ID: 1119790880

View in Genome Browser
Species Human (GRCh38)
Location 14:77348814-77348836
Sequence TTGTCTGTCCTGAGGTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119790880_1119790888 29 Left 1119790880 14:77348814-77348836 CCAACCTACCTCAGGACAGACAA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1119790888 14:77348866-77348888 GGGATTCTGTTGATCTTTATAGG 0: 1
1: 0
2: 0
3: 14
4: 159
1119790880_1119790886 9 Left 1119790880 14:77348814-77348836 CCAACCTACCTCAGGACAGACAA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1119790886 14:77348846-77348868 ACTCCAAGAATCAGAGCTGTGGG 0: 1
1: 0
2: 0
3: 20
4: 172
1119790880_1119790885 8 Left 1119790880 14:77348814-77348836 CCAACCTACCTCAGGACAGACAA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1119790885 14:77348845-77348867 CACTCCAAGAATCAGAGCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119790880 Original CRISPR TTGTCTGTCCTGAGGTAGGT TGG (reversed) Intronic
901662952 1:10810086-10810108 TAGTGGGTCCTGAGCTAGGTGGG + Intergenic
902759579 1:18572408-18572430 GTTTCTGCCATGAGGTAGGTGGG - Intergenic
905290701 1:36920110-36920132 TGGTCTGTCCTGAAGCTGGTCGG + Intronic
906274754 1:44507508-44507530 TCGTCAGTCCTGGGGTTGGTCGG + Intronic
906448765 1:45925663-45925685 TTGTCAGCCCTGAAGTAGGAGGG + Intronic
909227206 1:73041091-73041113 TTGTGTGTCCTGGGCTAGCTGGG - Intergenic
910700639 1:90070640-90070662 TTGTGTGTACTGTGGTGGGTGGG + Intergenic
911263466 1:95715357-95715379 CTGTCTGTCCAAAGCTAGGTGGG - Intergenic
913105531 1:115610469-115610491 TTTACAGTCCTGAGGTGGGTGGG + Intergenic
916590059 1:166181579-166181601 TTGTGTGTCCTGACCTATGTTGG - Intergenic
916956000 1:169835838-169835860 TTGGCTTTCCTGATGTAGTTTGG + Intronic
917578632 1:176349842-176349864 TTGTAAATCCTGAGATAGGTTGG - Intergenic
917846397 1:179024147-179024169 GTGTCTGTCCTGCAGTATGTGGG + Intergenic
920069121 1:203289859-203289881 TTCACTGTCCTGGGGCAGGTTGG - Intergenic
921402388 1:214739687-214739709 ATGTCTGGTCTGGGGTAGGTTGG + Intergenic
922023650 1:221730265-221730287 TTTTGTGTCCTGAGGTAAGGAGG - Intronic
923199431 1:231697064-231697086 TTGTCTGTGATGAGGTGGGCTGG + Intronic
924814211 1:247428098-247428120 GAGTCTGTCCTGAGGAAGGAAGG - Intronic
1062863381 10:828126-828148 TTAGCTGTCCTGAGGCATGTGGG - Intronic
1062939558 10:1411136-1411158 TTGTCTCTCCTGGGCCAGGTGGG + Intronic
1066130947 10:32393467-32393489 TTAGCTGGACTGAGGTAGGTTGG + Intergenic
1067541896 10:47160826-47160848 TTGTCTGACTGGAGGGAGGTAGG - Intergenic
1068628389 10:59274126-59274148 CTGTCTGTCCTGAGAGAGGCTGG - Intronic
1068657952 10:59593709-59593731 GTGTCTGTGATGAGGTGGGTAGG - Intergenic
1070105996 10:73432010-73432032 TTATCTTGCCTGAGGCAGGTGGG - Intronic
1072419309 10:95276387-95276409 GTGACTGTCCTGTGGTAGGGAGG - Intronic
1077153794 11:1082675-1082697 TTGGCTGTCCCGGGGTGGGTGGG + Intergenic
