ID: 1119790112

View in Genome Browser
Species Human (GRCh38)
Location 14:77342358-77342380
Sequence TCTATCATTTAGTAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119790112 Original CRISPR TCTATCATTTAGTAGGTGAA AGG Intronic
902898396 1:19495623-19495645 TCCATCGTTTAGTAGGTGTGTGG - Intergenic
902945009 1:19829301-19829323 GATGTCCTTTAGTAGGTGAATGG - Intergenic
903622974 1:24711472-24711494 TCTATCTCTTACTAGGTGCATGG + Intergenic
904225245 1:29011939-29011961 TCTTTCTTTTAGTAGGTCAGAGG + Intronic
908797831 1:67848754-67848776 TATATCATTCAGTGAGTGAATGG - Intergenic
909180078 1:72412669-72412691 TCCATCATTTACTAGGTGTGTGG + Intergenic
909304370 1:74054127-74054149 AATATACTTTAGTAGGTGAATGG + Intronic
909645636 1:77913838-77913860 GATGTCATTTGGTAGGTGAATGG + Intronic
910813923 1:91268444-91268466 TCTCTCATTTATTAGTTGTATGG + Intronic
911361721 1:96884976-96884998 GATGTCCTTTAGTAGGTGAATGG + Intergenic
911457563 1:98145826-98145848 GATATCCTTCAGTAGGTGAATGG + Intergenic
911678445 1:100685919-100685941 GATGTCCTTTAGTAGGTGAATGG - Intergenic
911698658 1:100924925-100924947 TCTACGATTAAGTAGGTGAGAGG - Intronic
912010881 1:104960742-104960764 GCTGTTATTTAGTAGGTGAGTGG + Intergenic
912493056 1:110072703-110072725 TCCATCACTGAATAGGTGAAAGG + Intronic
913175824 1:116272390-116272412 TCTGCCATTTATTAGCTGAAAGG + Intergenic
913462876 1:119106701-119106723 GATGTCTTTTAGTAGGTGAATGG - Intronic
914441820 1:147714370-147714392 AATATCCTTGAGTAGGTGAAAGG - Intergenic
916185715 1:162130773-162130795 CCTAACATTTGGTGGGTGAATGG + Intronic
916277367 1:163009273-163009295 GATATCTTTCAGTAGGTGAATGG + Intergenic
916602773 1:166309231-166309253 AATGTCATTCAGTAGGTGAATGG - Intergenic
916660997 1:166922100-166922122 TTGATCATTTAGTATATGAAAGG - Intronic
917341903 1:173988472-173988494 GATATCTTTTAATAGGTGAATGG - Intronic
918639540 1:186822556-186822578 TGAATCATTTATTGGGTGAATGG + Intergenic
918821821 1:189266405-189266427 TCTATCTTTTCCTAGGTAAAAGG + Intergenic
921014897 1:211180312-211180334 TATGTCCTTTAGTAGGTGAATGG - Intergenic
921093912 1:211870539-211870561 TTTATCATTTACTATGTGACAGG + Intergenic
921410211 1:214827998-214828020 TCTATCCTTTAGTACTTGCATGG + Intergenic
922040285 1:221889591-221889613 GCTGTCATTTAGGAGGTGCAGGG + Intergenic
922657562 1:227399584-227399606 AATGTCATTTGGTAGGTGAATGG - Intergenic
922824671 1:228509549-228509571 GATATTTTTTAGTAGGTGAATGG + Intergenic
1064747659 10:18493683-18493705 TCTGCCATTTATTAGGTGAGTGG - Intronic
1064920711 10:20514732-20514754 TCTACCATTTACTAGTTGTATGG + Intergenic
1068324818 10:55471053-55471075 TATATCGTTTAGTAGGTGAATGG - Intronic
1069625584 10:69865891-69865913 TCTACCATTTACTAGCTGCATGG + Intronic
1070498890 10:77051784-77051806 GCTCTCATTTTGCAGGTGAAGGG - Intronic
