAGTTGG + Intergenic
917986575 1:180326291-180326313 TGGTGGTGGTGGTGGCAACTGGG - Intronic
918365247 1:183801108-183801130 TGGTGAGAATGGGGAGAAATTGG - Intronic
920565199 1:206967484-206967506 TAGTTGGAATTGTGGGACCTTGG + Intronic
920711590 1:208300560-208300582 TGGTGTGAATGGGTGGAACTTGG + Intergenic
920862119 1:209718584-209718606 TGGTGAGAATGTGGGGAAATTGG + Intronic
923312713 1:232751305-232751327 GGGTGGTAATGGAGTGAACTTGG - Intergenic
923768188 1:236912608-236912630 GGGGGAGAATGGTGTGAACTCGG - Intergenic
923996811 1:239504907-239504929 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
924420234 1:243902192-243902214 TGGTGGGAAAGCTAGGAATTTGG - Intergenic
1064682766 10:17828038-17828060 TGGAGGGAATGTTGGGACCATGG - Intronic
1068402751 10:56551532-56551554 TGTAGGGATTGGTGGAAACTGGG + Intergenic
1068550086 10:58397812-58397834 TGGAGGGCATGGTGTGATCTTGG + Exonic
1069558395 10:69412879-69412901 TGGTGGCAATGGTGTGATCTTGG + Intronic
1069751761 10:70749569-70749591 TGGGAGGAATGGTGTGCACTAGG + Intronic
1070754917 10:78985937-78985959 TGGTGGTAATGGTAGCACCTCGG - Intergenic
1071319545 10:84439932-84439954 GGTAGGGAATGGTGGGAAATAGG + Intronic
1071511952 10:86267627-86267649 TAGTGGGTGTGGTGGGCACTCGG - Intronic
1072771639 10:98144903-98144925 TGGAGGGAATGGTGTGAAGTTGG + Intronic
1073348472 10:102802009-102802031 TGGGGGGAAGGGTGGGAAGGTGG - Intronic
1073771832 10:106743346-106743368 TGGTGGGACTGGTGGCAGCCAGG - Intronic
1074062311 10:109978071-109978093 TGGTGGGATTGGTTGCAAATGGG - Intergenic
1074976899 10:118588331-118588353 TAGTGGAAATGGTCGGGACTAGG - Intergenic
1075104027 10:119525344-119525366 TGGAGGGAGTGTTGGGGACTGGG - Intronic
1075206516 10:120453909-120453931 TGCTGGGAGTGCTGGGACCTAGG + Intergenic
1075292783 10:121244562-121244584 TGGTGGTGGTGGTGGGAAATGGG - Intergenic
1075589578 10:123681565-123681587 AGCTGGGAATGCTGGGAGCTGGG + Intronic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1076530888 10:131143459-131143481 TGGTGGGAATTGTTGGAGCTGGG - Intronic
1077045858 11:544863-544885 TGGTGGGAGTGGGGGGACTTGGG + Intronic
1077162183 11:1118916-1118938 TGGGGAGGCTGGTGGGAACTGGG + Intergenic
1077253305 11:1570206-1570228 TGGTGGGAAGGGAGGGAACCTGG - Intronic
1078464953 11:11543467-11543489 TGGTGGGGACGGTGGGGACAGGG - Intronic
1078720613 11:13880387-13880409 TGGTGGTAAGGTTGGGAAGTTGG - Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079152921 11:17917412-17917434 AGGGGGGAAGGGTGGGAAGTGGG + Intronic
1080461551 11:32459132-32459154 TGGTGGGGCTGGTGAGATCTTGG - Intergenic
1081402763 11:42661920-42661942 TGGTGGGAGTGTTGGGACCCAGG - Intergenic
1082210239 11:49491920-49491942 TGGGGGGAGTGGTGGGAGGTGGG - Intergenic
1083253546 11:61482963-61482985 TGGTGGGGATGGTGGGGACAAGG - Intronic
1083609079 11:63996647-63996669 CGGTGAGAAGGGTGGGCACTGGG + Exonic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1084101216 11:66950981-66951003 TGGTGGGAATGGCCGTAACGTGG - Intronic
1085168550 11:74427025-74427047 TGGTGAGAATGTGGGGAAATGGG - Intergenic
1089616025 11:119695301-119695323 TGGTGGGGAGGGTGGGGACCTGG - Intronic
1089646338 11:119882282-119882304 TTTTGTGAATGGTGGGAAATAGG + Intergenic
1090095668 11:123740364-123740386 TGGTGGGAAGCGTGTGAACGCGG - Intronic
1090737958 11:129628263-129628285 TGGTGGAAATAGTAAGAACTAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1092091144 12:5804577-5804599 TGGTAGAATAGGTGGGAACTAGG - Intronic
1093069993 12:14698807-14698829 TGGTTGGAGTGGAGAGAACTAGG + Intergenic
1093390602 12:18615114-18615136 TGGGGGGAAGGGTGGGAAGTGGG - Intronic
1094321456 12:29188546-29188568 TGCTAACAATGGTGGGAACTGGG - Intronic
1094385409 12:29888667-29888689 TTCTGGGACTGGTGGGGACTTGG - Intergenic
