ID: 1119806840

View in Genome Browser
Species Human (GRCh38)
Location 14:77487747-77487769
Sequence CCCTCTTCTGGCATCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 336}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119806840_1119806855 16 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806855 14:77487786-77487808 GGAAGGGGAGGCGGCAGTCAAGG 0: 1
1: 1
2: 7
3: 56
4: 638
1119806840_1119806853 4 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806853 14:77487774-77487796 GGAGCGAGACAGGGAAGGGGAGG 0: 1
1: 1
2: 17
3: 251
4: 2084
1119806840_1119806854 7 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806854 14:77487777-77487799 GCGAGACAGGGAAGGGGAGGCGG 0: 1
1: 1
2: 13
3: 190
4: 1859
1119806840_1119806851 0 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806851 14:77487770-77487792 TAGGGGAGCGAGACAGGGAAGGG 0: 1
1: 1
2: 9
3: 79
4: 671
1119806840_1119806852 1 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806852 14:77487771-77487793 AGGGGAGCGAGACAGGGAAGGGG 0: 1
1: 1
2: 6
3: 159
4: 1351
1119806840_1119806848 -6 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806848 14:77487764-77487786 AGAGGGTAGGGGAGCGAGACAGG 0: 1
1: 0
2: 1
3: 40
4: 572
1119806840_1119806849 -5 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806849 14:77487765-77487787 GAGGGTAGGGGAGCGAGACAGGG 0: 1
1: 0
2: 3
3: 46
4: 690
1119806840_1119806850 -1 Left 1119806840 14:77487747-77487769 CCCCAGGAGATGCCAGAAGAGGG 0: 1
1: 0
2: 5
3: 31
4: 336
Right 1119806850 14:77487769-77487791 GTAGGGGAGCGAGACAGGGAAGG 0: 1
1: 0
2: 13
3: 125
4: 1215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119806840 Original CRISPR CCCTCTTCTGGCATCTCCTG GGG (reversed) Intronic
900397389 1:2458651-2458673 GCCTCCTCAGGCATCTCCTCCGG - Intronic
900912588 1:5612135-5612157 CCCTTTTCCTGCAGCTCCTGTGG - Intergenic
901183267 1:7356252-7356274 CCCTCTGCAGGCAGTTCCTGGGG + Intronic
901424688 1:9174412-9174434 TCCTCTTCTGTAAACTCCTGGGG + Intergenic
904082953 1:27883481-27883503 CCATCTTCTGGAACCTTCTGTGG + Intronic
904268677 1:29333747-29333769 CGTGCTTGTGGCATCTCCTGAGG - Intergenic
905301615 1:36989734-36989756 TCTTCTTCCTGCATCTCCTGTGG + Intronic
905972841 1:42154369-42154391 CCCTCATCTGACATCTCCCGTGG - Intronic
906292191 1:44626494-44626516 CCCAGTTCAGGCCTCTCCTGTGG - Intronic
906659548 1:47572874-47572896 CCCACTCCTGGCAGCTCATGTGG - Intergenic
906673229 1:47675504-47675526 ACCTCTGCTGTCACCTCCTGGGG - Intergenic
908050504 1:60224700-60224722 CGCTTTACTTGCATCTCCTGGGG + Intergenic
909673188 1:78211688-78211710 CTGTCTCCTGGCCTCTCCTGGGG + Intergenic