1071996527 10:91154296-91154318 TCTATCATTTACTACCTGAATGG + Intergenic
1072155898 10:92723379-92723401 ACTCTGATTCAGTAGGTGAATGG + Intergenic
1073920634 10:108454205-108454227 TTTATCATTGAGTGGGTGGATGG - Intergenic
1073980023 10:109143698-109143720 TCTATCATGGAAAAGGTGAAGGG - Intergenic
1074328059 10:112472465-112472487 TCTCTCTTTTCATAGGTGAATGG + Intronic
1074435769 10:113432940-113432962 CATCTCATTTAGTAGGTGCAAGG + Intergenic
1075329442 10:121562588-121562610 GATATCTTTTAGTAGGTAAACGG + Intronic
1077343033 11:2034485-2034507 TCTCTCATTTTGTGGGTGAGTGG + Intergenic
1078173115 11:8944975-8944997 GATTTCCTTTAGTAGGTGAACGG - Intergenic
1078272094 11:9805421-9805443 TCTGTCCTACAGTAGGTGAATGG - Intronic
1078890886 11:15557756-15557778 GCTGTCCTTCAGTAGGTGAATGG + Intergenic
1079632289 11:22692746-22692768 TTTACCATTGAGTATGTGAAAGG - Intronic
1080856922 11:36120630-36120652 TCACTCAGCTAGTAGGTGAAGGG + Intronic
1082890520 11:58134053-58134075 TCTCTCATTTAGAAGCTGATTGG + Intronic
1082984407 11:59155638-59155660 AATATCATTTAGGAGGTCAAGGG - Intergenic
1083082110 11:60104616-60104638 TCAATATTTTAGTAGGTGACAGG - Intergenic
1085092304 11:73727554-73727576 TCTACCATTTAGTAGTTGGATGG - Intronic
1085652955 11:78284921-78284943 TCTATTATCTAGCAGGTCAAAGG + Intronic
1086225634 11:84505508-84505530 TCTATAATTTACTAGTTAAATGG + Intronic
1087097692 11:94335583-94335605 AATGTCCTTTAGTAGGTGAATGG - Intergenic
1202826019 11_KI270721v1_random:89674-89696 TCTCTCATTTTGTGGGTGAGTGG + Intergenic
1091946845 12:4553458-4553480 TCTTACATCTAATAGGTGAAGGG + Intronic
1093296340 12:17396648-17396670 GATGTCCTTTAGTAGGTGAATGG + Intergenic
1094110901 12:26861648-26861670 ACTATCTTTCAGTGGGTGAATGG - Intergenic
1097450379 12:59731081-59731103 TTTACCATTTATTAGGTAAAAGG - Intronic
1097813306 12:64042730-64042752 TCTGTCATTTAGAGAGTGAATGG - Intronic
1098215969 12:68220043-68220065 TCTATTTTTTAGTAGATGCAAGG - Intronic
1099127980 12:78789942-78789964 GATATCCTTCAGTAGGTGAATGG - Intergenic
1099610746 12:84865825-84865847 GATATCCTTTAGTAGGTAAATGG - Intronic
1100344711 12:93716767-93716789 GATATCCTTCAGTAGGTGAATGG - Intronic
1103456347 12:121069899-121069921 TCTATCATTGTGTATGTAAACGG + Intergenic
1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG + Intergenic
1104482152 12:129117008-129117030 GATATCCTTTAGTAGGTGAATGG + Intronic
1105045060 12:132995990-132996012 TCTGTCATGCAGTAGGGGAATGG + Intronic
1106652770 13:31709547-31709569 TCTGTTATTTAGTTGGTGATGGG + Intergenic
1106802883 13:33274634-33274656 TCTATCATGTAAGGGGTGAACGG - Intronic
1108819596 13:54331976-54331998 AATATCATTCAGTAGGTGATTGG + Intergenic
1110104902 13:71660291-71660313 TCTAACATTAAGCAGGTGACTGG - Intronic
1110328314 13:74242691-74242713 TCAATTGTTTAGTAGGTGTAGGG + Intergenic
