ID: 1119793568

View in Genome Browser
Species Human (GRCh38)
Location 14:77376469-77376491
Sequence CAACCCGGGTGGGGGCCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119793568 Original CRISPR CAACCCGGGTGGGGGCCGAG AGG Intronic
901489436 1:9589122-9589144 CAGCCCGGGTCCCGGCCGAGGGG - Intronic
901524022 1:9807944-9807966 CATCCCAGGTGGGGGTCAAGGGG + Intronic
901658189 1:10782575-10782597 CCAGCAGGGTGGGGGCCGGGTGG + Intronic
901673073 1:10867217-10867239 CAGCCCGCGCGGGGGCCGTGAGG + Intergenic
902360686 1:15941224-15941246 CCACCAGGCTGGGGGCCCAGAGG - Intergenic
903145890 1:21371808-21371830 GAACCAGGCTGGGGGCCTAGGGG + Intergenic
904097508 1:27992262-27992284 GGACCTGGGTGGGGGGCGAGAGG + Intronic
904607099 1:31704024-31704046 CACTCCGGGTGGGGGAAGAGAGG + Exonic
905207682 1:36352162-36352184 CACCCCTGGTGAGGGCCCAGCGG - Intronic
905282644 1:36859078-36859100 CAACACTGGTGGGGGCTGTGGGG + Intronic
905692802 1:39955398-39955420 CACCCCGCGTGGAGGGCGAGGGG + Intronic
914871004 1:151473610-151473632 CAACCCGGGAGGGAGCGGCGAGG + Intergenic
915234421 1:154470065-154470087 CTGCCCAGGTGGGGGCCCAGAGG - Intronic
917329702 1:173868558-173868580 CAGCCCGGCCGGGGGCCAAGGGG - Intronic
920367855 1:205457411-205457433 CAAGCCGGGTGGCGGGGGAGGGG - Intergenic
920647932 1:207816900-207816922 CTTCCCGGCTGGGGGCCGTGAGG + Intergenic
1064318545 10:14280181-14280203 CAAAGCGGATGGGGGCAGAGTGG + Intronic
1065141893 10:22726068-22726090 CAGCCCTGGTGTGGGCCGGGAGG - Intergenic
1069849684 10:71396874-71396896 CGAGCGGGGCGGGGGCCGAGCGG + Intergenic
1070537056 10:77387027-77387049 GAACCCGGGAGTGGGCTGAGGGG + Intronic
1071875227 10:89837320-89837342 CACCACGCCTGGGGGCCGAGAGG - Intergenic
1076031635 10:127164065-127164087 CAACCTGGGTGGCGTCCCAGGGG + Intronic
1077471937 11:2767929-2767951 CCAACAGGGTGGGGGCCCAGTGG - Intronic
1079090430 11:17476725-17476747 CCACCCGGTAGGCGGCCGAGTGG + Exonic
1080783615 11:35454324-35454346 CAACCCTGGGGTGGGCCTAGGGG - Intronic
1082102403 11:48183552-48183574 AAACCTGGGTGTGGGCCCAGAGG + Intergenic
1083762612 11:64826883-64826905 AAACCAGGCTGGGGGCCCAGTGG - Intronic
1083966923 11:66048940-66048962 AGACCGGGATGGGGGCCGAGAGG - Intronic
1084189977 11:67494446-67494468 ACACCGGGGTGGGGGCCTAGAGG + Intronic
1089554868 11:119310717-119310739 CAAAACGGGCGGGGGCGGAGGGG + Intronic
1092145801 12:6213845-6213867 TAGCCCTGGTGGGGGCCAAGAGG - Intronic
1092527317 12:9317148-9317170 CAACCAGGGATGGGGCCGGGTGG + Intergenic
1092539959 12:9414625-9414647 CAACCAGGGATGGGGCCGGGTGG - Intergenic
1094513080 12:31107839-31107861 CAACCAGGGATGGGGCCGGGTGG + Intergenic
1096070810 12:48774573-48774595 CAACCAGGGATGGGGCCCAGTGG + Intronic
1097246926 12:57611859-57611881 CGGCCCGGGTGGGGGGCGCGGGG + Intronic
1099613976 12:84912282-84912304 CAATCAGGGTGGGGGGCGACAGG - Intronic
1101118124 12:101551836-101551858 CAGCCAGGGTGAGGGGCGAGGGG - Intergenic
1105745667 13:23375328-23375350 TAACGCGGGTGGAGGCCGCGCGG - Intronic
1107014115 13:35695249-35695271 CAGCCCGGGAGGGGCCAGAGAGG - Intergenic
1108653785 13:52509170-52509192 CAACCCAGGTGGGGGAGAAGGGG - Intergenic
1112506535 13:99979653-99979675 CCACCCGGGCGGTGGCCCAGCGG - Intergenic
1115399292 14:32939260-32939282 CCACCCGGGAGGGGGGAGAGAGG + Intronic
1118843333 14:69528389-69528411 CACCCCGGGAGAGTGCCGAGGGG - Exonic
1119793568 14:77376469-77376491 CAACCCGGGTGGGGGCCGAGAGG + Intronic
1120549756 14:85855697-85855719 AAACCAGGGTGGGGGCGGTGGGG + Intergenic
