ID: 1119785526

View in Genome Browser
Species Human (GRCh38)
Location 14:77310755-77310777
Sequence CTAACTGGAGACTTAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119785526_1119785533 28 Left 1119785526 14:77310755-77310777 CCAAGATCTAAGTCTCCAGTTAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1119785533 14:77310806-77310828 TAATCCGAGAGCCTTCTCAGAGG 0: 1
1: 0
2: 1
3: 4
4: 73
1119785526_1119785530 4 Left 1119785526 14:77310755-77310777 CCAAGATCTAAGTCTCCAGTTAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1119785530 14:77310782-77310804 AAAGCCTTGAGTGAATTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 200
1119785526_1119785529 3 Left 1119785526 14:77310755-77310777 CCAAGATCTAAGTCTCCAGTTAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1119785529 14:77310781-77310803 GAAAGCCTTGAGTGAATTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119785526 Original CRISPR CTAACTGGAGACTTAGATCT TGG (reversed) Intronic
900891952 1:5455967-5455989 CTAAATGGAGACTTGAACCTGGG + Intergenic
908300810 1:62759435-62759457 CTTACTTGAGCCTTAGAACTGGG + Intergenic
916084063 1:161255572-161255594 CTAACCTGAGCCTTAGAACTGGG + Intergenic
918197027 1:182232272-182232294 TTCACTGGAGATTTAGATTTGGG + Intergenic
918478771 1:184954694-184954716 TGAACTGGAAACTTAAATCTTGG + Intronic
919682708 1:200452233-200452255 CTAACTGGAGCATTAAATCAGGG + Intergenic
920359027 1:205399504-205399526 CTCACTGAAGGCCTAGATCTTGG + Intronic
921634840 1:217480057-217480079 ATAGCTGGAGACTTTGGTCTGGG + Intronic
922051141 1:221991707-221991729 CCATCTGGAGACTTAGAGATTGG + Intergenic
923346128 1:233054396-233054418 CTCTGTGGAGACTTAGTTCTTGG - Exonic
1064603168 10:17013720-17013742 CTTACTCGAGCCTTAGAACTGGG - Intronic
1072031736 10:91528320-91528342 CTAGCTGGTGACCTAGTTCTGGG - Intergenic
1072101739 10:92235704-92235726 CAAAGTGGAGACTTAAATCCAGG + Intronic
1074586408 10:114771302-114771324 CTTATTTGAGACTTACATCTAGG - Intergenic
1081709087 11:45205523-45205545 CTGGCTGGAGATTTGGATCTGGG + Intronic
1083484417 11:62974459-62974481 CTTACTGGTGACTTAGAAGTGGG + Intronic
1094121221 12:26976703-26976725 CTAACAGGTGATTTAGAGCTTGG - Intronic
1096773124 12:53949192-53949214 CTGTCTGGAGACTAAGATGTGGG - Intergenic
1099021848 12:77415775-77415797 CTAACAGGAGACCCACATCTGGG - Intergenic
1099382998 12:81978531-81978553 GGGACTGGAGACTTAGATGTTGG - Intergenic
1099847999 12:88054121-88054143 CAAACTGGAAACTTAGAGTTGGG + Intronic
1100625662 12:96328779-96328801 CTAACTGGAGATTCAGACTTAGG + Intronic
1100890882 12:99124495-99124517 CTAAGTGGATACTTTCATCTAGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103824479 12:123726084-123726106 CTAACTAACTACTTAGATCTGGG - Intronic
1103903648 12:124316284-124316306 CTACCTGGGGACTCAGATCTGGG + Intergenic
1110064151 13:71081254-71081276 TTAAATGGAGATTTAGACCTTGG + Intergenic
1110149793 13:72237600-72237622 AAAACTGGAGACGTAGTTCTAGG - Intergenic
1110694463 13:78472006-78472028 CTAATTGGAGACTTAAAACCGGG - Intergenic
1110906595 13:80897686-80897708 CTTACCGGAGCCTTAGAACTGGG + Intergenic
1113977994 13:114245828-114245850 CTAACTGGAGAGTTAGATGAAGG - Intronic
1118468705 14:66055115-66055137 CTGACTGGCCACTGAGATCTGGG - Intergenic