1111743214 13:92231523-92231545 TCTATCATTAAGAAGTTAAAAGG + Intronic
1112777328 13:102859207-102859229 TCTGTCCTATAGTGGGTGAATGG - Intronic
1115086004 14:29515509-29515531 TCAATCAATAAATAGGTGAATGG - Intergenic
1115273393 14:31579511-31579533 TCCATCACTAAGTAGGTAAACGG - Intronic
1117085086 14:52192125-52192147 ATTACCACTTAGTAGGTGAAAGG + Intergenic
1117158250 14:52961927-52961949 TGTATCTTTTAATAGGTGTAGGG - Intergenic
1117240550 14:53828534-53828556 TCTATCAATTATTAAGAGAAGGG - Intergenic
1118886009 14:69866362-69866384 TCCATCAGTTTGTAAGTGAAGGG - Intronic
1119501674 14:75133749-75133771 TATGTCCTTTAGTGGGTGAATGG + Exonic
1119790112 14:77342358-77342380 TCTATCATTTAGTAGGTGAAAGG + Intronic
1119963941 14:78892102-78892124 TTTCTCATTTAGCAGGTGTATGG - Intronic
1120332442 14:83111166-83111188 TATGTCCTTTAGTAAGTGAATGG + Intergenic
1120908060 14:89638102-89638124 GATGTCATTCAGTAGGTGAATGG + Intronic
1122332574 14:100933136-100933158 GATATCCTTCAGTAGGTGAATGG - Intergenic
1122750561 14:103929483-103929505 GCTCTCCTTCAGTAGGTGAATGG - Intronic
1123454703 15:20410298-20410320 TCCATCCTTCAGAAGGTGAAAGG - Intergenic
1124406593 15:29398365-29398387 TCTTTCATTCAGTAGATGCATGG + Intronic
1124429880 15:29597671-29597693 TATATCCTTCAATAGGTGAATGG - Intergenic
1128057624 15:64712261-64712283 GGTATCCTTCAGTAGGTGAATGG + Intergenic
1128624814 15:69189434-69189456 TATGTCCTTCAGTAGGTGAATGG - Intronic
1131203666 15:90423080-90423102 TCTGTGATTTAGTAGAAGAAGGG + Intronic
1132257528 15:100389561-100389583 GATATCCTTCAGTAGGTGAATGG + Intergenic
1134636897 16:15799479-15799501 TCTGTCATCTAGTAGAGGAAAGG - Intronic
1135645635 16:24159245-24159267 TCTCCCATTTTGCAGGTGAAAGG + Intronic
1135847934 16:25935708-25935730 GGTGTCATTTAGCAGGTGAATGG - Intronic
1140727997 16:77831158-77831180 TCTGTCATTTAATAGGTGGTGGG + Intronic
1141458894 16:84164656-84164678 GATGTCTTTTAGTAGGTGAATGG - Intronic
1141825274 16:86474576-86474598 GATGTCCTTTAGTAGGTGAATGG + Intergenic
1146806623 17:35869936-35869958 TCTATCACTGAGTGGGTGGATGG - Intergenic
1148011665 17:44487392-44487414 GATATCCTTCAGTAGGTGAATGG - Intronic
1148387692 17:47246639-47246661 GATATCCTTTAGTAGGTGAATGG + Intergenic
1149233204 17:54560246-54560268 TCTGTCTGTTGGTAGGTGAATGG + Intergenic
1149725822 17:58893207-58893229 GATGTCCTTTAGTAGGTGAATGG + Intronic
1150035566 17:61792421-61792443 TGTTTCTTTCAGTAGGTGAATGG + Intronic
1150963279 17:69938237-69938259 TTTATCCTATAGTAGGTGATAGG + Intergenic
1151006417 17:70443001-70443023 GATATCCTTCAGTAGGTGAATGG + Intergenic
1151095584 17:71493901-71493923 ACAGTCATTTAGTAGGTGGATGG + Intergenic
1153693995 18:7621857-7621879 GATATCCTTCAGTAGGTGAATGG - Intronic
1154381588 18:13856043-13856065 TCCATCCATCAGTAGGTGAATGG + Intergenic
1154968195 18:21380597-21380619 TCTATCCCTTAATAGTTGAATGG + Intronic
