ID: 1119801820

View in Genome Browser
Species Human (GRCh38)
Location 14:77452228-77452250
Sequence TGCTACTGCTTGTGTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119801818_1119801820 18 Left 1119801818 14:77452187-77452209 CCAAGCTATATTAACACATAAAA 0: 1
1: 1
2: 18
3: 182
4: 993
Right 1119801820 14:77452228-77452250 TGCTACTGCTTGTGTAAAAATGG 0: 1
1: 0
2: 4
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119801820 Original CRISPR TGCTACTGCTTGTGTAAAAA TGG Intronic
902698367 1:18155363-18155385 TGCTCCTGCATCTGTAAAATGGG + Intronic
904569079 1:31447372-31447394 TGCTGATCCTTGTGTAAACAAGG - Intergenic
906758652 1:48348589-48348611 TGCTAGTGCTCTTGTAACAATGG - Intronic
906810774 1:48824896-48824918 TGCAACTACCTGTGTAAAACTGG + Intronic
906863073 1:49382965-49382987 TGCAACTGCTTTTTTGAAAAGGG - Intronic
907138581 1:52162932-52162954 AACTCCTGCTTGTGTAAAATTGG - Intronic
907375436 1:54034270-54034292 TGCTGCTGCTTGGGAGAAAATGG + Intronic
907696726 1:56738345-56738367 TCCTACAGCTTCTCTAAAAAGGG + Intronic
908745408 1:67371617-67371639 TTCTACTACTTGTGAATAAAAGG - Intronic
912057634 1:105624879-105624901 TGTTAGTATTTGTGTAAAAATGG - Intergenic
913075901 1:115339891-115339913 TGATACTACTTTTGTAGAAAGGG - Intergenic
915228375 1:154427987-154428009 TGCTACTGCTTGCTAATAAATGG + Intronic
918284090 1:183035130-183035152 TTCGACTGCTTCTGTTAAAAGGG + Intronic
918824432 1:189304463-189304485 TCATACAGCTTGTGCAAAAAGGG + Intergenic
919656120 1:200198837-200198859 TACTAGTGCTTGAGGAAAAAAGG + Intergenic
921243245 1:213208812-213208834 GTCTTCTGCTTGTGTAGAAAAGG + Intronic
923535901 1:234851658-234851680 TGCTTCTGATTGTGGATAAAAGG - Intergenic
923973086 1:239227065-239227087 GGCTACTGCTTGTGAAACCATGG - Intergenic
1064268573 10:13845553-13845575 TGCTACCTCGTGTGTAAAATGGG - Intronic
1064461741 10:15541221-15541243 TGACACTGCTTGTGGCAAAAAGG - Intronic
1065166181 10:22979998-22980020 TGATACTGCTTCTGCGAAAAAGG + Intronic
1065739183 10:28781629-28781651 TGCTACCATTCGTGTAAAAAAGG + Intergenic
1068720121 10:60235937-60235959 TGTTTCTGCATGTGTAAAATGGG - Intronic
1068854765 10:61786124-61786146 AGCTACTTCATGTGTAAAATGGG - Intergenic
1070078102 10:73157875-73157897 TGCCATGTCTTGTGTAAAAAAGG - Intronic
1071081579 10:81818824-81818846 TGGTAGTGCTTTTGTAAGAATGG - Intergenic
1071685592 10:87751955-87751977 TGAGTGTGCTTGTGTAAAAATGG - Exonic
1072030960 10:91521988-91522010 AGCAACTGCTTGGGTACAAAGGG - Intergenic
1072959979 10:99920620-99920642 TGCTTCTGTGTGTGTAACAAAGG + Intronic
1074216717 10:111392263-111392285 TTCTACTGCTTGTGAAACAGTGG + Intergenic
1074620143 10:115110352-115110374 TGCTAATGCTTGTTTGAAGATGG + Intronic
1077732993 11:4754624-4754646 TGATAAAACTTGTGTAAAAATGG - Intronic
1078192935 11:9108068-9108090 TGCTACTTTTTGTGTAAAGAAGG + Intronic
1078329225 11:10405750-10405772 TGCTGCTGCTTGGGGATAAAAGG + Intronic