1118518298 14:66551489-66551511 CTAGCTCAAGACTTAGATATAGG - Intronic
1119285617 14:73451934-73451956 GTAATTGAAGACTTTGATCTTGG + Intronic
1119785526 14:77310755-77310777 CTAACTGGAGACTTAGATCTTGG - Intronic
1121056213 14:90856201-90856223 CTAACTAGAGATTAAGCTCTTGG - Exonic
1124142157 15:27087091-27087113 CTGACTGGAGACTGAGAGATGGG + Intronic
1127779930 15:62303287-62303309 ATAGCTGGAGAGTTAGAGCTGGG + Intergenic
1128449315 15:67793902-67793924 CTAAAACCAGACTTAGATCTAGG + Intronic
1130580563 15:85134039-85134061 CTCACTGGTGACTTAGATGAGGG + Intronic
1134504453 16:14793607-14793629 CCATGTGGAGTCTTAGATCTTGG + Intronic
1134576118 16:15335302-15335324 CCATGTGGAGTCTTAGATCTTGG - Intergenic
1134726323 16:16421199-16421221 CCATGTGGAGTCTTAGATCTTGG + Intergenic
1134941109 16:18290660-18290682 CCATGTGGAGTCTTAGATCTTGG - Intergenic
1137067195 16:35859733-35859755 ATAACAGGAGAATTAGAACTAGG - Intergenic
1138685478 16:58721496-58721518 CTAACTGCAGGCTTAAAACTCGG + Intronic
1141682166 16:85551089-85551111 CTACCTGGAGGCTCAGGTCTGGG + Intergenic
1142774219 17:2123510-2123532 CTAACTGATGAATTAAATCTTGG + Intronic
1143172728 17:4939504-4939526 CTACCTGGAGTCCTAAATCTTGG - Intronic
1144375440 17:14635290-14635312 TGATCTGGTGACTTAGATCTGGG + Intergenic
1147119315 17:38326572-38326594 CTTCCTGGAGACTTGGCTCTGGG + Exonic
1148770495 17:50063394-50063416 CCATGTGGAGACTCAGATCTTGG - Intronic
1153392904 18:4583154-4583176 CAAACTGCAGACTTAGGACTTGG - Intergenic
1153505456 18:5792251-5792273 CAAACTGGAGACCTGGAGCTGGG - Intergenic
1157247957 18:46070903-46070925 CAAACTGGAGAATGAGATGTGGG - Intronic
1158612718 18:58956959-58956981 CTAACTGGAGACACAGATTTGGG - Intronic
1164641525 19:29829627-29829649 CTAACCCGAGAGTTAGATCAGGG - Intergenic
1166720928 19:44995393-44995415 CTTACTGGGGACTGAGACCTTGG + Intergenic
925515698 2:4678680-4678702 CTAAATGGGGATTTTGATCTTGG - Intergenic
927646423 2:24879856-24879878 CTAACTGGATCCTTAGCTCTTGG - Intronic
927771091 2:25862454-25862476 GGAACTGGATATTTAGATCTTGG - Intronic
928433641 2:31239849-31239871 CTAACAGGAGACTTAGAGGCAGG + Intronic
928967320 2:36989847-36989869 CTATCTGGAGACTCAGATTCAGG + Intronic
929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG + Intergenic
933468093 2:82682076-82682098 CAATCTGGAGACTGAGAGCTAGG + Intergenic
935085560 2:99841308-99841330 ATCACTGGAGACATAGATGTAGG + Intronic
936957187 2:118034293-118034315 CTGACTGGGGACTGAGATGTTGG + Intergenic
942361233 2:175173892-175173914 CTAACTGGTTCCTGAGATCTAGG + Intergenic
942456418 2:176141160-176141182 CTCCCTGGAGACTCAGAGCTTGG + Intergenic
942806945 2:179941958-179941980 CTAACAGGATACGTACATCTGGG + Intergenic
945681361 2:212917844-212917866 CACACAGGAGTCTTAGATCTGGG + Intergenic
1170800141 20:19583899-19583921 CTAACTGAGGATTTTGATCTAGG - Intronic
1172707288 20:36891511-36891533 CTAACTGCAGACTTTGTTCTTGG + Exonic
1177856923 21:26410136-26410158 CGAACTGGAGACTAAGACATTGG - Intergenic
1178954177 21:37007943-37007965 TTAACTGGAGACAGAGAACTGGG + Intronic
1182742403 22:32577570-32577592 CTAACTGGATTCTCAGCTCTTGG + Intronic
949793610 3:7821876-7821898 CTCACAGGAGACTCAGATATTGG + Intergenic
960289132 3:115862486-115862508 CTAGCTGAAGAAGTAGATCTGGG - Intronic