1155417005 18:25609651-25609673 GATATCCTTCAGTAGGTGAATGG + Intergenic
1155858410 18:30864985-30865007 GATATCCTTTAGCAGGTGAATGG + Intergenic
1157262910 18:46192037-46192059 ACTATCCTTCAGTAGGTGAATGG - Intronic
1163414483 19:17177789-17177811 TCTAGCATTGAGCAGCTGAAAGG - Intronic
1164913936 19:32034763-32034785 TCTGTCATTTAGTAGGTTTCAGG + Intergenic
1165209821 19:34225312-34225334 TTTATGATTTAGGAGGTGTAGGG - Intronic
925374701 2:3375693-3375715 TCTATCATTTACTAGTTAAGTGG + Intronic
925739245 2:6991071-6991093 GCTGTCTTTCAGTAGGTGAATGG - Intronic
926480634 2:13389303-13389325 TCCATCCTTCAGAAGGTGAAAGG + Intergenic
928788425 2:34919446-34919468 GCTGTCCTTTAGTAGTTGAATGG - Intergenic
929409537 2:41682171-41682193 GATGTCCTTTAGTAGGTGAATGG - Intergenic
929634059 2:43498098-43498120 TCTTTCATGTAGTATATGAAGGG - Intronic
929900274 2:45994676-45994698 AATGTCCTTTAGTAGGTGAACGG - Intronic
930298294 2:49582617-49582639 TCACTCATCTAGTAGGTGACAGG + Intergenic
930538463 2:52673682-52673704 TCTATCTTTAATGAGGTGAAGGG - Intergenic
931544954 2:63372645-63372667 TCTATCAATTACTAAATGAAAGG + Intronic
932510688 2:72286245-72286267 GGTATCCTTCAGTAGGTGAATGG + Intronic
932515645 2:72345429-72345451 GATGTCCTTTAGTAGGTGAATGG + Intronic
933352595 2:81173950-81173972 GATACCCTTTAGTAGGTGAATGG - Intergenic
933359683 2:81265040-81265062 GATATTCTTTAGTAGGTGAATGG - Intergenic
933407781 2:81883315-81883337 TCTTTCATTAAGTAGGAGAAAGG + Intergenic
935633242 2:105229626-105229648 ACTACCCTTCAGTAGGTGAATGG + Intergenic
936069763 2:109358288-109358310 GATGTCGTTTAGTAGGTGAATGG - Intronic
938624503 2:133093746-133093768 TCTATCAAATAGTAAATGAATGG - Intronic
939138840 2:138329016-138329038 CATATCATTCAGTAGGTGAATGG + Intergenic
939172276 2:138709904-138709926 AATATCCTTCAGTAGGTGAATGG - Intronic
939903583 2:147881758-147881780 TCTATCATTAAGTTTGTGAGAGG + Intronic
940410098 2:153351848-153351870 GATATCCTTCAGTAGGTGAATGG - Intergenic
942154777 2:173116769-173116791 TCTACCAATAAGTAGCTGAAGGG - Intronic
942163209 2:173214187-173214209 CCTATCATTTATTAGGTCAAAGG - Intronic
943234267 2:185297916-185297938 GATATCCTTCAGTAGGTGAATGG - Intergenic
944080652 2:195784489-195784511 GATGTCCTTTAGTAGGTGAATGG - Intronic
946992944 2:225356132-225356154 TCTATAATTTAGTATGTGGATGG + Intergenic
947921256 2:233876524-233876546 GATATCCTTCAGTAGGTGAATGG - Intergenic
1169024406 20:2356864-2356886 TCTATGATTTAGTGGGTGTTGGG + Intergenic
1169536875 20:6554057-6554079 GATATCCTTCAGTAGGTGAATGG - Intergenic
1169652206 20:7882041-7882063 CCTAGCATTTAGAAGGAGAAAGG + Intergenic
1170417008 20:16155216-16155238 GATGTCATTCAGTAGGTGAATGG + Intergenic
1172213926 20:33221051-33221073 TTTATCATTTAGTAGGTTGGAGG - Intronic
1172989019 20:39018192-39018214 TCACTCATTTAGTATGAGAAGGG + Intronic