910008885 1:82435965-82435987 TTTTCTTCTGGCATCTCCAGAGG - Intergenic
910875738 1:91876078-91876100 ACCTCTTCTAGCACCTCATGGGG + Intronic
912552383 1:110492547-110492569 CCATCTGGGGGCATCTCCTGGGG + Intergenic
912879049 1:113390735-113390757 GCCCCTTCTGGAACCTCCTGGGG + Intronic
913126329 1:115793776-115793798 CTCTATTCTGACAGCTCCTGGGG - Intergenic
913505511 1:119513092-119513114 CCCTGCCCTGGCATTTCCTGTGG - Intronic
913608623 1:120489720-120489742 CCCTCTTCTGGACCCTCCAGTGG + Intergenic
913986805 1:143572952-143572974 CCCTCTTCTGGACCCTCCCGTGG - Intergenic
914050760 1:144128200-144128222 CCTTCTTCTGCCATCTGCTTAGG + Intergenic
914128421 1:144837244-144837266 CCTTCTTCTGCCATCTGCTTAGG - Intergenic
914370364 1:147019498-147019520 CCCTCTTCTGGACCCTCCAGTGG + Intergenic
914484330 1:148093912-148093934 CCCTCTTCTGGACCCTCCAGTGG - Intergenic
914582579 1:149032118-149032140 CCCTCTTCTGGACCCTCCCGTGG - Exonic
914690418 1:150020930-150020952 CCCTGTTCTGGTCTCTGCTGGGG + Intergenic
915269255 1:154742026-154742048 CCCTCCTCTGGCATCTGCAGCGG + Intronic
915581547 1:156816017-156816039 CCAGGTTCTGGCAGCTCCTGCGG + Exonic
916312856 1:163416265-163416287 CCCTCTTATGGTTTCTCCAGGGG + Intergenic
916450376 1:164915075-164915097 CCCTCTACTGTCAGCTCCTCTGG + Intergenic
916631387 1:166618071-166618093 CCATCTGCTGGCCTCACCTGGGG - Intergenic
916824949 1:168434348-168434370 CCCTCTTCAGGCATTTACTGTGG + Intergenic
917334268 1:173912365-173912387 CACTTTTGTGGCATCTACTGGGG + Intronic
917569691 1:176252199-176252221 CCTTCTTCAGGCATTCCCTGTGG + Intergenic
918168838 1:181975698-181975720 CCCTCTTCTGCAATTTGCTGGGG - Intergenic
919313081 1:195936510-195936532 CTCTCTTCTGGGGTCTCCAGAGG + Intergenic
919806922 1:201385883-201385905 CCCTCTTCCTGCAGCTCCTGGGG - Intronic
919833084 1:201555771-201555793 CCCTTTTCTGGCCTCTCTTTCGG - Intergenic
920578104 1:207077972-207077994 CTCTCTTCTGCCACCTTCTGGGG + Intronic
921813752 1:219543889-219543911 GCCTCTTCTGGCATTTGCTTTGG - Intergenic
922899101 1:229122655-229122677 CTCCTTTCTGGCTTCTCCTGAGG - Intergenic
923570055 1:235105409-235105431 CCCTCATCTGGCTTTTACTGAGG + Intergenic
1062925369 10:1312309-1312331 CCTTCTTCCAGCAGCTCCTGTGG + Intronic
1063180190 10:3591091-3591113 CTCCCTTCTGGGATCTCCAGTGG - Intergenic
1063230994 10:4065543-4065565 CCCTCTCCGACCATCTCCTGTGG + Intergenic
1063384991 10:5610837-5610859 CCGTCTGCTGCCATCTCCGGAGG + Intergenic
1063418860 10:5895129-5895151 TCGTCCTCTGGCATCTCCTGTGG - Exonic
1064178989 10:13099271-13099293 CCCTCTCCTGGTATCTCCGAAGG - Intronic