1095260845 12:40097734-40097756 TGGTGGGAATATTGAGAAATTGG + Intronic
1097172545 12:57125487-57125509 TGTTGGGATTGTTGGGCACTTGG - Intronic
1100065961 12:90645579-90645601 TGGTGGGAACTGTGGCAACCTGG - Intergenic
1100800237 12:98223139-98223161 TGGTGGGATTGCTGGGCACTTGG - Intergenic
1101723277 12:107369446-107369468 TGGAGTGAATGGTGTGATCTTGG + Intronic
1102413336 12:112739244-112739266 TGATGGCAATGGTAGGAATTAGG + Intronic
1102422352 12:112814001-112814023 TGGTGGGTATGGAGTAAACTAGG + Intronic
1102531958 12:113553277-113553299 TGGAGAGAATGGAGGGAACCAGG + Intergenic
1102740051 12:115199082-115199104 TGGGGGCAAGGGAGGGAACTTGG + Intergenic
1103438463 12:120945302-120945324 TGGAGGCAATGGTGTGATCTTGG + Intergenic
1103490921 12:121319281-121319303 TGGAGGCAATGGTGCGATCTTGG + Intronic
1103600288 12:122050502-122050524 TGGTGGGCATGCTGGGATCACGG - Intronic
1103724926 12:122992726-122992748 GGGTGGGAAATTTGGGAACTGGG + Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1104245135 12:127032362-127032384 TGGTGGGGATTGTGGTAACATGG - Intergenic
1104371290 12:128225972-128225994 TGGTGGGGATGGTGGCACGTTGG - Intergenic
1104610231 12:130221483-130221505 TGATGGGAATGGTGGGGGGTGGG - Intergenic
1104919767 12:132284788-132284810 TTGTGGGAAGGGTGTGAAGTGGG + Intronic
1104932906 12:132349303-132349325 GGATGGGAATTGTGGGAAATTGG - Intergenic
1105519853 13:21122468-21122490 TGGTGGGAATGGTGCCTACTGGG - Intergenic
1106912046 13:34473208-34473230 ACCTGGGAATGGTGTGAACTCGG - Intergenic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107756595 13:43630087-43630109 TGGTGAGAATGGTGGGATTAGGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108442107 13:50465213-50465235 TGGTGGGAGTGGGGTGAACCGGG + Intronic
1108798579 13:54065056-54065078 TGGGGAGAATGGTGGGAATGGGG - Intergenic
1109149192 13:58823603-58823625 TTCTGGGAAAGGTGGGGACTTGG - Intergenic
1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG + Intronic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112361887 13:98726042-98726064 AGTTGGGAATGGTGGAATCTGGG - Intronic
1112610620 13:100951423-100951445 TGGTGGCAATGGTGGGAGAGAGG + Intergenic
1113210716 13:107976762-107976784 TGTTGAGATTGGTGGGATCTAGG - Intergenic
1114519818 14:23326034-23326056 TGGAGGGAATGGGAGGAAGTGGG + Exonic
1114665500 14:24375162-24375184 AGGTGGGAGTGGTGGGTTCTGGG + Intronic
1116271749 14:42779376-42779398 TGGTGGCAATGTTGGGATGTGGG - Intergenic
1116855204 14:49945964-49945986 TGGTGGGATTGGGGTGCACTGGG + Intergenic
1117226674 14:53668204-53668226 TGTTGGAAATGGTGGGAGATTGG + Intergenic
1117418413 14:55519316-55519338 TGGTGGTGATGGTGGCCACTGGG + Intergenic
1117715352 14:58574499-58574521 TGTTGGGAAAGGTGGGCAGTGGG + Intergenic
1118973616 14:70658074-70658096 TGGTGGTAATGGTGGAAACCCGG - Intronic
1119780984 14:77276737-77276759 TGGGGGGCATGGTGGGAGCCAGG + Exonic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120665628 14:87303289-87303311 GGTTGGGAAAGGTGGGAAATAGG + Intergenic
1121299556 14:92859688-92859710 TGGAGGGCATGGTGTGATCTCGG + Intergenic
1121538603 14:94708315-94708337 TGATGGGAATGTTGGGTAGTAGG + Intergenic
1121715895 14:96074022-96074044 TGTTGGGAAGGGTGGGAAGAGGG + Intronic
1121943541 14:98096374-98096396 TGGGGGGAATAGTGGGAAAGGGG - Intergenic
1122737226 14:103849699-103849721 TGTTGGGAATGGTGGGGGCGTGG - Intergenic
1123195148 14:106609198-106609220 TGGTGGGAAGGGTGGAGACATGG + Intergenic
1123433437 15:20237494-20237516 CGGTGGCAGTGGTGGGAGCTTGG - Intergenic
1124817423 15:33009232-33009254 TAGTGGAGATGGTGGTAACTTGG - Intronic
1125034264 15:35106009-35106031 TGGTGGGAACTGTGGGGAATAGG + Intergenic
1125360595 15:38860586-38860608 TGCTGGGGATTGTGGGAACTTGG - Intergenic