1174944183 20:54966710-54966732 CCTGTCAGTTAGTAGGTGACTGG - Intergenic
1175346765 20:58285034-58285056 TCTATGATTTAATAGATGAAAGG + Intergenic
1175584719 20:60129357-60129379 TCTGTCTTTTAGTGGGTGAATGG + Intergenic
1182748987 22:32626826-32626848 TCTATCATGTAGTAGGTATTTGG + Intronic
1182983285 22:34693006-34693028 TTTGTCATTTACCAGGTGAATGG - Intergenic
1183761105 22:39818963-39818985 GATATCCTTCAGTAGGTGAATGG + Intronic
949393931 3:3594962-3594984 TCCATCTTTTAGTAGCTGTATGG + Intergenic
950685026 3:14610721-14610743 ACTGTCATTCAGTTGGTGAATGG - Intergenic
951436608 3:22672528-22672550 GATATCCTTCAGTAGGTGAATGG + Intergenic
951926212 3:27911406-27911428 TCCACCATTTAGTAGTTGTATGG + Intergenic
951969054 3:28422609-28422631 GATATCCTTCAGTAGGTGAATGG - Intronic
952357708 3:32600099-32600121 TCTACCTTTTGGTAGGTGAGTGG + Intergenic
952434031 3:33254590-33254612 TATGTCATTCAGTAGGTGAATGG + Intergenic
954880037 3:53828997-53829019 GATATCCTTCAGTAGGTGAATGG + Intronic
954939417 3:54357667-54357689 AATATTATTTAATAGGTGAATGG + Intronic
956817245 3:72919233-72919255 GATATCCTTCAGTAGGTGAATGG + Intronic
956954651 3:74322743-74322765 TATATCCTTTAGTAGATGAGTGG + Intronic
956973352 3:74552188-74552210 GATATCCTTCAGTAGGTGAATGG - Intergenic
957533859 3:81475676-81475698 TCTACCATTTAGAATGTTAATGG - Intergenic
957906830 3:86568454-86568476 GATATCCTTCAGTAGGTGAATGG + Intergenic
958146109 3:89627661-89627683 TATATCCTTCAGTAGGTAAATGG + Intergenic
958622400 3:96577727-96577749 TTTATCATTAGCTAGGTGAAAGG - Intergenic
958731259 3:97962824-97962846 TCCATCATTTACTAGTTGCATGG - Intronic
959407643 3:105979878-105979900 TCTATAAGATAGTATGTGAAAGG - Intergenic
960576807 3:119238331-119238353 ACTATCATTTTGTATGTAAAAGG - Intronic
962574015 3:136739179-136739201 TCTATCATTTACTAGCTGTTTGG + Intronic
963199672 3:142573271-142573293 TCTATCTTTTAGTAGAGAAAGGG - Intronic
963283072 3:143405593-143405615 TCTATCATATAGGTGGGGAAAGG + Intronic
965181657 3:165411705-165411727 GATATCCTTTATTAGGTGAATGG + Intergenic
965368284 3:167826890-167826912 TTTATCATTCAGTAGGTCTAGGG + Intergenic
966545977 3:181148882-181148904 TATGTCCTTTAGTAGGTGAATGG + Intergenic
969147720 4:5138861-5138883 TCTGGCATTCAGTAGGTGATGGG + Intronic
970918836 4:21369081-21369103 TTTATCACTTACTAGCTGAATGG + Intronic
971630617 4:28988368-28988390 GGTATCTTTTAGCAGGTGAATGG - Intergenic
971873562 4:32275008-32275030 TCTATAATTTAGAAGACGAAAGG + Intergenic
973305219 4:48640257-48640279 AATGTCATTCAGTAGGTGAATGG + Intronic
973540030 4:51926455-51926477 TGTATTGTTTATTAGGTGAAAGG + Intergenic
973769434 4:54192891-54192913 TCTATAATGGAGTAGGTTAAAGG - Intronic
973881203 4:55273019-55273041 TCAATCATATAGCAGCTGAATGG - Intergenic
974878729 4:67728525-67728547 TCTATCTTTTCCTAGGAGAAGGG + Intergenic
