ID: 1119805651

View in Genome Browser
Species Human (GRCh38)
Location 14:77480389-77480411
Sequence CCAAATCCTCAGGGTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119805642_1119805651 19 Left 1119805642 14:77480347-77480369 CCACTTCTGATCTGAGGGAGCTG 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 173
1119805641_1119805651 20 Left 1119805641 14:77480346-77480368 CCCACTTCTGATCTGAGGGAGCT 0: 1
1: 0
2: 2
3: 18
4: 144
Right 1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119805651 Original CRISPR CCAAATCCTCAGGGTGTGCA GGG Intronic
900307550 1:2018726-2018748 CCAGATCCTAGGGGTGTGGAGGG + Intergenic
900536164 1:3178837-3178859 GCAAGTCCTCAGGGGATGCAGGG + Intronic
901813036 1:11778605-11778627 CCTCACCCTCAGGCTGTGCAGGG - Intronic
902318627 1:15643408-15643430 CCAAAGCCTTGGGGTGTGCTTGG + Intronic
902516018 1:16990034-16990056 CCAACTCTCCAGGGTGGGCAGGG - Intronic
902617295 1:17630773-17630795 CCAAATGCCCAGGGTGTGCCAGG - Intronic
904947960 1:34213157-34213179 CCCATTCCCCAGGGTGTGCCCGG - Intronic
906525773 1:46492374-46492396 CAAAATCCACAGTGTGTGCGTGG - Intergenic
907030474 1:51166168-51166190 CCATTTCCTGAGGGTGTGGAGGG - Intergenic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
909383125 1:75024199-75024221 CCAAACCCTCATGTTGTTCAAGG - Intergenic
909517140 1:76523752-76523774 CCAAATATTGAAGGTGTGCAGGG - Intronic
910330555 1:86068403-86068425 CCAAATCCTCCCGCTGTGCCAGG - Intronic
911190117 1:94940150-94940172 CCAAATCCCCATGTTGTTCATGG + Intergenic
911521603 1:98936511-98936533 CCTGATCCTCAGGATGTGCATGG + Intronic
912308341 1:108594097-108594119 CTAAGTCCTCAGGCTGGGCACGG - Intronic
913199626 1:116485190-116485212 CCAAGCCCTCAGGATGGGCAGGG + Intergenic
913989393 1:143596455-143596477 TCAAATACTCAGGTTGTTCATGG + Intergenic
915099923 1:153491751-153491773 CCAAGTCCTTGGGGTTTGCAGGG - Intergenic
915268713 1:154736678-154736700 TTTAATCCTCAGGGTTTGCAGGG - Intronic
915300119 1:154946922-154946944 CCAAATCCTCTGGGTGTTCCAGG - Intronic
915300605 1:154949427-154949449 CCAAATCCTCTGGGTGTTCCAGG - Intronic
1065806433 10:29397491-29397513 CCAAATCCACAAGATGTGCAGGG - Intergenic
1065873857 10:29980194-29980216 CCAAATCCCAAAGATGTGCAAGG + Intergenic
1065942736 10:30579647-30579669 CCAAATCCACAAGATCTGCAGGG + Intergenic
1067898523 10:50212852-50212874 GCAAATGCTCAGGTTGTGCTGGG - Intronic
1069506964 10:69008131-69008153 TTAAATCCTCAGGCTGGGCAAGG + Intronic
1069558558 10:69413754-69413776 CCCAAGCATGAGGGTGTGCATGG - Intronic
1071521825 10:86336319-86336341 CCAATTCCTAAGCGTGTGCTTGG - Intronic
1072025581 10:91452656-91452678 CAAAGTCCTGAGGGGGTGCAGGG - Intronic
1073393795 10:103201343-103201365 CTAAAGCCTCAGGCTGGGCATGG + Intergenic
1073854762 10:107661679-107661701 CCATTGCCTCAGGCTGTGCAGGG - Intergenic