1078452661 11:11452140-11452162 TTGACTCTCCTGAGGTAAGGAGG + Intronic
1080096691 11:28416728-28416750 TTGTTTCTCCTGAGGCAGCTGGG - Intergenic
1082178955 11:49095530-49095552 AAGTCTGCCCTGGGGTAGGTAGG - Intergenic
1083674460 11:64317664-64317686 TTGTGGGAGCTGAGGTAGGTAGG + Exonic
1084978852 11:72817842-72817864 TGGTCTGTGGTGAGGTAAGTTGG + Exonic
1086700179 11:89892783-89892805 AAGTCTGTGCTGGGGTAGGTAGG - Intergenic
1086705991 11:89951733-89951755 AAGTCTGTGCTGGGGTAGGTAGG + Intergenic
1087083981 11:94198137-94198159 TAATTTGTCCTGAGGTAGGGAGG + Intergenic
1088781371 11:113136974-113136996 TTGCCTCTTCTGAGGAAGGTGGG + Intronic
1088816472 11:113424358-113424380 TTGTCTACCTGGAGGTAGGTGGG - Exonic
1089079505 11:115764056-115764078 TTTTCTTTCCTGAAGGAGGTTGG - Intergenic
1089593705 11:119561227-119561249 TTGAGTGTCCTGAGGTAGGTGGG - Intergenic
1091588233 12:1828062-1828084 CTGTCAGTCCTGAGGGAGGGAGG - Exonic
1092287202 12:7135582-7135604 TGGGTTGTCCTGAGGGAGGTGGG - Intronic
1093383295 12:18521263-18521285 TTGACTGTCCTGTGGTAGAAGGG + Intronic
1095948763 12:47769324-47769346 GTGTCTGTCCTGGGCTGGGTTGG + Intronic
1105460646 13:20582535-20582557 TTTTCTATCCTGAGGTAGGGTGG + Intronic
1113353063 13:109548524-109548546 GTGTCTGTGCTGACGTTGGTTGG - Intergenic
1114430676 14:22657720-22657742 TTCTCAGCCCTGAGGTAAGTTGG + Intergenic
1117733114 14:58743765-58743787 TTGTTTTTCCTGATGTAGGTAGG + Intergenic
1119788406 14:77329126-77329148 CTGTCTGTCCTGAAGCAAGTGGG + Exonic
1119790880 14:77348814-77348836 TTGTCTGTCCTGAGGTAGGTTGG - Intronic
1120716095 14:87842181-87842203 TTCTCTGTCCTGAAGGAGGTAGG - Intronic
1120815791 14:88856584-88856606 ATGACTGTCCTGATGTAAGTAGG - Intronic
1122411944 14:101530024-101530046 TTGTTTTTTGTGAGGTAGGTAGG - Intergenic
1124344151 15:28910295-28910317 GTTTCTGTCCTCAGGTGGGTGGG + Intronic
1126704732 15:51396668-51396690 TTATCTGTCCTCAGGAAGCTAGG + Intronic
1128706815 15:69842682-69842704 TGGCCTGGCATGAGGTAGGTGGG + Intergenic
1129272756 15:74428117-74428139 TGGTCTTTCCTCAGGTGGGTTGG - Intronic
1130210031 15:81914368-81914390 TTGTCTGTCCTGAGATACCTAGG - Intergenic
1135503290 16:23015426-23015448 TTTTCTGCCCTCAGGCAGGTAGG - Intergenic
1135640636 16:24116864-24116886 TTTTCTGTCCTGGGGCAGCTGGG + Intronic
1143276009 17:5711395-5711417 GTGTCTTTCCAGAGGTAGGTGGG - Intergenic
1143361209 17:6372825-6372847 TTGTCTGCCCTAAGGTTGCTGGG - Intergenic
1149324886 17:55519877-55519899 TTGTAGGTCCTGAAGTATGTGGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151092857 17:71462522-71462544 TTGTCCTCCCTAAGGTAGGTGGG - Intergenic
1153203778 18:2674352-2674374 TTGCATTTCCTGAGGTATGTAGG + Intronic
1162185824 19:8904020-8904042 TTCTCGGACCTGAGGAAGGTAGG + Exonic
1162186198 19:8906834-8906856 TTCTCGGACCTGAGGAAGGTAGG + Exonic
1165965115 19:39570879-39570901 CTGTCTGTCCTGGGAAAGGTGGG - Intergenic