1065328727 10:24572024-24572046 CCCACTTCTGGTACCCCCTGAGG + Intergenic
1067211881 10:44266311-44266333 CCAGCTTCTGGCAACTTCTGTGG - Intergenic
1067818664 10:49506277-49506299 TCCTCTTCTGGCATACCCTAAGG + Intronic
1068676795 10:59777471-59777493 CCCTCTTCTCACATCTCCACTGG + Intergenic
1070695116 10:78557312-78557334 CCTTCTGCTGGAATCTCCAGGGG + Intergenic
1070842017 10:79493984-79494006 TCCTCTCCTGGCAGCTTCTGTGG + Intergenic
1072279199 10:93850752-93850774 CCCTCTTCTGGCAGAGGCTGGGG - Intergenic
1072726092 10:97815148-97815170 CTGTCTACTGTCATCTCCTGAGG + Intergenic
1073618129 10:105018708-105018730 GCCTCTTCTAGCCTCTCCTGAGG - Intronic
1073863154 10:107770531-107770553 CAGTCTGCTGGCCTCTCCTGGGG + Intergenic
1076022924 10:127089251-127089273 GCCTCTTTTGGTCTCTCCTGTGG + Intronic
1076318527 10:129561383-129561405 CCCTCGTCTGGGGTCTCGTGTGG - Intronic
1076516141 10:131045411-131045433 CCTTCTCTTGGCATCTCATGAGG + Intergenic
1076618183 10:131770727-131770749 CCCTCTGCTGGCTTCCCCTCCGG - Intergenic
1076628966 10:131841443-131841465 CCCTCTGCTGTCACCTCCTGTGG + Intergenic
1077308030 11:1876559-1876581 CCCCCTGCAGGCAGCTCCTGTGG - Intronic
1077693896 11:4375820-4375842 CCCTCTTCTGGCATAGGCTAGGG + Intergenic
1077695471 11:4389087-4389109 TCCTCTTCTGTGATCTACTGGGG + Intronic
1077910791 11:6570136-6570158 CCCTCTTCCAGGCTCTCCTGGGG - Intronic
1078415212 11:11159303-11159325 CACTCCTCCAGCATCTCCTGGGG - Intergenic
1078689109 11:13561314-13561336 CCCTCATCTGGAATACCCTGTGG + Intergenic
1079458881 11:20662232-20662254 CCCTCTTCTCCCATCCCTTGTGG + Intergenic
1079657809 11:23003789-23003811 CCCTCTTCTCACAGCTCCAGCGG + Intergenic
1079732014 11:23945100-23945122 CCAGTTTCTGGCAGCTCCTGGGG + Intergenic
1080683192 11:34495014-34495036 TCCTCTTCTGTGATCTCCTGGGG - Intronic
1081638135 11:44734548-44734570 CCCACTTCTAGCATCTCCCCAGG - Intronic
1081806088 11:45891349-45891371 CTCTCCACTGGCATCTCCAGTGG - Intronic
1084526098 11:69698866-69698888 CTGTCTTCTGGCTGCTCCTGGGG + Exonic
1085204144 11:74720451-74720473 ACCTCATCTCTCATCTCCTGTGG + Intronic
1085876978 11:80419771-80419793 CCTTCTTCTGGAATAGCCTGAGG - Intergenic
1088499654 11:110471059-110471081 GCCTCTCCTTGCATGTCCTGAGG + Intergenic
1088806582 11:113358493-113358515 TGCTCTGCTGGCCTCTCCTGGGG - Intronic
1092069280 12:5619645-5619667 CTCTCTTCCCTCATCTCCTGTGG + Intronic
1092103751 12:5905962-5905984 CTCTCTTCGGGCGTCTCCTCAGG + Intronic
1092919561 12:13218978-13219000 CAATTGTCTGGCATCTCCTGTGG + Exonic
1094499533 12:31009640-31009662 CCCTCTCCTGCCATCTGCTCTGG - Intergenic
1096183276 12:49562972-49562994 CCCCATTCTGCCAGCTCCTGGGG + Intronic