1074898798 10:117799333-117799355 TCAAATCCAGAGGATGTGCAAGG + Intergenic
1074960149 10:118437305-118437327 AGAAATCCTCTGGATGTGCAGGG - Intergenic
1075076658 10:119356254-119356276 ACAAATTCTCAGGGTGTGGAGGG + Intronic
1076558858 10:131347953-131347975 CCGAAGCCTCAGTGTGTGCCTGG + Intergenic
1077608099 11:3625820-3625842 CCAAATTCTCAGGCTGCTCAGGG - Intergenic
1081156117 11:39693236-39693258 CCTAATCCTCATGTTGTTCAAGG + Intergenic
1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG + Intronic
1085121490 11:73970176-73970198 CCACAGCCTCAGGGTGTGCAGGG + Exonic
1085367016 11:75957847-75957869 CCAAATCCTCAGTATCTCCAAGG - Intronic
1089737268 11:120558295-120558317 TAAAACCCTCAGGCTGTGCACGG + Intronic
1089938895 11:122394883-122394905 TTAAATCCTCAGGATGTGTAAGG + Intergenic
1090921322 11:131208382-131208404 CCAAATGGTCAGGATGTGAAGGG + Intergenic
1091193306 11:133712068-133712090 CCAAATGCACAGGGAGTGGATGG + Intergenic
1092491065 12:8945523-8945545 CTACATCTTCAGGGTGTGCCGGG - Exonic
1094853351 12:34392139-34392161 CCAAAGCATCATGGTGTGGAAGG + Intergenic
1104386564 12:128356110-128356132 CCAAACCCTAAGGGTGTTCAAGG - Intronic
1104714147 12:131005529-131005551 CTAAATCCTCTGCGTGTGGAGGG + Intronic
1104787475 12:131459031-131459053 CCAGATCCGCAGGGAGGGCAGGG - Intergenic
1110009747 13:70317235-70317257 CCAAAACCTCACAGTGTTCAAGG - Intergenic
1111150594 13:84249290-84249312 CCAAATCCTCTGTATGTACAGGG - Intergenic
1111566998 13:90029144-90029166 CCAGGCACTCAGGGTGTGCAGGG + Intergenic
1112342685 13:98565754-98565776 CCACCTCCTTAGGGTGGGCATGG - Intronic
1114225563 14:20735020-20735042 CCAATCCCTGAGGATGTGCATGG - Intronic
1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG + Intronic
1120850473 14:89164713-89164735 CCGTATCCTCAGCGTGTGCCCGG - Intronic
1124530285 15:30499730-30499752 CCATTTCCTCAGGCAGTGCAGGG - Intergenic
1124768374 15:32507958-32507980 CCATTTCCTCAGGCAGTGCAGGG + Intergenic
1131915213 15:97257739-97257761 CCAAAACTTCACTGTGTGCAAGG + Intergenic
1134257134 16:12621759-12621781 CCAAATCCCCAAGGAGTGCTGGG - Intergenic
1135026912 16:19005839-19005861 TCATATCCTCAGGGTGTGCCAGG + Intronic
1136066468 16:27762169-27762191 CCAGACCCTCTGGCTGTGCAGGG - Intronic
1138676421 16:58654759-58654781 GCAAATGCTCAGTGTGTACAAGG - Intergenic
1138934792 16:61705982-61706004 CCAATTCTTAAGGGTGTGCCTGG + Intronic
1139392886 16:66616610-66616632 GCAAATACTCAGGGTTTGAAGGG - Exonic
1139634420 16:68249282-68249304 CCAAATCACCAGGGACTGCAGGG - Exonic
1139962365 16:70725326-70725348 CCAAATCACCAAGGTGTCCAAGG - Intronic
1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG + Exonic
1140657331 16:77154204-77154226 CCAGATCCACAGAGTGTACATGG + Intergenic
1141657082 16:85422114-85422136 CCATGTCCCCAGGGTGTGCCCGG + Intergenic