1166339517 19:42129339-42129361 GTGTCTGACCTGAGGAAGGTGGG - Intronic
1166451555 19:42906699-42906721 GTGTCTGGCCTGAGAAAGGTAGG - Intronic
1166463798 19:43014893-43014915 GTGTCTGGCCTGAGAAAGGTAGG - Intronic
928550550 2:32366518-32366540 TAGTCTGTCCTTAGGAATGTTGG + Intronic
929485321 2:42348021-42348043 TTGTCTGTCACAAGGTAGGGAGG + Intronic
931925142 2:67064334-67064356 TTCTCTGTCCAGAAGTAGGTGGG - Intergenic
935328724 2:101961058-101961080 CTGGCTGTGCTGCGGTAGGTGGG + Intergenic
940932746 2:159454075-159454097 TTGTCTGACCTGAGGAAGTGAGG + Intronic
941779898 2:169432542-169432564 TAGTCTGTCCTGGGGCTGGTGGG - Intergenic
942167477 2:173255904-173255926 ATGTGGGTCCTGAGGTAAGTGGG - Intronic
1171097628 20:22347027-22347049 TTGTCTGTCCAGAGGGAAATAGG - Intergenic
1173228151 20:41174028-41174050 TGGGCTGGCCTGGGGTAGGTGGG + Intronic
1183252648 22:36741234-36741256 TTGGCTGTGGTGAGGCAGGTGGG + Intergenic
1184804494 22:46784392-46784414 TTATCTGAATTGAGGTAGGTGGG + Intronic
953543503 3:43843205-43843227 TTGTCAAACCTGAGTTAGGTTGG - Intergenic
954580322 3:51699715-51699737 ATGTGGGTCCTCAGGTAGGTGGG - Intronic
955469823 3:59274846-59274868 TGGTCAGTTATGAGGTAGGTGGG - Intergenic
955790834 3:62587473-62587495 TGGTCTGGCCTGAGAGAGGTAGG + Intronic
956822439 3:72965948-72965970 TTCTCTTTCCTGTTGTAGGTGGG + Intronic
957795126 3:84994481-84994503 TTCTGTGTCCTTAGGTAAGTAGG + Intronic
958491025 3:94773571-94773593 TTGTGTGTATTTAGGTAGGTTGG + Intergenic
959272557 3:104231621-104231643 TAGTCTGGCCTTAGGTAGGAGGG + Intergenic
962120488 3:132555534-132555556 TTGTCTGTCTTGAATTAGGGAGG + Intergenic
962864904 3:139440333-139440355 CAGTCTGTCCTGAGGTATGGTGG + Intergenic
966055673 3:175685859-175685881 TTGCCTTTCCTAATGTAGGTGGG - Intronic
967241400 3:187443173-187443195 TAGTCTGTCGTCAGGCAGGTAGG + Intergenic
969178532 4:5419342-5419364 GTCTCTGTCCTGAGGCAGTTTGG + Intronic
970662941 4:18306485-18306507 TTGTCTTCCATGAGGTGGGTGGG + Intergenic
976752039 4:88458436-88458458 TTTTCAGTACTGAGGTAGGAGGG + Intronic
979993943 4:127408624-127408646 CTGTCTGTAGTGAGGTAGGGAGG - Intergenic
981046303 4:140267995-140268017 TGGACTGTCCTGAAGTCGGTTGG - Intronic
981915915 4:150033019-150033041 TCATCTGTCCTGAGGAAGGAGGG + Intergenic
984206822 4:176795141-176795163 TTGTTTGTCTTAAGGTTGGTCGG + Intergenic
985026615 4:185745093-185745115 TGGCTTGTTCTGAGGTAGGTGGG + Intronic
988106021 5:26749083-26749105 TCTTCAGTCCTGAGGTTGGTGGG + Intergenic
990435636 5:55788692-55788714 TTCTCTGTTCTGAGGTATTTAGG + Intronic
992631034 5:78680852-78680874 GTGACTGTCATGAGGTGGGTGGG + Intronic
993405110 5:87501915-87501937 TTGTATGTCATGAGGTCAGTAGG - Intergenic
995330967 5:110945589-110945611 TTCTCTGTCCTGAGGCATTTGGG + Intergenic
996505862 5:124266983-124267005 TTATATTTCCTGAGGAAGGTGGG - Intergenic