1096769776 12:53927757-53927779 CCCTCTCCAGGCTTCTCCGGAGG - Intergenic
1096814956 12:54196097-54196119 CCCTCCTCTGGCCTTTGCTGGGG + Intergenic
1097984422 12:65768474-65768496 CCTTCATATGGCATCTTCTGGGG - Intergenic
1100149808 12:91723388-91723410 CACTCTTCTGTAATCTCATGAGG + Intergenic
1100201784 12:92306514-92306536 CCCTCTTCTGGCCTAGCCTCAGG - Intergenic
1100804208 12:98263961-98263983 CCCTCCTCTGACCTCTCCTAGGG - Intergenic
1101889877 12:108703744-108703766 GCCTCTCCTGGCTTCTGCTGGGG - Intronic
1101901243 12:108792609-108792631 CCCCCTTCTGCCTTCCCCTGAGG - Exonic
1102353981 12:112216921-112216943 CTCTCTTCTGGCATCTCTTCAGG - Exonic
1102525342 12:113508749-113508771 CCCAATCCTGGCACCTCCTGGGG - Intergenic
1103624195 12:122206098-122206120 CCCTCCTCTGCCATCATCTGAGG - Intronic
1104944587 12:132409943-132409965 GCCTCTGCTGGAATCACCTGAGG + Intergenic
1105624814 13:22102385-22102407 CCCTCTTCTGTCTTCCACTGTGG + Intergenic
1107282835 13:38756059-38756081 CCCTTTTCTGGCATATGCTCAGG - Intronic
1107867651 13:44718538-44718560 TTCTCTTCTGGGATCTTCTGAGG + Intergenic
1108010016 13:45996927-45996949 GCCATTTCTGGCATCTACTGGGG + Intronic
1108493130 13:51000763-51000785 GACTCTTCTGGCATCTCGTCAGG - Intergenic
1110173730 13:72532392-72532414 AGCTCCTCTGGCATCTCCTTGGG + Intergenic
1110560785 13:76908857-76908879 CTCTCTACTGGCTTCTTCTGGGG + Intergenic
1111239636 13:85457560-85457582 CACTCCTCTGTCCTCTCCTGGGG + Intergenic
1112211573 13:97382907-97382929 ACCTTTTCTGGCACCTGCTGAGG + Intronic
1112354960 13:98666518-98666540 ACCTGCTCTGGCATCTCATGGGG - Intergenic
1115687167 14:35808660-35808682 CCCTCTCCTGGGAGCCCCTGCGG - Intronic
1115883409 14:37945605-37945627 TCGTCTGTTGGCATCTCCTGGGG + Intronic
1116782369 14:49250632-49250654 CCATCTGCTGGCCTCTCGTGGGG + Intergenic
1116938916 14:50770835-50770857 CACTCTGCTGGCCTCACCTGAGG + Exonic
1119806840 14:77487747-77487769 CCCTCTTCTGGCATCTCCTGGGG - Intronic
1120010238 14:79405481-79405503 GCATCTTCTAGAATCTCCTGTGG - Intronic
1121641501 14:95487460-95487482 CCCTCCTCAGGGAGCTCCTGTGG - Intergenic
1122791895 14:104187518-104187540 CCCTCCTGGGGCATCTCCAGGGG - Intergenic
1123111103 14:105867173-105867195 CCAACAGCTGGCATCTCCTGGGG + Intergenic
1123131984 14:105994542-105994564 CCATCTACTGGCCTCTCCTGGGG - Intergenic
1123420630 15:20127526-20127548 CCTTCTTCTGCCATCTGCTTAGG + Intergenic
1123445232 15:20326001-20326023 CCTTCTTCTGCCATCTGCTTAGG - Intergenic
1123529855 15:21134055-21134077 CCTTCTTCTGCCATCTGCTTAGG + Intergenic
1123582220 15:21725672-21725694 CCATCTACTGGCCTCTCCTGGGG - Intergenic