1143493147 17:7295127-7295149 CCGCAGCCCCAGGGTGTGCAGGG - Intergenic
1143962835 17:10734849-10734871 CCAAATCCTGAAGGTCTTCAGGG + Intergenic
1144693824 17:17287593-17287615 CAAAATTCTAAGGGTGTGAAAGG - Intergenic
1144968757 17:19093980-19094002 CCATGTGCTCAAGGTGTGCAGGG - Exonic
1144979159 17:19158086-19158108 CCACGTGCTCAAGGTGTGCAGGG + Exonic
1144989063 17:19220146-19220168 CCACGTGCTCAAGGTGTGCAGGG - Exonic
1146662667 17:34674971-34674993 CCAGGTCCCCAGGGTGAGCAGGG + Intergenic
1148882160 17:50737448-50737470 CCAAATCCTGAGCCTGTCCAGGG - Intronic
1149658007 17:58320353-58320375 CCTATTTCTCAGGGTGGGCACGG - Intronic
1149686309 17:58537347-58537369 CCAACTCATCAGGGTTTGCCTGG - Intronic
1152430929 17:80247990-80248012 CCAAGTCCTCAGGGGCTGCTTGG + Intronic
1154052585 18:10974966-10974988 ACAAGTCCTCAGGGTGGACAGGG - Intronic
1156021638 18:32606286-32606308 GCAAATCCTCATGCTGTGCTGGG - Intergenic
1157801743 18:50626775-50626797 CCAAATCCTCAAGATGTTCAGGG + Intronic
1159222555 18:65483393-65483415 ACAAAAGCTCAGGGTGTTCAAGG - Intergenic
1160718458 19:587031-587053 CCAAACACTCAGGGTGGGGAGGG - Intergenic
1161461371 19:4399904-4399926 CAAAATCCTCTGGATGGGCAAGG - Intronic
1162633083 19:11944214-11944236 CCTAATTCTCAGGGAGTGCCTGG + Intronic
1163364273 19:16867525-16867547 CCACCTCCTCAGAGTGTCCAAGG - Intronic
1164460538 19:28443849-28443871 CCAAATCCTGCGGCTGGGCATGG + Intergenic
1164945246 19:32288019-32288041 CCAAGTCCTCAGGCTGTGGGAGG - Intergenic
1165601309 19:37057381-37057403 CCAAAGCCTCAGGGGTTGCCTGG + Intronic
1166888672 19:45976450-45976472 CCAAATCCTGGGGGACTGCAGGG + Intergenic
927210936 2:20638627-20638649 CCAGATCCCCAGGGGCTGCAGGG - Exonic
928432558 2:31233150-31233172 CAAAATGCTCAGCATGTGCAGGG - Intronic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
932227306 2:70052791-70052813 TCAAATCCTGCAGGTGTGCAGGG - Intergenic
933410039 2:81913804-81913826 CCATAGACTCAGGGTGGGCATGG + Intergenic
935208218 2:100915048-100915070 CCTAATGCTCAGATTGTGCAAGG + Intronic
935738363 2:106124994-106125016 CCAAACCAGCTGGGTGTGCAAGG - Intronic
935849369 2:107201594-107201616 CCAAATCCTTATGGTAAGCATGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936155375 2:110043359-110043381 CCTAATCCTCAGGATCTGGAAGG + Intergenic
936189305 2:110328054-110328076 CCTAATCCTCAGGATCTGGAAGG - Intergenic
944012185 2:194985075-194985097 TCACATCCTCAAGGCGTGCAGGG + Intergenic
946357334 2:219196281-219196303 CAAACTCCTCAGACTGTGCAGGG + Intronic
948161319 2:235827290-235827312 CTGAAACCTCAGGGTGAGCAAGG - Intronic
1169053843 20:2603666-2603688 TCAAATCCTCAGTGTTTTCAAGG - Intronic
1169312297 20:4554405-4554427 CCAATTTCTCAGTGTTTGCAAGG + Intergenic
1169850404 20:10042845-10042867 CCAAATACTCAGGGTCAACAGGG + Intronic