975723533 4:77270585-77270607 TCTTTGACATAGTAGGTGAAAGG - Intronic
979817080 4:125122033-125122055 TATATCCTTCAATAGGTGAATGG + Intergenic
979830329 4:125292717-125292739 TATGTCCTTCAGTAGGTGAATGG + Intergenic
980289034 4:130821406-130821428 TATATCCTTCATTAGGTGAATGG - Intergenic
980384571 4:132070603-132070625 TCTATCATTTAGTAATAAAATGG + Intergenic
980666060 4:135937186-135937208 GATATGATTTAGTGGGTGAAAGG - Intergenic
981263364 4:142750421-142750443 TCTATCATTTACCAAGTGGATGG + Intronic
981872227 4:149500133-149500155 CCTTTCATTTAGTATTTGAAAGG + Intergenic
981947835 4:150370285-150370307 GATATATTTTAGTAGGTGAATGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984297953 4:177877890-177877912 GATATCCTTTGGTAGGTGAATGG - Intronic
984468391 4:180130497-180130519 TCTTTCATTTACTTGTTGAATGG - Intergenic
984472877 4:180199365-180199387 TCTAAAAGTTAGTCGGTGAAAGG - Intergenic
984636579 4:182116797-182116819 TATATCCTTTAGTAGTTGATTGG - Intergenic
984725572 4:183016910-183016932 TCTAACATTTTGTAGTTTAAAGG + Intergenic
985759557 5:1738423-1738445 GATATCTTTCAGTAGGTGAATGG - Intergenic
986228543 5:5840092-5840114 TCTATAATTTAAAGGGTGAAGGG - Intergenic
986969347 5:13314243-13314265 TCCATCAAAAAGTAGGTGAAGGG + Intergenic
987903185 5:24040018-24040040 CCTGTTATTTAGCAGGTGAAAGG - Intronic
987989496 5:25192184-25192206 TCTATCATTGAGTAGATTATTGG + Intergenic
990059153 5:51625778-51625800 GATGTCCTTTAGTAGGTGAATGG - Intergenic
991988464 5:72314242-72314264 TATATAATCTAGTAGTTGAAAGG - Intronic
992519039 5:77530044-77530066 TCTCTCATTTTGTATGTGACTGG - Intronic
992533793 5:77677942-77677964 TATGTCTTTCAGTAGGTGAATGG + Intergenic
994208908 5:97066175-97066197 ACTATAATTTAGTAGGTGTCTGG - Intergenic
994360928 5:98847465-98847487 TCTGTCCTTCAGTATGTGAAGGG + Intergenic
995336301 5:111003636-111003658 TCTATTATTTACTATGTGATAGG + Intergenic
995420567 5:111962382-111962404 TCTCTCCTTTTGTAGATGAATGG - Intronic
996469714 5:123845424-123845446 TCAACCATTTAGCAGGTGGAAGG + Intergenic
997906262 5:137820528-137820550 TCTATCATTTGGTAGATGAATGG + Intergenic
998696058 5:144641171-144641193 TGTATCATTCAACAGGTGAATGG - Intergenic
999695271 5:154183258-154183280 TATGTCCTTCAGTAGGTGAACGG + Intronic
999791843 5:154947235-154947257 ACTCTAATTTACTAGGTGAATGG - Intronic
1001022892 5:168198679-168198701 TCTATCACTTACTAGCTGAGTGG - Intronic
1003385613 6:5664793-5664815 TCTATCATTCAGTAGCTCAAGGG + Intronic
1003417453 6:5924623-5924645 GCTGTCATTCAATAGGTGAATGG + Intergenic
1006773605 6:36574602-36574624 AATATCTTTTAGTAGGTAAATGG - Intergenic
1007132483 6:39488743-39488765 TCTAATGTTTAGTTGGTGAATGG - Intronic
1007457367 6:41989923-41989945 GCTGTCCTTCAGTAGGTGAATGG + Intronic
1008828773 6:55732240-55732262 TGTTTCATTTATTAGGTTAAGGG - Intergenic