1125436169 15:39647096-39647118 TGGTGAGACTGGTAGGAAATGGG + Intronic
1125514730 15:40311702-40311724 TGGAGGCAATGGTGTGAACTTGG - Intergenic
1126062181 15:44793293-44793315 TGGTGAGAATGTGGGGAAATGGG + Intergenic
1128493317 15:68172665-68172687 TGGTGGCCATTGTGGGATCTGGG + Intronic
1128685735 15:69684166-69684188 TGGTGAGAATGCTGGGGACCAGG - Intergenic
1129712046 15:77825419-77825441 TGGTGGGAATTTGGGGACCTGGG + Intergenic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1130991970 15:88880933-88880955 CGATGGGAGTGGTGGGGACTGGG - Intronic
1132295025 15:100728564-100728586 TGGTGGGAAGGGTCTGGACTGGG - Intergenic
1132394783 15:101464654-101464676 TGCTGGGAATGCAGGGAAATGGG + Intronic
1132936325 16:2483121-2483143 TGGTGGGAATGCAGAGAGCTGGG + Intronic
1134252611 16:12585070-12585092 TGTTGGGTATTGTGGGAAGTCGG - Intergenic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1134465057 16:14468363-14468385 TGGTGGGAAAGGTGGACAGTCGG + Intronic
1134915024 16:18062196-18062218 AGGTGGGATTGGTAGGAAATAGG + Intergenic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136511444 16:30740164-30740186 TGGAGGGTTGGGTGGGAACTTGG + Exonic
1136851189 16:33613634-33613656 TGGCGGCAGTGGTGGGAGCTTGG + Intergenic
1138460101 16:57143006-57143028 AGGTGGGAATGCTGGGGACAGGG + Intronic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1140045787 16:71439731-71439753 TGGTGAGAATGTGGGGAAATTGG + Intergenic
1141421483 16:83920675-83920697 AGGTGTGAAAGGTGGGAACTAGG - Exonic
1141530008 16:84639754-84639776 TGCAGGGAATGGTGGGAAATGGG - Intergenic
1203112792 16_KI270728v1_random:1462095-1462117 TGGCGGCAGTGGTGGGAGCTTGG + Intergenic
1142811172 17:2396294-2396316 TGGTGGGGATGTTGGGGATTTGG - Intronic
1143316009 17:6033963-6033985 TGGTGGTAGTGGAGGGAATTGGG + Intronic
1143544211 17:7587007-7587029 TGGTGGGGAGGGTGGGTACCAGG + Exonic
1143552934 17:7642348-7642370 TGGTGGGAAAGGTGGGCTCCAGG + Intergenic
1146063507 17:29618998-29619020 TGGTGGCAAAGGTGGGACCCAGG - Intronic
1149364898 17:55933535-55933557 TGCTGGGAATGGTGGAATATAGG + Intergenic
1149409888 17:56394559-56394581 TGGTGGGGATGGCGGTAGCTGGG - Intronic
1149850002 17:60028545-60028567 TGGAGGCACTGGTGGGAACCCGG + Intergenic
1149860165 17:60117979-60118001 TGGAGGCACTGGTGGGAACCCGG - Intergenic
1149881206 17:60292913-60292935 TAGTTGGAATGGTGTGAACAAGG - Intronic
1150352615 17:64457756-64457778 AGGTGGCCATGGTGGGAAATGGG - Intronic
1151161791 17:72172166-72172188 TGATAGGAAAGCTGGGAACTGGG - Intergenic
1151212551 17:72555346-72555368 TCTTGGGTATGGTGAGAACTAGG - Intergenic
1152545001 17:80995936-80995958 GGCTGGGAACTGTGGGAACTGGG + Intronic
1153049642 18:889670-889692 TGGTGGGAATGGAGAGAGTTGGG + Intergenic
1153709271 18:7781595-7781617 TGGGGGGAATGGTGGGACAGGGG - Intronic
1153996296 18:10444849-10444871 TGGAGGGAGTGGTGGAGACTTGG - Intergenic
1155878362 18:31114144-31114166 TGATGGAAATGGTGAGAATTGGG - Intergenic
1156435537 18:37124428-37124450 GGGTGGGAATGGCGGTAGCTTGG - Intronic
1157525124 18:48374815-48374837 TGGTGGGAGAGGTGGGTACAGGG - Intronic
1157915785 18:51662554-51662576 TTCTGGAAATGGTGGGGACTGGG + Intergenic
1158196335 18:54889353-54889375 TGGTGGAAATTCTGGAAACTTGG + Exonic
1158582258 18:58694051-58694073 TGGTAGGAAAGGTGGAAAATGGG - Intronic
1158595711 18:58814144-58814166 TGGTGAGGATGTTGGGAAATTGG + Intergenic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1159887914 18:73927090-73927112 TGGTGGGAAGGGTGGCAAAGGGG + Intergenic
1159949282 18:74468652-74468674 TGGAGGAGATGGAGGGAACTGGG + Intergenic
1160034047 18:75285158-75285180 TGGTGGGAAGGGCAGGAACTTGG - Intronic
1160036395 18:75305293-75305315 TTCTGGGAAGGGTGTGAACTCGG - Intergenic
1160058615 18:75509545-75509567 AGTTGGGAATGGTGGGAGCGAGG + Intergenic