1123618870 15:22168268-22168290 CCATCTACTGGCCTCTCCTGGGG - Intergenic
1124123076 15:26909119-26909141 CTCTCTTCTGGCTTCTCTAGGGG + Intronic
1125477215 15:40055382-40055404 CCCTCTTCTGGGATAGCCAGAGG - Intergenic
1125858741 15:42977250-42977272 CTGTCTTTTGGAATCTCCTGGGG - Intronic
1126675371 15:51155919-51155941 TCCTCCACTGGCATCTCCGGTGG + Intergenic
1128300703 15:66564827-66564849 CCCCCTGCAGGCTTCTCCTGGGG - Exonic
1128976256 15:72155955-72155977 CTCTCTTCTCTCATCACCTGGGG - Intergenic
1129523391 15:76199565-76199587 CCCTCCTCTGCCAACTCATGTGG - Intronic
1129878027 15:78989607-78989629 CCCTCTTCTTGCCTTTCTTGTGG - Intronic
1132886399 16:2184153-2184175 CCTTCTTCTGGGATCTCCACCGG + Intronic
1134844045 16:17424984-17425006 CCCTCTCCTGTAACCTCCTGTGG + Intronic
1135919259 16:26633861-26633883 TGCTCTTCTGGCATCTTCTTTGG + Intergenic
1136552101 16:30987253-30987275 CCCTCTCCTCTCCTCTCCTGGGG - Intronic
1136567636 16:31079730-31079752 CCCTCCTCTGCCATGTGCTGGGG - Exonic
1138434574 16:56989854-56989876 CCCTCATCTGCCATCCTCTGCGG - Intronic
1139106753 16:63835555-63835577 CTGTCTGCTGGCCTCTCCTGGGG + Intergenic
1139196096 16:64920306-64920328 CTCTCTTCTGGTATGCCCTGTGG + Intergenic
1139218755 16:65157206-65157228 CCCTCCTTTGCCATCTCCTATGG + Intergenic
1139948023 16:70654846-70654868 CCTCCTCCTGCCATCTCCTGGGG + Intronic
1140477286 16:75245300-75245322 CACTCTGCTGGCACTTCCTGTGG - Intronic
1141173603 16:81705453-81705475 CCCTCTCCCGGCCACTCCTGGGG - Intronic
1141446035 16:84058908-84058930 CCTTCTTCTGTCATCCCCGGGGG - Intronic
1141732727 16:85833725-85833747 CCCGCCTCTGGCATCCGCTGCGG - Intergenic
1143168556 17:4912029-4912051 CCCTCTTCTGGCTTCTGCAGCGG - Intergenic
1143777759 17:9210465-9210487 CACTCTTCTGCTGTCTCCTGGGG + Intronic
1144671442 17:17134783-17134805 GCCTCTTCTGTCAGCGCCTGCGG + Intronic
1145259187 17:21344639-21344661 CTCTCTCCTGGCCTCTCCTCTGG + Intergenic
1145317430 17:21743308-21743330 CTCTCTCCTGGCCTCTCCTCTGG - Intergenic
1146691148 17:34877019-34877041 CCTTCTTCCAGCTTCTCCTGAGG + Intergenic
1147170273 17:38614444-38614466 CACTCCCCTGGCCTCTCCTGTGG + Intergenic
1147829728 17:43291155-43291177 CCCTGTGCTTGCGTCTCCTGCGG + Intergenic
1148071560 17:44911601-44911623 TTCTCCCCTGGCATCTCCTGGGG + Intronic
1148478699 17:47946053-47946075 ACATCTCCTGGCATCTCCTGGGG - Intronic
1150464620 17:65381531-65381553 GCCTCTTCTGTTTTCTCCTGAGG - Intergenic
1152178947 17:78805977-78805999 CCCTCTTCTGTGTTCCCCTGTGG - Intronic
1152876165 17:82787359-82787381 CGGGCTTCTGGCAGCTCCTGGGG + Intronic
1153156947 18:2160657-2160679 CCCTCATCTGGCATCTCACTGGG + Intergenic
