ID: 1119797774

View in Genome Browser
Species Human (GRCh38)
Location 14:77414776-77414798
Sequence TACAGTATGCTGTATAATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119797774_1119797776 -2 Left 1119797774 14:77414776-77414798 CCACTATTATACAGCATACTGTA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1119797776 14:77414797-77414819 TAATGTCTATAACACATTGTGGG 0: 1
1: 0
2: 1
3: 16
4: 204
1119797774_1119797775 -3 Left 1119797774 14:77414776-77414798 CCACTATTATACAGCATACTGTA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1119797775 14:77414796-77414818 GTAATGTCTATAACACATTGTGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119797774 Original CRISPR TACAGTATGCTGTATAATAG TGG (reversed) Intronic
906263726 1:44412422-44412444 ATCAGTATGCTGAATCATAGTGG + Exonic
908089880 1:60674851-60674873 TACAGGATGCTGTATATAGGAGG - Intergenic
909246854 1:73297813-73297835 TTCAGTATGCTGCAAAATACTGG + Intergenic
909500772 1:76332784-76332806 TAAAGTATACTGTATAATTTAGG - Intronic
909654050 1:78010732-78010754 TAAAGTATGCTGTGTGTTAGTGG + Intronic
910319193 1:85924784-85924806 AACACTATGCTGAATAAGAGTGG - Intronic
911964870 1:104354025-104354047 TATAGAATACTGTAGAATAGTGG - Intergenic
912245863 1:107961195-107961217 TATACTATGCTTTATAGTAGGGG - Intronic
913031216 1:114904736-114904758 GCCAGTATGCTGAATAACAGTGG + Intronic
914219674 1:145668600-145668622 AACACTATGCTGAATAAGAGTGG + Intronic
919158910 1:193803391-193803413 TTCAGAAGGCTGTATTATAGAGG + Intergenic
921497049 1:215854449-215854471 TTCAGTATGTTGAATAAAAGTGG - Intronic
924115822 1:240745370-240745392 TACAGCATTCTTTATAAGAGAGG - Intergenic
1063235105 10:4106000-4106022 CCCAGTATTCTGTTTAATAGTGG - Intergenic
1066785950 10:39004463-39004485 AACAGTATGTTGAATAAGAGTGG + Intergenic
1069166132 10:65162234-65162256 CACATTTTGCTGTATAATGGTGG - Intergenic
1072102752 10:92245059-92245081 TACAGTATGCTGCAAATCAGTGG - Intronic
1078042468 11:7881045-7881067 TTGCGTATTCTGTATAATAGTGG + Intergenic
1080351537 11:31390814-31390836 TACACTATTCTGAAAAATAGAGG + Intronic
1080996524 11:37608773-37608795 CACAGTATGCTTTATACTACTGG + Intergenic
1082264121 11:50101462-50101484 TACAGTAGCCAGTACAATAGTGG + Intergenic
1085364100 11:75922296-75922318 TACAGTATTTTGTATAAAATAGG + Intronic
1086013533 11:82135983-82136005 TCCAGTATGCTGTAAAATTCAGG - Intergenic
1088617807 11:111649111-111649133 TACAGTATGCTGAAATATAAGGG - Intronic
1092628208 12:10350796-10350818 TTCAGTATGATGTAAAATAAAGG + Intergenic
1095914845 12:47467432-47467454 TACATTATACTGTATAGTACAGG - Intergenic
1096995643 12:55836356-55836378 TACAGTAGTCTGTATAATAAGGG - Intronic
1098761114 12:74426249-74426271 CAAAGTATGCTGTGTCATAGGGG + Intergenic
1099782300 12:87212145-87212167 TACAGTTTGTTTTTTAATAGTGG - Intergenic
1099902379 12:88727704-88727726 TTCAGTATGGTGCTTAATAGAGG + Intergenic
1108369627 13:49755416-49755438 TATACTATGTTGAATAATAGTGG - Intronic
1110231104 13:73168446-73168468 TACAGGAAGCTGAGTAATAGAGG - Intergenic
1110768143 13:79304023-79304045 AACAGTATGCTGAATAGGAGTGG - Intergenic
1111840785 13:93448354-93448376 TACAGTATGCTATATCATCTAGG + Intronic
1114003945 14:18291084-18291106 TACAGTAAGAATTATAATAGAGG - Intergenic
