ID: 1119802015

View in Genome Browser
Species Human (GRCh38)
Location 14:77454131-77454153
Sequence CTTTAGGGAGAGACCCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119802015_1119802021 29 Left 1119802015 14:77454131-77454153 CCTTTCTGGGTCTCTCCCTAAAG 0: 1
1: 0
2: 1
3: 24
4: 235
Right 1119802021 14:77454183-77454205 CTAACTGATCCCAAAAATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119802015 Original CRISPR CTTTAGGGAGAGACCCAGAA AGG (reversed) Intronic