1160975109 19:1789276-1789298 TGGTGGGACTGGGGGGACCTGGG - Intronic
1161321953 19:3645476-3645498 TGGTGGGGAAGGTGGGGACTCGG - Intronic
1161556725 19:4946963-4946985 TGGTGAGAATGTGGGGAAATTGG - Intronic
1162161923 19:8724589-8724611 TGGTGGGAATGGAGGTGGCTGGG - Intergenic
1162629312 19:11914263-11914285 TGGAGTGAATGGTGTGACCTCGG - Exonic
1163015281 19:14450870-14450892 TGGTGGGAAGTGTGGGGGCTGGG - Intronic
1163463683 19:17454553-17454575 TGCAGGGAAGGGTGGGAGCTAGG - Intronic
1164458863 19:28430824-28430846 AGCAGGGAGTGGTGGGAACTGGG - Intergenic
1164581935 19:29440023-29440045 AGGTGGGAAGTGCGGGAACTGGG + Intergenic
1164738264 19:30558395-30558417 TGGTGGGGGTGGAGGGTACTTGG + Intronic
1165029643 19:32988558-32988580 TGGCGGCAATGGTGGGAGCTTGG - Intronic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1165966180 19:39582800-39582822 TGGTGGGGATCTTGGGGACTGGG + Intergenic
1165971838 19:39638274-39638296 TGGTGGGGATCTTGGGGACTGGG + Intergenic
1166593920 19:44027620-44027642 GGGTGGGAAGGGTGGGAGCAGGG - Intronic
1167506255 19:49872682-49872704 TGCTGGGAGTGGTGGGCACAAGG - Intronic
1168301242 19:55406483-55406505 TGGTGGGAATGGTGTCAGCAAGG - Intronic
925368417 2:3326446-3326468 AGGTGGGCATGGTGGGAGCAGGG - Intronic
925445539 2:3923862-3923884 TGGTGGGGGTGGAGGGATCTGGG + Intergenic
926861476 2:17314766-17314788 TGGTAGGAATGGTGGTCACTGGG - Intergenic
926940587 2:18132040-18132062 AGGTGGGAATGGGGAGAATTTGG + Intronic
927307700 2:21592389-21592411 TGGTGAGAAGTGGGGGAACTGGG + Intergenic
928013113 2:27629129-27629151 TGTTGGGAATGGCGGGATCCGGG + Exonic
928139806 2:28718553-28718575 AGGTGTGAAGAGTGGGAACTGGG + Intergenic
930370596 2:50496385-50496407 TGGAGGGAATTGTGGAAACAGGG - Intronic
931428503 2:62192098-62192120 TGGAGTGCATGGTGTGAACTCGG + Intergenic
931583407 2:63801763-63801785 TTCTGGGTAGGGTGGGAACTTGG - Intronic
933656983 2:84896665-84896687 TGGTGAGAATGCTGGGAAACTGG + Intronic
933763146 2:85687856-85687878 TGGTGTGAGTGGTGTGATCTTGG - Intronic
936111077 2:109665391-109665413 GGAGGGGAATGGTGGGATCTTGG + Intergenic
937988490 2:127649414-127649436 GGGTGGGGATGGTGGATACTGGG + Intronic
938556799 2:132431778-132431800 TGGTGGGGATGATGGCAAATGGG + Intronic
939459343 2:142479317-142479339 AGGTGAGAATGGTGTGAACCTGG - Intergenic
939723775 2:145688216-145688238 TGGTGGGGACGGTGGGGACGGGG + Intergenic
940318720 2:152351347-152351369 TGCTGGGATTGGTGGGAAAGGGG - Intronic
940691532 2:156925689-156925711 TGGTGGGAATGATTGGATCATGG - Intergenic
941565550 2:167101466-167101488 TGGGAGAAATGGTGGGAAGTGGG - Intronic
941670269 2:168285368-168285390 TGGTGGGACTGGTAGGAAATAGG + Intergenic
943662608 2:190575189-190575211 TGTTGGGGATGGTGGGAAACTGG - Intergenic
944330235 2:198457165-198457187 TGGGAGGATTGGTGGAAACTAGG - Intronic
946215731 2:218182035-218182057 TCTTGGGAAGGGTGGGAATTGGG + Intergenic
946404317 2:219484384-219484406 TGGGGGGCACCGTGGGAACTCGG - Exonic
946493426 2:220171906-220171928 TGGTGGGGATGGTGGTAAACTGG + Intergenic
948144910 2:235701395-235701417 GGGTGGGCATGGTGGCATCTTGG + Intronic
948954183 2:241273793-241273815 TGTTGAGGATGGTGGGAGCTGGG + Intronic
1170216576 20:13897991-13898013 TGGTGAGAATGGGGAGAAATAGG + Intronic
1170433414 20:16297936-16297958 TGGAGAGAATGGTGGGAGCAGGG - Intronic
1170613474 20:17931966-17931988 AGGCGGGAATGGTGTGAACCCGG + Intergenic
1170763454 20:19271822-19271844 TGGAGGGAAGGGTGGGAATGGGG + Intronic
1170975102 20:21156158-21156180 TGGTAACAATGGTGGAAACTAGG - Intronic
1171041181 20:21765150-21765172 AGGGGGAAATGGTGGGAAGTGGG - Intergenic
1171214720 20:23344056-23344078 TGGTGAGAATGTGGGGAAATTGG - Intergenic
1173208534 20:41013801-41013823 TGGAGTGAATGGTGTGATCTGGG + Intergenic