1115891563 14:38035501-38035523 TTAAGTTTGCTGTATAATATGGG + Intronic
1116565107 14:46434933-46434955 TACAGTAAGCTGAAAGATAGAGG + Intergenic
1116725613 14:48558270-48558292 TAAAGTCTGTTGTATAATTGAGG + Intergenic
1117589250 14:57249727-57249749 TACAGAATGATGGATAAGAGTGG + Intronic
1119797774 14:77414776-77414798 TACAGTATGCTGTATAATAGTGG - Intronic
1120605544 14:86571601-86571623 TACAAAATTCAGTATAATAGAGG - Intergenic
1125776907 15:42224131-42224153 AACAGTATGGTTTATGATAGGGG + Intronic
1126231334 15:46329406-46329428 TACTGTATGATGTATAGTAGAGG + Intergenic
1127596701 15:60490363-60490385 CACAATATGCTGTATAATACCGG - Intronic
1131120414 15:89819476-89819498 TACAGCATGATTTAAAATAGGGG + Intergenic
1133229286 16:4359071-4359093 TACAGTATGATTTTTAATAATGG + Intronic
1133666208 16:7970681-7970703 TACAGTATCTTGTATAATTGGGG - Intergenic
1134890364 16:17836374-17836396 TTCAGTATACTGTATTATGGAGG - Intergenic
1135092937 16:19535775-19535797 TACGGTATCCTGTATCACAGGGG - Intronic
1138126565 16:54443608-54443630 TACAGTGTGTTGTGTAACAGTGG + Intergenic
1140767135 16:78170204-78170226 TAAAACATGCTGTATTATAGTGG + Intronic
1141256437 16:82406652-82406674 TACAGTCTTATTTATAATAGTGG - Intergenic
1151892484 17:76958832-76958854 TACAGTCTCCTGTCTAGTAGTGG + Intergenic
1153087871 18:1308879-1308901 TACATTATGCAGGATAAAAGAGG - Intergenic
1153144703 18:2017859-2017881 TATAATATGCTGTATCATAAAGG - Intergenic
1154533832 18:15376731-15376753 TACAGTAAGAATTATAATAGAGG + Intergenic
1158866863 18:61646366-61646388 TACAGTATTCTGTGGAATAAAGG + Intergenic
1163065694 19:14792488-14792510 TGAAGTATGCTGTATAGTAATGG + Intronic
1165388064 19:35523351-35523373 TACACTATGCTGTCTCATTGTGG - Exonic
925895266 2:8466488-8466510 TACATGATGCTGTATATTTGAGG - Intergenic
928966875 2:36985047-36985069 TACAGTATCCGGTATAAGAATGG - Intronic
930463920 2:51720420-51720442 AATAGTATGCTGTATATTACTGG + Intergenic
930548591 2:52801962-52801984 TGTAGTATACTGTATAATAGTGG - Intergenic
934132065 2:88957727-88957749 TACAGAATGCAGCATAATGGTGG - Intergenic
934149461 2:89131490-89131512 TACTGAATGCGGTATAATTGTGG + Intergenic
934217834 2:90050538-90050560 TACTGAATGCGGTATAATTGTGG - Intergenic
937250993 2:120523641-120523663 TACAGTAAGCATAATAATAGTGG - Intergenic
937633257 2:124127022-124127044 AACAGTATGTTGAATAAGAGTGG - Intronic
938532580 2:132204022-132204044 TACAGTAAGAATTATAATAGAGG + Intronic
942204536 2:173606861-173606883 AAGAGAATGCTTTATAATAGTGG + Intergenic
942493464 2:176513094-176513116 TACAGGATGCTGAATACTGGAGG + Intergenic
943851458 2:192728333-192728355 TATGGTAGGCGGTATAATAGAGG + Intergenic
944889672 2:204104216-204104238 TACACTATGCTATATATCAGTGG + Intergenic
945267225 2:207902364-207902386 TAAAGTATGTTGTTTAAAAGTGG + Intronic
1177326518 21:19597019-19597041 TGCAGTATGCTATATCTTAGGGG + Intergenic
1179346346 21:40561107-40561129 TACACTATGCTATTTAATATTGG - Intronic
1180428459 22:15221887-15221909 TACAGTAAGAATTATAATAGAGG - Intergenic
1180511068 22:16090232-16090254 TACAGTAAGAATTATAATAGAGG - Intergenic
1184484997 22:44771929-44771951 TCCAGTATACTGTCAAATAGAGG + Intronic
949164773 3:926124-926146 TACAGTATTCCATATAATATGGG + Intergenic
949280924 3:2345646-2345668 TTGAGTTTGCTGTCTAATAGGGG + Intronic