1078622371 11:12921049-12921071 TGCTACTGTTTGTGTGATAAAGG + Intronic
1079722916 11:23842046-23842068 GGCAACTACTTGTGGAAAAAAGG - Intergenic
1083021698 11:59514213-59514235 TGCTAGTGGGTGTGTAAAATTGG - Intergenic
1085881336 11:80470481-80470503 TGCTAGTGATTGTTTAGAAAGGG + Intergenic
1086783109 11:90931365-90931387 TGCTCCTGCCTGTGTCAAAATGG + Intergenic
1088944465 11:114495558-114495580 TGCTTCTGCTTGAGGAAAGAAGG - Intergenic
1092230043 12:6771046-6771068 TGCTGCTGCTTTTGTATCAAAGG - Intergenic
1093229647 12:16528042-16528064 TGCTACTGAGTCTGTGAAAAAGG + Intronic
1095924006 12:47560457-47560479 TGATACTGCTTGTTTAGAGAAGG + Intergenic
1096004963 12:48162023-48162045 TGAACCTGCTTGTGTAAAAGTGG - Intronic
1096686037 12:53288874-53288896 TTCTATTCCTTCTGTAAAAATGG + Intronic
1098089957 12:66891178-66891200 TGCTAGTGCTTGTCTAAATATGG - Intergenic
1099988483 12:89697455-89697477 CACTTCTGCTTTTGTAAAAATGG + Intronic
1101862221 12:108492273-108492295 TGCTACTGCTGGAATAATAATGG - Intergenic
1103195758 12:119042522-119042544 TGCTTCTGCTTGTGTAAGGCTGG - Intronic
1103393633 12:120591607-120591629 AGCTACTGCTCTTGTAAGAATGG + Intergenic
1103596715 12:122028706-122028728 TGTTTCTGCATCTGTAAAAAGGG + Intronic
1103630588 12:122256999-122257021 TGCTACTACTTGTACAAAAGTGG + Intronic
1103860598 12:124009840-124009862 TGCTACCGTTTCTGCAAAAAAGG - Intronic
1108965983 13:56302454-56302476 TGCTATTGTTTGTTCAAAAAAGG + Intergenic
1109829718 13:67771081-67771103 TGCATCTTCATGTGTAAAAATGG - Intergenic
1110234385 13:73201224-73201246 TGGTTCTGCTTGAGTAAAAGGGG - Intergenic
1111730093 13:92064015-92064037 TGCTTCTTCTGGTTTAAAAATGG - Intronic
1112751406 13:102587549-102587571 TACTACAATTTGTGTAAAAAAGG + Intergenic
1113245196 13:108387678-108387700 TGCTTCTGCATGTGTGAAGAAGG + Intergenic
1113284634 13:108832468-108832490 TTCTTCTGCTTGTGAAAAAGAGG - Intronic
1114358844 14:21947100-21947122 TGCTACTGCTTGATGAAAAGGGG + Intergenic
1114720618 14:24877474-24877496 TGCTACCTTTTGTGTAAGAAAGG - Intronic
1114874159 14:26694813-26694835 TGCAAATGCTTTTGTAAACAAGG + Intergenic
1116309390 14:43303595-43303617 AGCTACTCCATCTGTAAAAAAGG + Intergenic
1116968415 14:51039223-51039245 TGCTACTGAGAGTGTTAAAATGG + Intronic
1117305597 14:54470436-54470458 TGTTACTGCTTTTTTAAAGAAGG + Intergenic
1117625937 14:57638184-57638206 AGCTATTGCTTGTGGAACAAGGG - Intronic
1118135402 14:63020441-63020463 TAGTACTCCTTGTGTAAATATGG - Intronic
1118284279 14:64457370-64457392 TGCTACTGCTTGTGACCACATGG + Intronic
1119442530 14:74637864-74637886 TGCTCCTGCTTCTGTAAAAATGG + Intergenic
1119801820 14:77452228-77452250 TGCTACTGCTTGTGTAAAAATGG + Intronic
1120161979 14:81155700-81155722 TGGCAGTGCTTGTGTAAGAAGGG - Intergenic
1120709907 14:87782199-87782221 TTTTACTGCTCATGTAAAAATGG + Intergenic
1121674767 14:95743350-95743372 TGCTTCTTCATCTGTAAAAATGG - Intergenic