1173620423 20:44431795-44431817 TGGTGGGATTTCTGGGCACTGGG - Exonic
1174447065 20:50597531-50597553 CGGTGGGAGTGGTGGCCACTGGG + Intronic
1175381524 20:58567464-58567486 TGGTGGGAATGAAGGGGACAGGG + Intergenic
1175896110 20:62336195-62336217 TGGAGGGAGTGGTGGGATATGGG - Intronic
1175919312 20:62442617-62442639 TAGTGGGGCTGGTGGGACCTTGG + Intergenic
1177003716 21:15645115-15645137 TGGTGTGAATGGTGTGATCTTGG - Intergenic
1177233324 21:18351448-18351470 TGGTGGGAGTGATGGGATCACGG + Intronic
1178079082 21:29044350-29044372 TGGTGTGAATGGTGAGAAAGGGG - Intronic
1178239383 21:30881431-30881453 TGGTGGAAGTCGTGGTAACTTGG + Exonic
1178509948 21:33196220-33196242 TGGGGGGTATGGTGAGTACTTGG - Intergenic
1178666862 21:34555625-34555647 TGGTGGGAAGTGTGGGAAGGAGG + Intronic
1179727227 21:43347304-43347326 TGGTGGGAAAGGCGGGCCCTGGG - Intergenic
1180167612 21:46038108-46038130 TGGAGGAAGTGGTGGGAGCTGGG + Intergenic
1181688266 22:24543763-24543785 GGGTGGGAACTGTGGGCACTGGG + Intronic
1182051558 22:27316336-27316358 TGGGGTGAGTGGTGGGAACTTGG - Intergenic
1182458434 22:30467711-30467733 AGGTGTGTGTGGTGGGAACTAGG + Intronic
1182899398 22:33885421-33885443 TAGGGGGATTGGTGTGAACTTGG - Intronic
1183048981 22:35245753-35245775 TGGTGTCAATGGTGGCAACCTGG - Intergenic
1183055817 22:35304940-35304962 TGGTTGGGGTGGTGGGAGCTGGG + Intronic
1183505945 22:38208938-38208960 AGGTGGCAGTGGTGGGAAATGGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184672404 22:46021729-46021751 TGGTGGGAATGGCTGGAGTTGGG - Intergenic
1184767640 22:46579890-46579912 TAGTGGCCATGGTGGGGACTTGG + Intronic
1185164645 22:49253915-49253937 TGGTGGGAGTGCTGGCCACTGGG - Intergenic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
950337480 3:12208493-12208515 TGGTGTGTATGGTGGGAGGTAGG + Intergenic
951639890 3:24825481-24825503 TGGTGGGAATGTTTGGCCCTGGG - Intergenic
951708263 3:25565812-25565834 TGGTGGGCTTGGTGGGAAGGAGG - Intronic
952054184 3:29424464-29424486 TGGTTTGAATGGTGAGTACTGGG + Intronic
952397559 3:32934394-32934416 TGGGGGGAATGGGGGGAAAGAGG + Intergenic
952914057 3:38218247-38218269 TGGTGGGAATGTGGAGAAATTGG - Intronic
953477417 3:43217575-43217597 TGGTGGGATTGGAGGTATCTGGG - Intergenic
953707603 3:45243150-45243172 TGGTGGGAAAGGTAGGTGCTGGG + Intergenic
953950858 3:47189052-47189074 TGGAGGGAGTGGTGTGATCTCGG - Intergenic
954479271 3:50782781-50782803 TGGGGGGAAGGGTGGGAGGTGGG - Intronic
954629997 3:52042704-52042726 TGGAGTGAATGGTGCGATCTCGG - Intergenic
955412703 3:58666486-58666508 AGGTGGGGAGGGTGGGAAATAGG - Intronic
956224710 3:66944316-66944338 TGGGGGAAAGGGTGGGAAGTGGG + Intergenic
956284791 3:67597238-67597260 TGTGGGCAATGGTGGGAAGTTGG - Intronic
956299249 3:67751869-67751891 TGGGGGGAAGGGTGAGAAGTGGG + Intergenic
957201384 3:77140528-77140550 TAGTGAGTATGGTGGTAACTGGG + Intronic
958646595 3:96882498-96882520 TGGTGGGAGTGGTGAGAGGTGGG - Intronic
958809781 3:98847649-98847671 TTGTGAGAATGCTGGGCACTGGG - Intronic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
960034162 3:113086368-113086390 TGGTGGCAATGGTGGCCACAGGG - Intergenic
961009388 3:123425711-123425733 TGGGGTGAGTGGTGTGAACTGGG - Intronic
961648679 3:128406368-128406390 GGGTGGGAATGGGGAGATCTTGG + Intronic
962611163 3:137077465-137077487 TGGAGGGAATGGAGAGAAATGGG - Intergenic
963692769 3:148525460-148525482 TTCTGGGACTGGTGGGGACTTGG + Intergenic
965179537 3:165384191-165384213 TGGTGGGAGTGGTGGGAGGTTGG + Intergenic
965519099 3:169655197-169655219 TGGCGGGGATGGTGGGAAACTGG - Intronic
966600808 3:181773386-181773408 TGGTGAGAATGGTGGGAGATGGG + Intergenic
966906988 3:184533450-184533472 TGGTGGTGATGGTGGGAACCTGG + Intronic
967819084 3:193824742-193824764 TGGTGGGAATGTGAGGAACCTGG - Intergenic