1010080736 6:71857971-71857993 AATATCCTTTAATAGGTGAATGG - Intergenic
1010644092 6:78365739-78365761 GCTATCTTATAGAAGGTGAAAGG + Intergenic
1012891448 6:104902105-104902127 CATATTCTTTAGTAGGTGAATGG - Intergenic
1013502694 6:110768488-110768510 GATATCCTTCAGTAGGTGAATGG + Intronic
1015564783 6:134557923-134557945 TATATACTTTAGCAGGTGAAGGG + Intergenic
1016437940 6:144057007-144057029 TATATCCTTCAGTAGGTGAATGG - Intronic
1017958486 6:159200501-159200523 TCCCTAATTTAGGAGGTGAATGG + Exonic
1019641241 7:2104943-2104965 TTTAACATTTAGGAGGTGAGCGG - Intronic
1021105005 7:16628092-16628114 ACTATTATTTGGTAGGTAAATGG + Intronic
1022607405 7:31829190-31829212 TCTCACATCTAGTAGGAGAAAGG - Intronic
1023255568 7:38309264-38309286 TCTACCATTTACTAGCTGAGAGG - Intergenic
1023729442 7:43176649-43176671 TTTATGATTTAGTAGATTAATGG - Intronic
1024062184 7:45707285-45707307 GGTATCCTTCAGTAGGTGAATGG + Intronic
1024221415 7:47290933-47290955 AATGTCCTTTAGTAGGTGAATGG + Intronic
1026687846 7:72527141-72527163 TCTATCAGTTACTAAGAGAAAGG - Intergenic
1026723066 7:72848989-72849011 TCTATCAGTTACTAAGAGAAAGG - Intergenic
1027409770 7:77904070-77904092 TTTGTCATTTAATAGGTAAATGG - Intronic
1028396512 7:90374976-90374998 GATATCTTTCAGTAGGTGAATGG + Intronic
1029962076 7:104698665-104698687 GGTATCTTTTAATAGGTGAATGG + Intronic
1030211179 7:106997036-106997058 TCTATCATATATTACATGAAAGG + Intergenic
1030911689 7:115257847-115257869 TTTAGCATTCAGTAGGTAAATGG + Intergenic
1031428002 7:121631163-121631185 GCTGTCCTTCAGTAGGTGAATGG - Intergenic
1031733526 7:125328078-125328100 TCTATTATTTATTGGGTGGAAGG - Intergenic
1031946208 7:127843629-127843651 TATATCCTTCAGTAGGTGAATGG - Intronic
1033980295 7:147155965-147155987 GATACCATTTAGTAGGTGCATGG + Intronic
1035606371 8:932617-932639 TGAATCATTTATTATGTGAAGGG + Intergenic
1038639570 8:29312576-29312598 TCTAACATTTAGGAGGGGAGAGG - Intergenic
1038924152 8:32119142-32119164 TCTATTATTTAATAGGTAGAAGG + Intronic
1039366831 8:36937118-36937140 TCAATCACTTACTAGCTGAATGG - Intergenic
1040977507 8:53210506-53210528 GATATCTTTTAATAGGTGAATGG - Intergenic
1042767800 8:72345416-72345438 TGTCTCATTTAGCAGGCGAAAGG - Intergenic
1043420657 8:80095122-80095144 GATGTCATTCAGTAGGTGAATGG + Intronic
1046501857 8:115087817-115087839 GATGTCCTTTAGTAGGTGAATGG - Intergenic
1047119502 8:121885162-121885184 CTTAACATTTAGTAAGTGAAGGG - Intergenic
1047922503 8:129650035-129650057 TCTATCATTTACTAGCTGTGTGG + Intergenic
1048295071 8:133208083-133208105 TCTGTCATTTACTAGGTGTTGGG + Intronic
1048480653 8:134789234-134789256 TCTAGCATTAGGTAGGTAAATGG - Intergenic
1048753658 8:137709057-137709079 TATATCCTTCAGTAGATGAATGG + Intergenic
1049873092 8:144996597-144996619 TTTGTCCTTTAGTAGGTGAATGG - Intergenic
1050245706 9:3687821-3687843 TCTGTCATTCAGAAGGTGAAAGG - Intergenic