1122581963 14:102777075-102777097 CAGGCCGCGTGGGGGCCGAGAGG - Intergenic
1122886509 14:104712769-104712791 CACCCCGGGTGGTGCCCGCGCGG + Intronic
1124920680 15:34023218-34023240 CAACCTGAGTGGGGGATGAGAGG - Intronic
1128866038 15:71115738-71115760 GAAGCCGGGTCGGGGCCGCGCGG - Intronic
1130908697 15:88256837-88256859 CAGCCCGGGCGGGGGGCGGGGGG - Intergenic
1130968636 15:88715717-88715739 CCACCAGGGTGGGGTCCTAGAGG - Intergenic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1142116353 16:88358126-88358148 CAAGCCGGCTGGGGGCCTGGGGG - Intergenic
1142961364 17:3554307-3554329 TAACCCGGCTGGGTGCAGAGTGG + Intronic
1143625916 17:8110063-8110085 GACCCCGGGTGGGGGCCCAGCGG - Intronic
1143970585 17:10792339-10792361 CAGCCAGGGTGAGGCCCGAGGGG + Intergenic
1145279571 17:21457812-21457834 CCACCGGGGTGAGGGCAGAGAGG - Intergenic
1147575206 17:41594941-41594963 CAGCCCAGCTGGGGGCAGAGGGG + Intergenic
1147918158 17:43900756-43900778 TAACCCGGGTGGGAGAAGAGTGG + Intronic
1151694532 17:75707395-75707417 CAACCCCGGGGGGAGCCCAGTGG - Exonic
1151894192 17:76969135-76969157 CTGCCCGGGGCGGGGCCGAGCGG + Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1157624791 18:49042304-49042326 CATCCCGGGTGGGGTCCCAGAGG - Exonic
1160040104 18:75337434-75337456 GAAAAAGGGTGGGGGCCGAGGGG + Intergenic
1160684446 19:426992-427014 CAGCCCGGGTGTGGGCACAGGGG + Intronic
1160912860 19:1482881-1482903 CAACACGGGTGAGGGCGGGGCGG - Exonic
1160917948 19:1506704-1506726 CAGCCAGGGTGGGGGATGAGTGG - Intronic
1161206912 19:3046421-3046443 CAGCCCGGTTGGGGGCGGGGAGG - Intronic
1161401507 19:4067698-4067720 CCACCCGGCTGCGGGCCGCGGGG + Intergenic
1162410376 19:10502208-10502230 GCACCAGAGTGGGGGCCGAGTGG - Intronic
1162947830 19:14054484-14054506 AAAGCCCGCTGGGGGCCGAGGGG - Exonic
1163302829 19:16458444-16458466 CAAGCGGGGTGGGGGCGGGGCGG - Intronic
1163577905 19:18121539-18121561 GAACCCAGCTGGGGGCAGAGTGG + Intronic
1165247360 19:34505147-34505169 CAGCCTGGGTGGGGGCTCAGAGG + Exonic
1166978773 19:46620755-46620777 CAAGCCTGGTGGGGGACCAGCGG + Exonic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
931890153 2:66662291-66662313 CAACTCAGGTGGCGGTCGAGGGG + Intergenic
937183187 2:120013715-120013737 CGTCCCGGGTGGGGGCGGGGCGG - Intronic
945978496 2:216289231-216289253 CAACTTGGGTGGGGGGCGGGTGG - Intronic
946029464 2:216693295-216693317 CAACCCGGGGGCGGGGCAAGCGG + Intronic
948822637 2:240557761-240557783 CACCCCAGGGAGGGGCCGAGGGG - Intronic
1172245459 20:33442893-33442915 CAACCAAGGTGGGTGCAGAGGGG - Intronic
1176039120 20:63055128-63055150 CAACCCCAGTGGGGACTGAGAGG + Intergenic
1178992735 21:37368004-37368026 CCACACTGGTGGGGACCGAGAGG - Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1179707297 21:43189001-43189023 CAGACCCGGTGGGGGCCGGGAGG - Intergenic
1180067154 21:45418231-45418253 CATCCCTGGTGGGGGCAGAGGGG + Intronic
1180844079 22:18972060-18972082 CAGCCCTGGTGGGTGCGGAGTGG - Intergenic
1182024683 22:27108872-27108894 CAGCCAGGGTGGGGGCGGGGGGG - Intergenic
1183665132 22:39242541-39242563 CCTCCCGGGTGCGGGCCGCGGGG + Intronic
1184656151 22:45943230-45943252 GAGCCCGGGTGGGGTCCGGGTGG - Intronic
1184678002 22:46053928-46053950 CACCCCGGGTGGGCGCAGGGTGG + Exonic
1185047678 22:48537199-48537221 CACCCGGGGTGGGGGCAGGGTGG + Intronic
950154239 3:10709655-10709677 CAACCCAGGTGGGGAAGGAGTGG - Intergenic
950345176 3:12287235-12287257 CAACATGGGTGGGGACGGAGTGG - Intergenic
950759282 3:15206288-15206310 CAAGCCGGGTCTGGGCTGAGGGG + Exonic
959574481 3:107919532-107919554 CAACCTGAGTGGGGGCCGAAGGG + Intergenic