950301962 3:11887685-11887707 AACACTATGTTGTATAATAGTGG - Intergenic
950315371 3:11997258-11997280 TAGAGGATGCTTAATAATAGTGG + Intergenic
950596103 3:13983794-13983816 TACTGTATGCTGAATAACAGTGG + Intronic
951656527 3:25015131-25015153 TACAATATGCTGAAGAATTGAGG + Intergenic
955483741 3:59414983-59415005 CACAGTATGCTGAAGAATATGGG + Intergenic
957869427 3:86070486-86070508 TACATTATGCTTTTTAATTGTGG + Intronic
958096026 3:88945937-88945959 TACAGTATGCTTCATCATAATGG - Intergenic
958272172 3:91515313-91515335 TATAGTATGCTTTCTAATAGAGG + Intergenic
960433200 3:117595052-117595074 TTCTGTATGCTGTATACTAAAGG - Intergenic
964061239 3:152526494-152526516 TACATTATGCTATATTATATTGG - Intergenic
973594692 4:52475004-52475026 TTCAGTATGATGTTGAATAGAGG - Intergenic
973694641 4:53478271-53478293 TACATTATGCCATTTAATAGAGG + Intronic
976755760 4:88496424-88496446 GACAGTATGATGTATGATATTGG + Intronic
977613634 4:99063006-99063028 GACAGAATGCTGAATATTAGGGG + Intergenic
979673437 4:123385184-123385206 TATAGTATCCTGTAGAAGAGTGG - Intergenic
981838826 4:149087359-149087381 TACAGTATGGTGTCTGATAAGGG - Intergenic
987916347 5:24219869-24219891 TACAATATACTGTATTTTAGTGG + Intergenic
989600398 5:43195301-43195323 CTCAGGATGCTGTATAATAATGG - Intronic
989711347 5:44401063-44401085 TACTGTTTGCTGTAAAATATTGG - Intergenic
993062584 5:83057110-83057132 TGCAGTATGCTGTATAGTAATGG - Exonic
993423104 5:87726913-87726935 CACAATATTCTTTATAATAGGGG - Intergenic
994709666 5:103251833-103251855 AACACTATGCTGAATAAGAGTGG + Intergenic
996445805 5:123548915-123548937 CACAGTACGCTGTACAATATTGG + Intronic
996929355 5:128867469-128867491 TACAGTAGGATTTATACTAGTGG + Intronic
997872059 5:137514986-137515008 TACAGGATGCTGGTTAATGGGGG - Intronic
998897574 5:146816113-146816135 TACAGTATTATTAATAATAGTGG + Intronic
1008359675 6:50600627-50600649 TACAGTGTTTTGCATAATAGGGG + Intergenic
1008873099 6:56295957-56295979 TACAGTATGATATTGAATAGGGG + Intronic
1008982936 6:57505816-57505838 TATAGTATGCTTTCTAATAGAGG - Intronic
1009050470 6:58269341-58269363 TACAATATACTGTTTAAAAGGGG - Intergenic
1009171003 6:60398686-60398708 TATAGTATGCTTTCTAATAGAGG - Intergenic
1009239942 6:61173040-61173062 TACAATATACTGTTTAAAAGAGG + Intergenic
1009874144 6:69484301-69484323 AACACTATGCTGAATAAGAGTGG - Intergenic
1011582361 6:88883370-88883392 TGCAGTATGTTTTATAATAATGG - Intronic
1012384319 6:98660784-98660806 TGCAGTATTGTTTATAATAGTGG - Intergenic
1013293962 6:108742373-108742395 TCCAGAAGGCTGTATAATAATGG - Intergenic
1014245356 6:119062237-119062259 TACATTATGCTGTTTAATCATGG - Intronic
1014497828 6:122148794-122148816 TCCAGTATGATGTTGAATAGTGG + Intergenic
1014989114 6:128052228-128052250 TAAAGTATTCTGGATAATGGAGG - Intronic
1015752933 6:136579074-136579096 TTCAGAATGCTCTATAATATAGG + Intronic
1017657404 6:156643138-156643160 TACAGTATTCTTTTTAATAGAGG + Intergenic
1017657416 6:156643250-156643272 TACAGTATTCTTTTTAATAGAGG + Intergenic
1018657286 6:166050432-166050454 TACAGCAAGTTGTATGATAGTGG + Intergenic
1031509267 7:122628037-122628059 TACAGTGTGCTATAAATTAGGGG - Intronic
1031841192 7:126741796-126741818 TACAGCATGATGTTTAAGAGTGG + Intronic
1033844093 7:145411532-145411554 TGCAATAGTCTGTATAATAGTGG + Intergenic