968590262 4:1455146-1455168 TGGTGGGAGGGGTTGGAACATGG - Intergenic
968644905 4:1735570-1735592 TGCTGGGAATGGTGGTGTCTCGG + Intronic
968905638 4:3449436-3449458 GGCAGGGAATGGTGGGAACCAGG - Exonic
969481715 4:7449889-7449911 TGGCGGGAGAGGTGGGAGCTGGG + Intronic
970666680 4:18344387-18344409 TGGTGGGGGTAATGGGAACTTGG - Intergenic
971031770 4:22645432-22645454 TGGAAGCAATGGTGGGAACTGGG + Intergenic
971146922 4:23987574-23987596 TGGTGGGTAGGGTGGGAGTTAGG - Intergenic
972404441 4:38733185-38733207 TGGTGGTAATGGTGGGATGGTGG + Intergenic
973142058 4:46781680-46781702 GAGAGGGAATGGTGGGAACCTGG + Intronic
973788706 4:54358747-54358769 TGGTGGGAATGGAGAGTCCTAGG + Intergenic
975762548 4:77633425-77633447 TGGTGGGGATGGTGATAACCAGG - Intergenic
978092769 4:104738287-104738309 AGGTGGGAATGAGGGGGACTCGG + Intergenic
980813977 4:137919505-137919527 TGGGGGGAAGGGTGGAATCTGGG + Intergenic
981529199 4:145735484-145735506 TGGTGGGAGGGGTTGGAATTTGG + Intronic
981733934 4:147928912-147928934 TGGGGTTAATGATGGGAACTGGG - Intronic
982228384 4:153186219-153186241 TGGTCTGAGTGCTGGGAACTGGG + Intronic
982358877 4:154497317-154497339 TGGAGGGAATGGGGAGAAGTTGG - Intergenic
983383318 4:167024693-167024715 TGGCGGGAAGGGTGGGAGGTGGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984789479 4:183602206-183602228 AGCTGGGCATGGTGGCAACTTGG + Intergenic
985234078 4:187853334-187853356 TGGTGGAATTGTGGGGAACTGGG + Intergenic
985479934 5:103198-103220 TGGTGGGAGCGATGGGACCTGGG - Intergenic
985669395 5:1199903-1199925 TGGAGGGAAGGGTGGGGACTTGG - Intergenic
987291723 5:16514678-16514700 TGGGGGGAATGGTGGGAGGGAGG - Intronic
987961357 5:24813559-24813581 GGGTGGTAATGGTGGGAATAAGG + Intergenic
988373261 5:30400349-30400371 TGGTGGCAATGGCAGGAAATTGG - Intergenic
988748475 5:34169786-34169808 TGGTGAGGATGTAGGGAACTTGG + Intergenic
988995552 5:36711637-36711659 AGATGGGAATGGTTGTAACTTGG - Intergenic
989037164 5:37187160-37187182 TGGTGGAAATGGGGAGATCTTGG - Intronic
989343983 5:40408559-40408581 TGATGGGGATGGTGGGAAAGGGG - Intergenic
989745033 5:44819296-44819318 TGGTGGGAACTGTGGCAAATCGG - Intronic
990165562 5:52989596-52989618 TGGAGGGATTGGGCGGAACTAGG + Intronic
991443714 5:66678265-66678287 TGGGGGGAATGGGGAGAAGTTGG + Intronic
992590768 5:78294265-78294287 TGGTGGGAGTTGTGGGAGTTTGG - Intronic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996780606 5:127182627-127182649 TGCTGGGTCAGGTGGGAACTTGG + Intergenic
997368135 5:133338873-133338895 TGGTAGGAGTGGTGGGAAACTGG - Intronic
997590066 5:135066986-135067008 TGGTGGGAATGGAGGAAGCCAGG + Intronic
998004752 5:138649524-138649546 TGGTGGAAGGGGTGGGAAATGGG - Intronic
998025943 5:138816510-138816532 TGGTGGGAATGCAGGGAAAGGGG - Intronic
998126589 5:139627120-139627142 TGGTGGGTATGGTGTGTGCTTGG + Exonic
998203136 5:140141362-140141384 TGGTGGGTGGGGTGGGGACTGGG - Intergenic
998398093 5:141832508-141832530 TGGAGGGAAAAGTGGGAACTAGG - Intergenic
998908815 5:146935875-146935897 TGCTGGGAAAGATGAGAACTGGG - Intronic
999361818 5:150992111-150992133 TGGTGGGAGTGGTGGATTCTGGG + Intergenic
1001223149 5:169920521-169920543 TGGTGTGAATGGTGAGATCTCGG - Intronic
1001584374 5:172823443-172823465 TGTTGGGGATGGTGGGAATCAGG - Intergenic
1002429645 5:179195621-179195643 TGTTGGGAGTGGTGGGGACTCGG - Intronic
1002484292 5:179523975-179523997 TGGTGGCGAGGGAGGGAACTGGG - Intergenic
1002500282 5:179643513-179643535 TGGTGGCGAGGGAGGGAACTGGG + Intronic
1004481699 6:16025655-16025677 AGGTGGGTAGTGTGGGAACTGGG - Intergenic
1004882585 6:20023461-20023483 TTCTGGGACGGGTGGGAACTTGG + Intergenic
1005680376 6:28201038-28201060 TGGTGAGAATGTAGGGAAATTGG - Intergenic
1006523812 6:34587598-34587620 GGGTGGCCATGGTGGGAAATGGG - Exonic