1170528502 20:17265680-17265702 CCAAATTCTCATGGTTTGTAAGG + Intronic
1171487428 20:25494724-25494746 CCATGTCCTCAGGGTTTCCACGG - Intronic
1173510569 20:43624913-43624935 CCAAATGCCCAGGATGTGCTGGG - Intronic
1173586100 20:44184627-44184649 CCTAGTCCACAGGGTGTACATGG - Intronic
1175122004 20:56722962-56722984 CCAAAGCCTTTGAGTGTGCAAGG + Intergenic
1175221054 20:57416660-57416682 CCTCATCCTCAGGGTGGGCAGGG + Intergenic
1175337784 20:58207235-58207257 CCAGCTCCTCAGGGTGGGCCCGG - Intergenic
1175768796 20:61609697-61609719 CCTAATCCAGTGGGTGTGCATGG + Intronic
1177597151 21:23259437-23259459 CCAAACCCTCACATTGTGCATGG - Intergenic
1177946596 21:27478568-27478590 CCTAATCCTCATGTTGTTCAAGG + Intergenic
1177998441 21:28131366-28131388 CCATGTCCTAAGGCTGTGCAGGG + Intergenic
1178750601 21:35299112-35299134 CCAAATTCTCAGCGGGAGCATGG + Intronic
1183897190 22:40978743-40978765 GCAAATCCTCTGGGTGGGTAAGG - Intergenic
1184350011 22:43937276-43937298 CCCACTCCTCGGGGTGAGCACGG + Intronic
1184357957 22:43995331-43995353 CCAAATCCTCAGCTTGGGCAAGG + Intronic
954433394 3:50483307-50483329 CCAGCTCCTCAGGGTCTCCAAGG - Intronic
956119428 3:65951246-65951268 ACAAGTCCTCAGGGTCTGCTGGG - Intronic
958989347 3:100824326-100824348 CCAAATCCTCAGTGGGCCCAAGG + Intronic
959112353 3:102136831-102136853 CCAAAGCCACAGAGTATGCAGGG - Intronic
961484264 3:127206532-127206554 CCCCATCCTCAGGGTGTCCTAGG - Intergenic
962128736 3:132650010-132650032 CCAAATACTCAGTGTTTCCATGG - Intronic
965501158 3:169457756-169457778 CCAAATCCTCAGTGAGGGCCTGG - Intronic
966544439 3:181129482-181129504 CCAAATCCTCAGCCTCTCCAAGG + Intergenic
966855515 3:184191323-184191345 CCAGATCCTCAGGCTGTAAAGGG + Intronic
968248185 3:197176693-197176715 CATATTCCTCAGTGTGTGCATGG - Intronic
968743139 4:2341294-2341316 CCAGATCCTCCAGGGGTGCACGG + Intronic
969470554 4:7385120-7385142 CCAAAGCCCTAGGGTCTGCAGGG + Intronic
970812757 4:20114484-20114506 ACAATTACTCAGGGTGTGAAAGG - Intergenic
976207888 4:82639632-82639654 CCAGGTCCTCAGCCTGTGCAGGG - Intronic
980501440 4:133659476-133659498 CCAAATACTCATCCTGTGCAGGG - Intergenic
983589280 4:169389824-169389846 CCAAATCCCCAAGTTGTTCAAGG - Intergenic
987717339 5:21589197-21589219 CTAGATCCTCAGGATATGCAGGG + Intergenic
987917214 5:24229239-24229261 CTAAATCCTCAGAGTGTGAGAGG - Intergenic
988157749 5:27476857-27476879 GCAAATACTCAGGGTGTGTGAGG - Intergenic
995390407 5:111634485-111634507 CCCAACCCTCAGGCTGTGGATGG + Intergenic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1006295238 6:33167307-33167329 TCAAATCTTCAGGGTCAGCAAGG - Exonic
1006514008 6:34536061-34536083 CCCCAACCTCAGGGTGTGCCAGG + Intergenic
1007033474 6:38650866-38650888 CCAAAGCTTCAGGCTGGGCATGG - Intergenic
1008631486 6:53366386-53366408 CCAAGTCCTGAGGCTGTACAGGG + Intergenic