1124692151 15:31832879-31832901 TGCTACTGCTGCTATAAACACGG + Intronic
1126169706 15:45685019-45685041 TGGTACTGTTTGAATAAAAATGG - Intronic
1126507324 15:49420431-49420453 TGCTACCTTTTGTATAAAAAGGG + Intronic
1126989480 15:54355961-54355983 TGCTACTATTTGTGTAAAAAAGG - Intronic
1129203368 15:74019628-74019650 TGCTACCTTTTGTGTAAGAATGG - Intronic
1129358389 15:75008386-75008408 TGCTACCCCTTATGTAAGAAAGG - Intronic
1130184110 15:81662696-81662718 TGCTATTGTTTGTATAAACAGGG + Intergenic
1130188409 15:81708566-81708588 TGCTATTGTTTGTATAAACAGGG + Intergenic
1130333073 15:82936192-82936214 TGCTACCGCATGTGCAGAAAGGG - Intronic
1130337625 15:82970848-82970870 AGCTCCTGTTTGTCTAAAAATGG + Intronic
1131605358 15:93897949-93897971 TACTAATGCTTGTGTACAAACGG + Intergenic
1131713731 15:95085331-95085353 TGCTACTCCTTGTGCAAGAGAGG + Intergenic
1135237036 16:20766873-20766895 TGCTACCTGTTGTGTAAAATTGG + Intronic
1135286086 16:21194460-21194482 TGCTTCCGCATCTGTAAAAAGGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136415851 16:30103128-30103150 TGCTACTGTCTATGTAAACATGG - Intergenic
1138101968 16:54259330-54259352 TGCTACCTTTTGTGTAAGAAGGG + Intronic
1139720712 16:68851102-68851124 TGCTACCTTTTGTGTAAAAATGG - Intronic
1144361008 17:14492769-14492791 GGTTAATGCTTCTGTAAAAAGGG - Intergenic
1144469756 17:15527665-15527687 TGCTGCTTCATCTGTAAAAATGG + Intronic
1144715531 17:17432878-17432900 GGCTACTTTTTGTGTAAAAAGGG - Intergenic
1144926587 17:18815995-18816017 TGCTGCTTCATCTGTAAAAATGG - Intergenic
1145095006 17:20017695-20017717 TGCTACTATTTGTGCAAAAAAGG - Intronic
1145225634 17:21125886-21125908 TGCTATTGTTTGTGTAACAAGGG + Intronic
1148342799 17:46883631-46883653 TGCTACTTATTGTGTAGCAAGGG - Intronic
1148642667 17:49200121-49200143 TGCTACCGTTCGTGTAAAAAGGG + Intergenic
1148773495 17:50080009-50080031 GGCCCCTGCTTGTGTAAACAGGG - Intronic
1149310324 17:55386837-55386859 TACTACTGCTTCTGTACAGAGGG + Intergenic
1154994085 18:21623332-21623354 TGTTACTGCTTTTGTTAAGATGG - Intronic
1156895938 18:42245459-42245481 TGCTACCATTTGTTTAAAAAAGG + Intergenic
1156974443 18:43200664-43200686 TACTACTGATTGTTTAACAAGGG - Intergenic
1157660443 18:49437255-49437277 TGCTATGGTTTGTTTAAAAAGGG - Intronic
1158817314 18:61118047-61118069 TGCTACTGACTGTGTAACCATGG - Intergenic
1160273204 18:77406882-77406904 TGCTGCTACTTGTTTTAAAACGG - Intergenic
1160352101 18:78192296-78192318 TGCTACTGCCTGAATAAACAAGG + Intergenic
1164761183 19:30729550-30729572 AGCTACTGCCTGTGTAGAAGGGG + Intergenic
1164965388 19:32478639-32478661 TGCCACTTCTTCTGTAAAAATGG - Intronic
926965847 2:18409865-18409887 AGAAACTGATTGTGTAAAAAAGG + Intergenic
927418149 2:22901488-22901510 TGCTATTGGTTGTCTAAACATGG + Intergenic
927517992 2:23683065-23683087 TGCTTCTGCATCTGTAAAATGGG - Intronic