1006546356 6:34785116-34785138 TGTTGGCAATGGTGCGATCTTGG - Intergenic
1008039117 6:46777155-46777177 TAATGGGAAAGGTGGTAACTGGG + Intergenic
1008780618 6:55099541-55099563 TAGTGGAAATAGTGTGAACTTGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009672953 6:66779940-66779962 TTCTGGGAAGGGTGGGGACTTGG - Intergenic
1010434183 6:75811102-75811124 TGGTGGGGGTGGTGGGGATTGGG + Intronic
1012052663 6:94362756-94362778 TGATGGGAATGGTGGGCTGTCGG - Intergenic
1013611982 6:111804285-111804307 TGGGGGAACTGGGGGGAACTGGG + Intronic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015663560 6:135602975-135602997 TCATGGAACTGGTGGGAACTGGG + Intergenic
1016750353 6:147624717-147624739 TGGGGGAAAGGGTGGGAAGTGGG + Intronic
1017648038 6:156556864-156556886 TGGTGGGATTGGAGGGACCTGGG - Intergenic
1017727223 6:157284031-157284053 TGGTGGGAATGGTGTGCTGTGGG + Intergenic
1017727234 6:157284071-157284093 TGGTGGGAATGGTGTGCTGTGGG + Intergenic
1018699697 6:166416637-166416659 TGGAGGTAATGGTGGGAGCAGGG - Intronic
1018699706 6:166416673-166416695 TGGAGGTAATGGTGGGAGCAGGG - Intronic
1018791150 6:167148732-167148754 TGGTAGGAATTGTAGGAATTGGG - Intronic
1018836602 6:167489016-167489038 TGGTGGGAATGTGGCGAAATTGG - Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1021579251 7:22135095-22135117 TGGTGGCAATGGGAGGAAGTGGG + Intronic
1023068619 7:36404387-36404409 TGGTGTGAATGATGGCAATTGGG - Intronic
1023806310 7:43875406-43875428 TGGTTCGAATGGTGGCAAGTGGG + Intronic
1026806280 7:73431122-73431144 TGGTGGCAATGGTGAGAAAATGG - Intergenic
1027052502 7:75028942-75028964 TGGTGGGAAAGGAAGGAGCTGGG + Intronic
1028505703 7:91568035-91568057 GGGTGAGATTGGTGGGAAGTGGG + Intergenic
1028760167 7:94487300-94487322 TGGTGGTGATGGTGGGGACCTGG - Intergenic
1028948969 7:96612399-96612421 TGGTGGCAAGGGTGGGATCAAGG - Intronic
1030186915 7:106772415-106772437 TGGAGGGAAGGGTGGGAGCCTGG + Intergenic
1030291952 7:107881445-107881467 TGGGGGGAATGGTGAGATGTTGG - Intergenic
1030334396 7:108308766-108308788 TGGTGGGAGTGGTGAGAAGGGGG + Intronic
1030772529 7:113491957-113491979 TGGTGTGAATGGTGTGAACCTGG - Intergenic
1031624916 7:123981492-123981514 TGATGGGGAGGGTGGTAACTGGG - Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1034131084 7:148718377-148718399 TTGTGGGGATGGTGGGAATGGGG - Intronic
1034543720 7:151776498-151776520 TGGTGGACATGGTGGGACGTTGG - Intronic
1034902112 7:154914266-154914288 TGGTGGGAATGCGGGGAGCACGG - Intergenic
1035027802 7:155837116-155837138 TGGGGGACATGGTGGGATCTGGG - Intergenic
1035399894 7:158557870-158557892 TGCTGGGAATGCTGGGAAGAGGG - Intronic
1035612838 8:979660-979682 GGGTTGGATTGGTGGAAACTAGG + Intergenic
1037178772 8:15977820-15977842 TGCTGTGAACTGTGGGAACTTGG - Intergenic
1037895038 8:22646381-22646403 TGGAGGGAAGGGTGGGATGTGGG - Intronic
1037935706 8:22913694-22913716 CGGTGTGAATGGTGGGAGTTAGG - Intronic
1037963857 8:23118371-23118393 TGGTAGGAATGAGGGAAACTAGG + Intergenic
1038027681 8:23606737-23606759 TGGGGGAAATGGCTGGAACTGGG - Intergenic
1038634423 8:29273864-29273886 TGGTGGGGGCAGTGGGAACTGGG + Intergenic
1038641682 8:29333994-29334016 GGGAGGGAATGATGGGAGCTGGG + Exonic
1039060883 8:33571286-33571308 TGGTGGGAGGGCAGGGAACTGGG - Intergenic
1039172640 8:34765832-34765854 TGGTGGGGAAGGTTGGAACGGGG + Intergenic
1042137316 8:65644783-65644805 AGGTGAGTAGGGTGGGAACTCGG + Exonic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1043238379 8:77899211-77899233 TGGTAGGAATGGTGGTCACTAGG + Intergenic
1043504611 8:80890045-80890067 TGGTGGGATTGGTTGGATTTAGG - Intergenic
1044560728 8:93609402-93609424 TGTGGGGAAAGGTGGGAACTGGG + Intergenic
1045273697 8:100682837-100682859 TGGTGGGCATGATGGTAACAGGG + Intergenic