963819554 3:149873632-149873654 ATCACTGGAGACAGAGATCTTGG - Intronic
964827309 3:160842883-160842905 CTAAATGGTGAGTTAGAACTAGG - Intronic
964927429 3:161975725-161975747 CCAACTGGAGCCTCAGATGTTGG - Intergenic
965980943 3:174689574-174689596 CTACCTGGAGATTTTCATCTAGG - Intronic
966551002 3:181203856-181203878 CTAACTGGTCACTTAGATAAGGG - Intergenic
971456708 4:26851990-26852012 CAAGCTGGAGATTTAGATTTAGG - Intergenic
972482801 4:39513839-39513861 CTAATTTGAGATTTAGAACTAGG - Intronic
974552472 4:63396251-63396273 CTTCCTGGAGGCTTAGACCTTGG + Intergenic
974653275 4:64783308-64783330 CTAACTGTAGACTTTGAGCAAGG - Intergenic
975173001 4:71254619-71254641 CAAAATAGAGACTTAGAACTGGG - Intronic
977257236 4:94754680-94754702 CTAACTGTAGCCTTGGATTTTGG - Intergenic
978274260 4:106930339-106930361 ATAACTTGAGACTTACATTTAGG + Intronic
979234126 4:118380337-118380359 CTAACTGGAAAATTAGATAAGGG - Intergenic
981445382 4:144830897-144830919 CTAACTGGAATGTGAGATCTTGG + Intergenic
982228796 4:153189403-153189425 CTAATTGGTGACTGATATCTGGG + Intronic
982444599 4:155475300-155475322 CTAAATGGAGATTTAGCTCATGG - Intergenic
986594777 5:9409819-9409841 TTACCTGGAGACTTTGATTTGGG - Intronic
986637684 5:9838956-9838978 CTAACTGGACACTGAAATCTGGG + Intergenic
991432997 5:66567826-66567848 CTAACTCCAGACTTAGAGTTAGG - Intergenic
991898688 5:71434580-71434602 CACACTGGAGACTCAGAGCTTGG + Intergenic
993610763 5:90051561-90051583 ATACTTGGAAACTTAGATCTAGG - Intergenic
998786572 5:145716165-145716187 CTAACAGAAGACTTAGACCAGGG - Intronic
999299117 5:150479760-150479782 TTAATTGGAGACTTATAGCTGGG + Intergenic
999487798 5:152016784-152016806 CTGACTGGAGACTAAGAGATTGG - Intergenic
1007222098 6:40286815-40286837 AGAACTGGAATCTTAGATCTAGG - Intergenic
1008816486 6:55573382-55573404 CTAACTGGAGATCTGGATATTGG + Intronic
1012862204 6:104573417-104573439 TTAAATGGAGAGTTAGAGCTTGG + Intergenic
1013978394 6:116101840-116101862 CTGTCTGGATGCTTAGATCTTGG - Intronic
1022047816 7:26637099-26637121 ATAACTGGTGACATTGATCTTGG - Intergenic
1023943741 7:44787052-44787074 CTAACTGAAGACTTATTTCTGGG + Intergenic
1024543099 7:50495170-50495192 CTCACTGGAAACTTTTATCTAGG - Intronic
1026713187 7:72762459-72762481 CTAACAGCAGAGTTAGAACTAGG - Intronic
1031058805 7:117025545-117025567 CTAAGTGCAGACTTAGAGGTGGG - Intronic
1031460427 7:122042186-122042208 CTACCTGGAAACATAGACCTAGG + Intronic
1040971105 8:53138414-53138436 CTTACCTGAGACTTAGAACTGGG - Intergenic
1041002289 8:53464752-53464774 CTTACCCGAGACTTAGAACTGGG + Intergenic
1043795096 8:84526426-84526448 CTACCTGGAGAATTAAATTTAGG - Intronic
1060377477 9:123129733-123129755 CAAACAGGAGATTTAGAACTTGG - Intronic
1186165900 X:6825587-6825609 CAAGCTGGAGACTTAGAGGTGGG - Intergenic
1186748983 X:12602131-12602153 CTCACTGGAAACCTAGAACTAGG + Intronic
1189377496 X:40476909-40476931 CAAATTGGAGACTGACATCTTGG + Intergenic
1189899972 X:45696404-45696426 CAAACTGGAGACTTGAAACTAGG + Intergenic
1190598334 X:52067375-52067397 CTTACTGGTGACTAACATCTGGG + Exonic
1190610490 X:52186698-52186720 CTTACTGGTGACTAACATCTGGG - Exonic
1199822723 X:151465220-151465242 CTAGCTGGAGTCTCAGAACTGGG + Intergenic
1201530845 Y:14988462-14988484 CTTACTCCAGACTTAGAACTGGG + Intergenic