932092732 2:68820829-68820851 TACTACATTTTGTGTAAAAAAGG - Intronic
932236503 2:70124975-70124997 TACTAATGCTTGTGTAAATTGGG + Intergenic
933014939 2:77113332-77113354 TACTTCTCCTTGTGTTAAAATGG - Intronic
934111582 2:88748194-88748216 GGCTACCGCTAGTGTAAAAAGGG - Intronic
935509825 2:103957690-103957712 TTCTACTGCATGTGTTAGAAAGG + Intergenic
936274561 2:111083242-111083264 TGTTTCTTCATGTGTAAAAAGGG + Intronic
936987395 2:118324407-118324429 TGCTACTCCTTGAGAAATAATGG + Intergenic
939711281 2:145523119-145523141 TACTACTGCCTTTCTAAAAATGG - Intergenic
942387058 2:175453402-175453424 TGCTTCTGGTTATGTTAAAATGG + Intergenic
942571125 2:177315573-177315595 TGCAACTTCATTTGTAAAAAGGG - Intronic
945934902 2:215893348-215893370 TGCTACTGTTTATCTAAGAATGG + Intergenic
946478875 2:220034412-220034434 TGGTCCAGCTTGTGCAAAAATGG + Intergenic
946926662 2:224633248-224633270 TACTCCTGTTTGTGTAGAAATGG + Intergenic
1170262889 20:14431055-14431077 TACAACAGCTTATGTAAAAAAGG - Intronic
1174229598 20:49034429-49034451 TGCTGCAGCTTGTGTAAAAGTGG + Exonic
1177510484 21:22080578-22080600 TTATACTTCTTTTGTAAAAATGG + Intergenic
1178105496 21:29314600-29314622 TGCCACCGCTTTTTTAAAAATGG - Intronic
1178964321 21:37101507-37101529 TGTTACTGTTTTTTTAAAAAGGG - Intronic
1179005368 21:37509247-37509269 TGGTACTATTTGTGTACAAAGGG - Intronic
1181656997 22:24310083-24310105 TGCCACCTTTTGTGTAAAAAAGG - Intronic
1181956498 22:26590902-26590924 TGCTTCTTCATGTGTAAAATTGG + Intronic
1182365882 22:29778960-29778982 TGTTACTGCTTTTGTACTAAGGG + Intergenic
1183543263 22:38441971-38441993 AGCTACCATTTGTGTAAAAAAGG + Intronic
1183982645 22:41551003-41551025 TGTTACCATTTGTGTAAAAAAGG + Intergenic
1185192694 22:49448658-49448680 TACTCCTGCCTGTGTAACAAGGG - Intronic
949613166 3:5724700-5724722 TGCTACTATTTGTGTAAAAATGG + Intergenic
951468531 3:23030352-23030374 TGTTGCTGTTTGAGTAAAAATGG - Intergenic
955361940 3:58283202-58283224 TGCTACTTCATGGCTAAAAAGGG - Intronic
955464267 3:59219895-59219917 TGCTACTGTTTGTAAAAAACAGG - Intergenic
955863173 3:63354205-63354227 TGCTATTGCTTGCATAAATAAGG + Intronic
956527141 3:70177734-70177756 TGCAACTTCTTCTGTAAAATGGG - Intergenic
958589174 3:96132505-96132527 TGCTACTGTTAGTGTTGAAAAGG - Intergenic
960472022 3:118077207-118077229 TGATACTTCTTGTTTAAATAAGG - Intergenic
960682061 3:120259594-120259616 TGCTACCTTTTGTGTAAGAAAGG + Intronic
960930695 3:122846097-122846119 TACTACTGGTTTTTTAAAAAAGG + Intronic
965284454 3:166800225-166800247 TGCAAGTGCTTCTGTGAAAAAGG - Intergenic
965621083 3:170642839-170642861 TGCTACTGTTTGTGTGAAAATGG - Intronic
965921260 3:173917363-173917385 AGTTACTTCTTTTGTAAAAATGG + Intronic
966252158 3:177878083-177878105 TGTTACTGATTTAGTAAAAATGG - Intergenic
966579682 3:181546284-181546306 TCCTACTGCCTGTGTAATTATGG - Intergenic
968709329 4:2101722-2101744 GGCTGCTGCTTGTGGAACAAGGG + Intronic