997052812 5:130402716-130402738 TTGTTTAGACTGAGGTAGGTAGG + Intergenic
997414760 5:133717583-133717605 TTGTTTGCCCTGGGGTTGGTGGG - Intergenic
1000502711 5:162071827-162071849 TAGTCTATCCTGAGGTAGACTGG + Intronic
1003014897 6:2460438-2460460 TTGTTTGTCTTGAGGTAGACTGG - Intergenic
1003799494 6:9647483-9647505 TTGTCTGTACTGATGTTTGTTGG - Intronic
1004672320 6:17809253-17809275 TTGTGTGTGCTGAGGGAGGGTGG + Intronic
1006638169 6:35474889-35474911 GTGTGTGTGCTGGGGTAGGTGGG + Exonic
1006726539 6:36203050-36203072 TTCTTTTTCCTGAGGTAAGTGGG + Intronic
1007468885 6:42075255-42075277 TGGTCTGGCCTGAACTAGGTTGG + Intronic
1008459327 6:51749858-51749880 TTGTGTGTCCTTTGCTAGGTAGG + Intronic
1008944713 6:57085318-57085340 TGGTCTGTAGTGCGGTAGGTAGG - Intergenic
1009658882 6:66583684-66583706 TTGTGTGTCCTGAGATAAGGAGG - Intergenic
1010269096 6:73901099-73901121 TGGTCTGTGCTGTGGTAGGCAGG - Intergenic
1012007813 6:93736703-93736725 TTGTGTGACTTGAGGTGGGTAGG + Intergenic
1014122193 6:117738410-117738432 TTGTCAGTCCTGAAGCAGCTGGG + Intergenic
1015217917 6:130771155-130771177 TTTTCTGTCCTGATTTAGATTGG - Intergenic
1017067328 6:150541045-150541067 TTGTATGTGCTGAGATAGATTGG - Intergenic
1017757720 6:157543788-157543810 TCTTGTGTCCTGAGGTAGGAAGG + Intronic
1018753981 6:166832289-166832311 TTGGCTGTGCTGAGGAAGTTGGG + Intronic
1019868141 7:3732166-3732188 TTCTCTGTGTTGAAGTAGGTAGG + Intronic
1020150952 7:5681242-5681264 TTGGATTTCCTGAGGTAGGGAGG - Intronic
1022995143 7:35747661-35747683 TTGTCTGTCAGGATTTAGGTGGG - Intergenic
1031010074 7:116517068-116517090 TTTTCAGTCTTGAGTTAGGTAGG + Intergenic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1034735539 7:153426010-153426032 TTGTCTGACTTCAGGTGGGTGGG - Intergenic
1037379597 8:18270505-18270527 GTATCTGTCCTCAGGTAAGTGGG + Intergenic
1038374499 8:27025152-27025174 TTGTCTTTCCTCAGGAAGGATGG - Intergenic
1038670001 8:29575282-29575304 TTGTATGTCCTGAGGGGGGTTGG - Intergenic
1042108099 8:65349950-65349972 TTCTCTGCCCTCAAGTAGGTTGG + Intergenic
1043917290 8:85937651-85937673 GGCTCTGTCCTGGGGTAGGTGGG - Intergenic
1043980071 8:86627752-86627774 TTGTGTGCCCTGAGGCAGGATGG + Intronic
1045584175 8:103512627-103512649 TTCTCTACCCTGAGTTAGGTAGG - Intronic
1047564652 8:126030697-126030719 TTGCCTGTGGTGAGGTATGTGGG + Intergenic
1049321153 8:141997086-141997108 TTGTCGGGCCTGAGGGAGGGAGG + Intergenic
1056971978 9:91212840-91212862 ATGTCTGTCCTGACAAAGGTAGG - Intergenic
1058041797 9:100310678-100310700 TTGGGAGTCTTGAGGTAGGTGGG - Intronic
1062483202 9:136762013-136762035 TAGTCTGTTCTGGGGGAGGTGGG + Intronic
1187234328 X:17452847-17452869 TTTTCTGAGCTGTGGTAGGTTGG + Intronic
1187400579 X:18956352-18956374 TTATCTGTTCTGAGGTCTGTTGG + Intronic
1190285523 X:48958501-48958523 CTGTCTGTCCCAAGGTTGGTCGG - Intergenic
1190753314 X:53380611-53380633 GAGTCTATCCTGAGGTAGGGCGG - Exonic