1010803484 6:80206058-80206080 CCAAATTCTAAAGGTGTGAATGG + Intronic
1014450055 6:121572087-121572109 CCATGTCCTGAGGCTGTGCAGGG - Intergenic
1015069776 6:129077951-129077973 CCAAACCCGCAGGACGTGCAAGG + Intronic
1016128678 6:140437857-140437879 CCAAATTAACAGGGTGTGGATGG + Intergenic
1016823733 6:148369139-148369161 AGAAATCATCAGCGTGTGCAAGG + Intronic
1021958986 7:25853544-25853566 CCAGATCCTTAGTGTCTGCAGGG - Intergenic
1023042370 7:36182974-36182996 CCAGAGCTACAGGGTGTGCATGG - Intronic
1023242329 7:38161457-38161479 CCAAAACCTGAGGGTGCACAAGG - Intergenic
1023404399 7:39816876-39816898 CCAAATCTTCCGGATGTGTATGG + Intergenic
1024644553 7:51360278-51360300 CCAAGGCCTCAGGGTCTGCTTGG + Intergenic
1024868347 7:53931190-53931212 TCAAATCCTGAGGGTGTGCCAGG + Intergenic
1025109009 7:56197025-56197047 CCAAGTGCTCAGGGTGGTCAGGG - Intergenic
1027137639 7:75636594-75636616 CCAATTCCCCAGGGTGGGTAAGG + Intronic
1032060061 7:128716776-128716798 CCAAATGCTCAGGTTGTGCCTGG + Intronic
1032516290 7:132508633-132508655 CCACCTCCTCATGGTGGGCATGG - Exonic
1033285112 7:140034828-140034850 CCAAATCCTCAGGATGAGTATGG - Intronic
1034074788 7:148221343-148221365 CAACATCCTCTGAGTGTGCAAGG - Intronic
1037361090 8:18074680-18074702 CCAAATCCTCAGTGTTTAAATGG - Intronic
1040807304 8:51408696-51408718 CCGGAACCACAGGGTGTGCATGG + Exonic
1043939541 8:86181459-86181481 CCCAATCCCCAGGGTGAGCTTGG + Intergenic
1044530782 8:93305009-93305031 CCTAATCCTCATGCTGTTCAAGG + Intergenic
1048864047 8:138746277-138746299 GCACATGCTCAGGCTGTGCAAGG - Intronic
1050363825 9:4855765-4855787 CCAACTCCTCAGCCTGTCCAAGG - Intronic
1052423973 9:28279712-28279734 CCAAATCCTCAATATCTGCAAGG + Intronic
1053448664 9:38173647-38173669 CTACACACTCAGGGTGTGCATGG - Intergenic
1054744330 9:68839501-68839523 CCTAATCCACAGGGTGTTTAAGG - Intronic
1054769578 9:69071045-69071067 CAACCTCCTCAGGGTGCGCAAGG - Intronic
1056341246 9:85634499-85634521 CCAAATTCTTATAGTGTGCAAGG - Intronic
1056966293 9:91165339-91165361 CCAAATCATCAGGGGGCGCGGGG + Intergenic
1062205636 9:135335325-135335347 CATCATCCTCAGGGTGAGCAGGG + Intergenic
1062219093 9:135404705-135404727 ACAAATCCCCAGGGAGTGGAGGG - Intergenic
1062656520 9:137606637-137606659 CCACAGCCTCAGGCGGTGCAGGG - Intronic
1186528865 X:10275434-10275456 CCAAATCCTGAGTGTATGCTCGG - Intergenic
1186764127 X:12753560-12753582 CCAAAGCCTCAGAGCGGGCAGGG + Intergenic
1187074004 X:15915987-15916009 CCAAATATGCAGGGTATGCAAGG - Intergenic
1194737515 X:97530227-97530249 CCAAATCCTTAAGCTGTTCATGG + Intronic
1197856025 X:130914961-130914983 CCAACTCCTGAGGGGCTGCAAGG + Intergenic
1200039676 X:153356002-153356024 CCAACTCCCCAGGGTGTCCTCGG + Intronic
1201944702 Y:19499161-19499183 CCAAAACCTCAACGTGTCCAGGG - Intergenic