974282182 4:59810510-59810532 TGCTGCTGCTGCTGCAAAAATGG + Intergenic
975229744 4:71918437-71918459 AGCTACTGTTATTGTAAAAATGG + Intergenic
979060521 4:116053889-116053911 TTATACTGATTGTGAAAAAAAGG - Intergenic
979666683 4:123318491-123318513 TACTAGTACTTTTGTAAAAAGGG - Exonic
979667309 4:123326429-123326451 TGCTACTGTCAGGGTAAAAAAGG - Intergenic
981305499 4:143242736-143242758 TGGTAATGCTTGTGTAAAGAAGG - Intergenic
982045437 4:151440633-151440655 TGCTACTGTTTGTGTACCCAGGG - Intronic
986751158 5:10789002-10789024 TGCTGCTTCTTCTGTAAAATAGG + Intergenic
988153329 5:27415943-27415965 TGCTACTGGTTTTGCAACAAGGG - Intergenic
990636379 5:57732361-57732383 TTCTACTGCTTGAAAAAAAAGGG + Intergenic
990825947 5:59897742-59897764 TGCTACTTCATTTGTAAAGATGG + Intronic
992267140 5:75030656-75030678 TGCTAATCCCTGTGTGAAAATGG - Exonic
993731410 5:91427322-91427344 TACTACCATTTGTGTAAAAAAGG + Intergenic
994162025 5:96567559-96567581 GGCTGCTGCTTGTGTAAACAGGG + Intronic
995830748 5:116352782-116352804 TGTGATTGCTTGTGTAGAAAGGG + Intronic
996172865 5:120316369-120316391 TGCTTCTGCTTGGTTAAAAGGGG + Intergenic
998324457 5:141267346-141267368 TGCTTCTGCTGGGATAAAAAAGG - Intergenic
998353373 5:141515302-141515324 TGCTGGCGCTTGTGTATAAAGGG - Exonic
998592789 5:143495850-143495872 TGCTACTGCTTGCATAAAATTGG - Intergenic
999015634 5:148101345-148101367 TTCTTCTGCTTGGCTAAAAAAGG - Exonic
999466722 5:151814013-151814035 TGCAACTGAGGGTGTAAAAAAGG + Intergenic
1000141512 5:158408871-158408893 AGCTATTGCTTGTGCAAATAAGG - Intergenic
1001913187 5:175538073-175538095 TGCTATTGTTTCTGTAAAAGAGG + Intergenic
1002257109 5:177966132-177966154 CGCAACTGCTTGTGGAAACACGG - Intergenic
1006531142 6:34655452-34655474 TGCTACCATTTGTATAAAAAAGG - Intronic
1006722121 6:36162410-36162432 TGCTACATTTTGTGTAACAAAGG - Intergenic
1006734168 6:36260658-36260680 TGCTACCATTTGTGTAAAAAAGG - Intronic
1007807729 6:44463057-44463079 TGTTACTGCTTGAGTAAAAGGGG + Intergenic
1008040066 6:46788178-46788200 TTCTACTGCTTCTGAAATAAGGG - Intergenic
1009496548 6:64356010-64356032 TGTTACTGCTTTTGCAGAAAGGG - Intronic
1010273393 6:73940705-73940727 TGCTATTGCCTGTGTAAACATGG - Intergenic
1010740924 6:79503447-79503469 TTCTACTGTTTTTTTAAAAAAGG - Intronic
1015116410 6:129654490-129654512 TGCTACTCCATGTGAAAAATAGG - Intronic
1017890099 6:158630931-158630953 AGCTGCTGCTTCTGTAAAACGGG - Intronic
1019665097 7:2247919-2247941 TGCTTCTACTTGGGTATAAATGG - Intronic
1020468868 7:8512783-8512805 TGCTTATGCATGTGTAGAAAAGG + Intronic
1022398892 7:30017033-30017055 TGCTTCTTTTTGTGTAAGAAAGG + Intronic
1022438243 7:30410503-30410525 TGCTACTGCTTGCTATAAAATGG + Intronic
1022578083 7:31517970-31517992 TGTTACTGTGTGTGTTAAAAGGG + Intronic
1023645177 7:42304591-42304613 TGCCACCTCTTGTGTAAAAAAGG - Intergenic
1024330929 7:48154693-48154715 TGCTTTTGCTTTTGTAAAGATGG + Intergenic