1046098697 8:109590019-109590041 GGGAGAGAAGGGTGGGAACTAGG - Intronic
1047237486 8:123054836-123054858 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
1048528619 8:135227463-135227485 TGGAGGGAATGGTGGAGACCTGG + Intergenic
1048609191 8:136003426-136003448 GGGTGGGAATGGTGTGAAAATGG + Intergenic
1049201725 8:141343669-141343691 TGGGGGTGATGGTGGGAACCGGG + Intergenic
1049221362 8:141430249-141430271 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049221426 8:141430462-141430484 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1050255906 9:3791581-3791603 TATTGGGAAAGGTGGGAACAAGG - Intergenic
1050424145 9:5496664-5496686 TGGGAGGAATGAGGGGAACTAGG - Intergenic
1050644249 9:7702269-7702291 TGGTGGTAGTGTTGGCAACTGGG - Intergenic
1050733502 9:8736163-8736185 TGGTGGTACTGGTGGGAATTAGG + Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1053414454 9:37938257-37938279 TGGTAGGAATGGTGGGATTCAGG + Intronic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053535432 9:38920714-38920736 GTGGGAGAATGGTGGGAACTTGG + Intergenic
1053551053 9:39079822-39079844 TGTTGGGAATGGGGGAAAGTTGG - Intronic
1053815163 9:41899903-41899925 TGTTGGGAATGGGGGAAAGTTGG - Intronic
1054207652 9:62145118-62145140 GTGGGAGAATGGTGGGAACTTGG + Intergenic
1054615433 9:67287538-67287560 TGTTGGGAATGGGGGAAAGTTGG + Intergenic
1054630699 9:67443236-67443258 GTGGGAGAATGGTGGGAACTTGG - Intergenic
1055200351 9:73651075-73651097 TGAGGGGAATGGTGGGGACTGGG + Intergenic
1055309036 9:74959224-74959246 TAGTGGCAATGGTGCGATCTTGG - Intergenic
1055430081 9:76234372-76234394 AACTGGGAATGGTGGGGACTGGG - Intronic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1056850884 9:90082608-90082630 TGGATGGACTGGTGGGAACCAGG + Intergenic
1056949229 9:91028796-91028818 TGATGGGGATGGTGGGCAATAGG - Intergenic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057846935 9:98533157-98533179 TGGTGGGACAGATGGCAACTTGG - Intronic
1058216541 9:102240878-102240900 AGGTGGCCATGGTGGGACCTGGG + Intergenic
1058327156 9:103713127-103713149 TGGGGGTAATGGTGGGGGCTGGG - Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058404357 9:104655042-104655064 AGTTTGGAATGGTTGGAACTTGG - Intergenic
1059027194 9:110647906-110647928 TGATGGAAAAGGTTGGAACTAGG + Intergenic
1059469693 9:114495366-114495388 TGGTGGCAATGGTGGTGACGGGG + Intronic
1060738928 9:126084946-126084968 TCGGGGGAAAGCTGGGAACTTGG - Intergenic
1061223266 9:129264811-129264833 TGGTGGGGGTGGTGGGGAGTTGG + Intergenic
1061455592 9:130695215-130695237 TGGGGGGAATGGTGGCAACAGGG + Intronic
1062035673 9:134381537-134381559 TGGTGGAGATGGTGGGGGCTGGG + Intronic
1062099521 9:134720984-134721006 TGGTGGGTCTGGCGGGGACTGGG - Intronic
1188330599 X:28866372-28866394 TGGAGGAAATGGTGGGAAGGAGG + Intronic
1190340925 X:49294813-49294835 GGCTGAGAATGGTGTGAACTCGG + Intronic
1191950338 X:66584454-66584476 TGGTGGAAAGGGTGGGAATGGGG - Intergenic
1192473413 X:71419335-71419357 TGGTGGGAATTGGAGGAAGTGGG - Intronic
1192961461 X:76135735-76135757 GGGTGGAGAAGGTGGGAACTGGG - Intergenic
1193917161 X:87379404-87379426 TGGTGGTAATGGTGGACACAAGG + Intergenic
1194869314 X:99108224-99108246 TGGTGTGAATGGCGTGAACCTGG + Intergenic
1195112094 X:101659025-101659047 TGGGGGGATTTGTGGGAAGTGGG - Intronic
1195280626 X:103329774-103329796 TGGAGGGAATGGGGTGAATTAGG - Intergenic
1197304993 X:124830788-124830810 AGGTGGGAATGGTGGTAGATAGG - Intronic
1197350924 X:125382320-125382342 TGGTGGGAATTGTTGGATCATGG - Intergenic
1198156999 X:133970731-133970753 TGGTGGGAAGGTGGGGAACAGGG + Intronic
1198496830 X:137201742-137201764 TGCTAGCAATGGTGGGAACTTGG + Intergenic
1202192993 Y:22263072-22263094 TTCTGGGCAGGGTGGGAACTTGG - Intergenic