1034464192 7:151216270-151216292 TGCACTATGCTGTATAACAAAGG + Intronic
1034699799 7:153086044-153086066 TACACAGTGATGTATAATAGCGG + Intergenic
1038030093 8:23630669-23630691 TACAGAATGCTGTGTATTTGGGG - Intergenic
1038907196 8:31918230-31918252 AACAGTATGTTGAATAGTAGTGG + Intronic
1039929851 8:41975678-41975700 TACCGAATGCTGTATTAGAGAGG - Intronic
1042076287 8:64998550-64998572 CACAGAATTGTGTATAATAGAGG - Intergenic
1044045577 8:87427392-87427414 TTCAGTAGGCTGTATAAGATGGG + Intronic
1045073520 8:98536889-98536911 TAAACTACTCTGTATAATAGTGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1047483366 8:125305948-125305970 TACAGGATGCTGCATAAGATTGG + Intronic
1048906502 8:139094269-139094291 CACAGTATGCTGTTTAAGAAAGG + Intergenic
1050648033 9:7743226-7743248 TACAAACTGCTGTATAACAGTGG + Intergenic
1053685717 9:40520037-40520059 TACAGTAAGAATTATAATAGAGG + Intergenic
1053711190 9:40810621-40810643 TACAGTAAGAGTTATAATAGAGG + Intergenic
1053935670 9:43148352-43148374 TACAGTAAGAATTATAATAGAGG + Intergenic
1054278016 9:63104924-63104946 TACAGTAAGAATTATAATAGAGG - Intergenic
1054396822 9:64660010-64660032 TACAGTAAGAATTATAATAGAGG + Intergenic
1054421100 9:64931438-64931460 TACAGTAAGAGTTATAATAGAGG + Intergenic
1054431464 9:65165214-65165236 TACAGTAAGAATTATAATAGAGG + Intergenic
1054498915 9:65856313-65856335 TACAGTAAGAATTATAATAGAGG - Intergenic
1054889725 9:70238110-70238132 AACACTATGCTGAATAGTAGTGG - Intergenic
1057762217 9:97885844-97885866 TACATAATGATGTATAATAAAGG - Intergenic
1060519421 9:124285809-124285831 TACAGTATGCTGCCCAATAGAGG - Intronic
1186140951 X:6572966-6572988 TAGAGCATGCTGAATAATAAAGG + Intergenic
1186252825 X:7687415-7687437 TTCTGTATGCTTTATAATAAGGG + Intergenic
1187352908 X:18537861-18537883 TTTAGTATGCTGTAGTATAGAGG + Intronic
1188669412 X:32865167-32865189 GACAGTATGATGCATAATACTGG - Intronic
1192986440 X:76404915-76404937 TACAGTACTCTGTATAGTATTGG + Intergenic
1193209569 X:78790092-78790114 TTCAGTATGCTGTATTCAAGAGG + Intergenic
1193315702 X:80062574-80062596 AACAGTATGTTGAATAAGAGTGG + Intergenic
1193636878 X:83961931-83961953 TACAGCAACATGTATAATAGTGG + Intergenic
1194514702 X:94837850-94837872 TCCAGTATGTTGAATAACAGTGG + Intergenic
1194752808 X:97703727-97703749 TACAATCTTCTGTATAATAATGG - Intergenic
1195810068 X:108819102-108819124 AACAGTATGTTGAATAATAGTGG + Intergenic
1196177586 X:112656887-112656909 CACAGTATGCTGTAGAGTATGGG + Intronic
1196226547 X:113174769-113174791 CACAGTATGCTGTAGAGTATTGG - Intergenic
1196233997 X:113257926-113257948 CACAGTATGCTGAATAGGAGTGG + Intergenic
1196986464 X:121278551-121278573 TAAAGTATTCTGAAAAATAGAGG + Intergenic
1197565260 X:128076246-128076268 TCCAGTATGATGTTGAATAGTGG - Intergenic
1199227111 X:145390221-145390243 TCCAGCATGTTGAATAATAGAGG + Intergenic
1200697904 Y:6377223-6377245 TACAGTATGGTGTGTAGTTGAGG + Intergenic
1200698319 Y:6380742-6380764 TACAGTTTGTTGTATTGTAGAGG + Intergenic
1201035795 Y:9783957-9783979 TACAGTTTGTTGTATTGTAGAGG - Intergenic
1201036208 Y:9787476-9787498 TACAGTATGGTGTGTAGTTGAGG - Intergenic
1202062966 Y:20907370-20907392 TGCAGTGTGCTGTATAGTAATGG - Intergenic
1202068515 Y:20966144-20966166 AACACTATGCTGAATAAGAGTGG - Intergenic