1024846980 7:53657165-53657187 TGCCAGTGCTTGAGGAAAAATGG + Intergenic
1024939800 7:54750575-54750597 TGCAATTGCTTTTTTAAAAAAGG + Intergenic
1030001693 7:105071069-105071091 TGCTACTGCTTACCTAAATAAGG - Intronic
1031944260 7:127822236-127822258 TGCTAGTATATGTGTAAAAAGGG - Intronic
1036287198 8:7453480-7453502 TGCTATTGCTTACATAAAAATGG - Intronic
1036334283 8:7858043-7858065 TGCTATTGCTTACATAAAAATGG + Intronic
1036920259 8:12846608-12846630 TGCTACAGATTGTATCAAAATGG + Intergenic
1038585944 8:28789584-28789606 TTCCACTGCTTGTTCAAAAAAGG + Intronic
1039098870 8:33919042-33919064 TGCTGCTTTTTGTGTAATAAAGG + Intergenic
1041810764 8:61906766-61906788 TGCTATTGTATGTGTTAAAATGG + Intergenic
1041909476 8:63073128-63073150 TGGTAATGATTTTGTAAAAATGG + Intronic
1042547945 8:69967365-69967387 GGCTACTTTTTGTGTAATAAAGG + Intergenic
1043572655 8:81622611-81622633 TACAACTCCTTGTGTAAATAGGG + Intergenic
1044092352 8:88017509-88017531 AGCTGCTGCTTGTGTTGAAAAGG - Intergenic
1044098691 8:88102219-88102241 TGCCACTGCTTGTCTGAAGAGGG - Intronic
1044606841 8:94055252-94055274 TACTACTGTTTGTATAAAAAAGG + Intergenic
1045379554 8:101609724-101609746 TGCTACCATTTGTGTAAAATAGG + Intronic
1046400676 8:113699661-113699683 TACTACTTCATGTGTAACAAAGG + Intergenic
1047912411 8:129544723-129544745 CTCTACTGCTTCTGTAAAACAGG - Intergenic
1049068786 8:140340743-140340765 GGCTACTGCATGTGTAGGAAGGG - Intronic
1049650031 8:143761612-143761634 AGCTAATGCTTTTTTAAAAATGG - Intergenic
1050571639 9:6946098-6946120 TGGTATTGCTTGTGTAATCAAGG + Intronic
1051222768 9:14867747-14867769 TGCTGCTGCTTCTGGAAAAATGG - Intronic
1051421350 9:16892488-16892510 TGCTACCTTTTGTGTAAAAAAGG + Intergenic
1056330775 9:85519461-85519483 TGCTACTGCTTGTGTACCAGGGG + Intergenic
1059041286 9:110818107-110818129 TTATCCTGCTTGTTTAAAAAAGG + Intergenic
1060686673 9:125620771-125620793 TGCTACATGTTGTGTAAAAGGGG + Intronic
1061111660 9:128576635-128576657 TTCTATTTCTTATGTAAAAAGGG - Intronic
1062226376 9:135454625-135454647 TGCTATAGCTAGTGGAAAAATGG - Intergenic
1186759105 X:12704582-12704604 TGTTACTGCTTCTGAAAATATGG - Intronic
1188274480 X:28182834-28182856 AGCTACCGCTTGAGAAAAAAAGG - Intergenic
1188290558 X:28382433-28382455 TTCTACTGCTAATGTAAAAGTGG - Intergenic
1188695581 X:33186212-33186234 AGCTACTGCTTTTGTAAATCTGG + Intronic
1189291825 X:39891539-39891561 TGCTACCTTTTATGTAAAAAAGG - Intergenic
1194858069 X:98958483-98958505 TGCTTCTGCTTGCATAAAAGTGG - Intergenic
1197114194 X:122813220-122813242 TGCAATAGCATGTGTAAAAAGGG - Intergenic
1197161440 X:123327157-123327179 TGCCACTTCTTATTTAAAAATGG - Intronic
1197727250 X:129784627-129784649 TGCCACTGATTGTGTAAACTGGG - Intronic
1198000653 X:132432120-132432142 TGCTACTATCTGTGTGAAAATGG + Intronic
1201341072 Y:12935278-12935300 TTTTAATGCTTGTTTAAAAAAGG + Intergenic