959849661 3:111071757-111071779 CGACGCGGGCGGGTGCCGAGGGG + Exonic
960257550 3:115527200-115527222 CAACCGGGGTGGGGGGAGAGGGG - Intergenic
962685076 3:137839833-137839855 CACCCGGGGTGGGGGTGGAGTGG + Intergenic
966390946 3:179451615-179451637 CAGCCCGGGCGGGGGGCGAAGGG + Intergenic
966941823 3:184752712-184752734 CAGCCCAGGTGGGGGCCTGGAGG + Intergenic
968593611 4:1471743-1471765 CACCTCGGGTGGGGACCGTGTGG + Intergenic
968916802 4:3500208-3500230 AAGCCCCGGTGGGGACCGAGAGG - Intronic
969490145 4:7494948-7494970 CTGCCCGGCTGGGGGCAGAGTGG + Intronic
973717315 4:53690080-53690102 AGACCTGGGTGGGGGCTGAGAGG - Intronic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
981550782 4:145938456-145938478 AAACCCCCGTGGGGGCAGAGAGG + Exonic
985536002 5:466073-466095 CATCCCGGGTGGGGACAGTGGGG + Intronic
986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG + Exonic
992195691 5:74336745-74336767 CAGCAGGGGTGGGGGCTGAGGGG + Intergenic
998222950 5:140302861-140302883 TAAACGGGGTGGGGGGCGAGCGG - Intronic
999089982 5:148927510-148927532 TAAGCTGGGTGGGGGCCCAGAGG - Intronic
999663993 5:153893982-153894004 CCAGCCGGGTGGGGCCCCAGAGG - Intergenic
1001581211 5:172799804-172799826 CAACCCATGTGAAGGCCGAGCGG + Intergenic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1003944668 6:11063953-11063975 CAACCTGGGTGCAGGCCAAGGGG - Intergenic
1003963294 6:11229360-11229382 CAGCCCGGGCGGGGGCTCAGCGG - Intronic
1007812199 6:44494457-44494479 CAACCGGGTTGGTGGCCGAGTGG + Intergenic
1012126501 6:95434555-95434577 GAACCCGGGTAGGGGGAGAGGGG + Intergenic
1013085084 6:106849914-106849936 CAACCCAGTTGGAGGCAGAGGGG - Intergenic
1014045347 6:116877683-116877705 CTACTGGGGTGGGGGCGGAGGGG - Intronic
1015440364 6:133241029-133241051 CGGCCCGGGTGGGGGCGGGGTGG + Intronic
1020106545 7:5424711-5424733 CAGCCCGGGCCTGGGCCGAGCGG - Intronic
1022814998 7:33905209-33905231 CAGCCCGGGCGGCGGCTGAGCGG + Intronic
1024521029 7:50304338-50304360 CGATCCGGGAGGCGGCCGAGAGG + Intronic
1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG + Intergenic
1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG + Intergenic
1034263764 7:149772148-149772170 AAACCGGGGTGGGGGAGGAGAGG - Intronic
1034405308 7:150898928-150898950 CATCCCAGGTGGAGGCCGTGAGG - Intergenic
1035564595 8:633050-633072 CAACCAGTGTGGGGCCCGCGCGG + Intronic
1037805668 8:22056879-22056901 CAAGGAGGGTGGGGGCCCAGAGG + Intronic
1039212873 8:35236010-35236032 CCAACCGGATGGGAGCCGAGTGG + Intronic
1039227071 8:35400068-35400090 CAACCCTGGTGATGGCTGAGTGG + Intronic
1040568442 8:48587457-48587479 CAACCCTGGTGGGGGCTGTGAGG + Intergenic
1045539637 8:103071311-103071333 CAACACGGGGAGGGGCCGGGAGG - Exonic
1049109974 8:140636101-140636123 GAGCCAGGCTGGGGGCCGAGGGG - Intergenic
1056373519 9:85983662-85983684 CACGGCGGGTGGGGGCCAAGGGG + Intronic
1059453282 9:114384013-114384035 CAACCCAGGCTGGCGCCGAGTGG - Intronic
1060189291 9:121582030-121582052 CACCACGGTTGGGGGCCGTGGGG + Intronic
1060280785 9:122214182-122214204 CCACCCGGGTCCGGCCCGAGGGG + Intronic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1187483133 X:19676346-19676368 CTACCTGGGTGGGGGCTGGGTGG + Intronic
1198683383 X:139204466-139204488 CAACCCCCGGGGCGGCCGAGAGG + Intronic
1200292367 X:154885882-154885904 CAACCGGGGTGGGGACGGAGAGG + Intronic
1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG + Intergenic
1200347264 X:155459073-155459095 CAACCGGGGTGGGGACGGAGAGG - Intergenic