1050689671 9:8211555-8211577 TCTATCATCTAGCAATTGAAAGG + Intergenic
1052479951 9:29010959-29010981 TCTATCATTTAGTAATTGTGTGG + Intergenic
1052482015 9:29042442-29042464 TCTGTCCTTCAGTGGGTGAATGG + Intergenic
1053187543 9:36030790-36030812 GATGTCCTTTAGTAGGTGAATGG - Intergenic
1053302855 9:36964104-36964126 TCTATTTTTTAGTAGGGGCAGGG - Intronic
1053584420 9:39441812-39441834 TCTACCATTTATTAAGGGAAAGG - Intergenic
1054106000 9:61000558-61000580 TCTACCATTTATTAAGGGAAAGG - Intergenic
1055005591 9:71502290-71502312 GATATCCTTTAGTAGGTGAATGG + Intergenic
1056127342 9:83548324-83548346 TATGTCCTTTAATAGGTGAATGG + Intergenic
1057018392 9:91676094-91676116 TCTATCCATCAGTAGGAGAAAGG - Intronic
1058321120 9:103632399-103632421 TCTATCATATAGTAGAAGTATGG + Intergenic
1058466031 9:105228852-105228874 TCTGTCATTTATTAGCTGCATGG - Intergenic
1058664047 9:107293285-107293307 GCCATAATTTAGTATGTGAAGGG + Intronic
1060742530 9:126109017-126109039 TCCACCATTCAGTAGGTGGAGGG - Intergenic
1060774363 9:126360651-126360673 TCTATCAATTATTAAGAGAAGGG + Intronic
1060785000 9:126444393-126444415 TTTATCAATTGGAAGGTGAAGGG + Intronic
1061453811 9:130682980-130683002 TTTATCATTTAGCATCTGAATGG + Exonic
1061771617 9:132928178-132928200 AGTATCCTTCAGTAGGTGAATGG - Intronic
1062175408 9:135159357-135159379 TCCCTCATTGAGTGGGTGAAAGG - Intergenic
1186377357 X:9018921-9018943 TCAATCATTTATTAGCTGTAAGG + Intergenic
1186871262 X:13776176-13776198 TCTGTCATTTAGAAGCTGGAGGG + Intronic
1189439204 X:41019241-41019263 TCCATCATTCAATAGGTCAAGGG - Intergenic
1190466304 X:50727650-50727672 ACAATCATCTAGAAGGTGAAGGG - Intronic
1190575012 X:51826980-51827002 GATGTCCTTTAGTAGGTGAATGG + Intronic
1191681569 X:63846155-63846177 TATAACAGTTAGTAGATGAAGGG + Intergenic
1192919267 X:75689066-75689088 AATATCCTTCAGTAGGTGAAGGG - Intergenic
1193134245 X:77952089-77952111 GATACCCTTTAGTAGGTGAATGG - Intronic
1193325936 X:80178657-80178679 TCAAACACATAGTAGGTGAAAGG - Intergenic
1193781287 X:85704559-85704581 CCAATGATTCAGTAGGTGAAGGG + Intergenic
1194661456 X:96632646-96632668 GTTATCCTTAAGTAGGTGAATGG + Intergenic
1194959377 X:100217493-100217515 TCTTTCAGTCAGTAGGTCAAGGG - Intergenic
1196078934 X:111610219-111610241 TATCTCACTTAGTAGGGGAAAGG + Intergenic
1197896753 X:131324181-131324203 TCGAACATTTCGTAGGTGACAGG - Intronic
1198765198 X:140073334-140073356 TATGTCTTATAGTAGGTGAATGG + Intergenic
1199058285 X:143324045-143324067 TCTATCACTTAATAGATGAGTGG - Intergenic
1201738215 Y:17294143-17294165 TCCCTCATTTAGTTGGTAAACGG - Intergenic
1201850758 Y:18477225-18477247 TCTAACATTTTGTGGGTGAAGGG + Intergenic
1201882560 Y:18843152-18843174 TCTAACATTTTGTGGGTGAAGGG - Intergenic
1201982372 Y:19922001-19922023 TCTTTCATGTAGTAGGAAAAAGG + Intergenic