1155494471 18:26429162-26429184 CCCTCTTCTCTCATCTGCTGTGG - Intergenic
1155540667 18:26864802-26864824 ACCTCTTCTGGTGTCTCCTGCGG - Intronic
1156711206 18:39948152-39948174 TCCTCTTCTTCCATCTTCTGTGG - Intergenic
1156896935 18:42256800-42256822 TGGTCTTCTGGCCTCTCCTGGGG - Intergenic
1159458350 18:68692491-68692513 CCCCCTTACTGCATCTCCTGGGG + Intronic
1159959024 18:74541258-74541280 GCCTTTCCTGGCAGCTCCTGTGG - Intronic
1160389133 18:78517399-78517421 CCTTCTCCTGGTAACTCCTGTGG + Intergenic
1160841767 19:1149567-1149589 GCCCCTGCTGGTATCTCCTGGGG + Intronic
1161835747 19:6645175-6645197 ACCTCTTCTCACATTTCCTGGGG - Intergenic
1162534210 19:11253527-11253549 CCCTCCTGTGGCCTGTCCTGGGG - Intronic
1163265389 19:16217632-16217654 CAGTCTGCTGGCCTCTCCTGGGG - Intronic
1163270669 19:16251573-16251595 CTCTCTTCTTGGAGCTCCTGTGG + Intergenic
1163889869 19:20001233-20001255 CCCACCCCAGGCATCTCCTGTGG + Intronic
1164939469 19:32241311-32241333 CCCTGTTCAGTCAACTCCTGTGG + Intergenic
1165447887 19:35866658-35866680 CCCACTTGGGGCATCTCCTTTGG - Exonic
1166405860 19:42521542-42521564 CCCTCTGATGACATCACCTGTGG - Intronic
1166470014 19:43071975-43071997 CCCTCAGATGGCATCACCTGTGG - Intronic
1202690168 1_KI270712v1_random:80839-80861 CCTTCTTCTGCCATCTGCTTAGG + Intergenic
925082437 2:1081012-1081034 CTCTCTCCTTGCTTCTCCTGGGG - Intronic
925339778 2:3128078-3128100 GGCTCTTCTGGCGTGTCCTGAGG - Intergenic
926175817 2:10591321-10591343 CCTTTTTCTGTCCTCTCCTGTGG - Intronic
929126728 2:38529324-38529346 CCCTCTTCTAGCGACTCCGGGGG + Intergenic
930085474 2:47494315-47494337 TCCTCAACTGGCCTCTCCTGGGG + Intronic
931557196 2:63518720-63518742 CCTTCACCTGGCCTCTCCTGGGG + Intronic
933812542 2:86042046-86042068 CCTTCTTCTGGTATTTCCTTCGG + Exonic
933956245 2:87375174-87375196 CCTTCTTCTGCCATCTGCTTAGG - Intergenic
934240396 2:90267198-90267220 CCTTCTTCTGCCATCTGCTTAGG - Intergenic
934272794 2:91549549-91549571 CCTTCTTCTGCCATCTGCTTAGG + Intergenic
937958633 2:127438112-127438134 GCCTCTCTTGGCCTCTCCTGAGG - Intronic
939873917 2:147554944-147554966 CCCTCTCCTGGGACATCCTGAGG - Intergenic
940070714 2:149684540-149684562 ACTTCTTCTGGAGTCTCCTGAGG + Intergenic
940307464 2:152241831-152241853 ACCTCTTCTGGGATCTTTTGAGG - Intergenic
942463361 2:176184972-176184994 CCCTCTGCTGTCACCTCCCGTGG + Intergenic
942754856 2:179328614-179328636 CCCTCTTCTGTCATCTCAATTGG + Intergenic
946018468 2:216622621-216622643 CCTGCATCTGGCTTCTCCTGTGG - Intergenic
946095450 2:217270553-217270575 CCATTTGCTTGCATCTCCTGTGG + Intergenic
946374184 2:219298188-219298210 CCCTGTTAGGACATCTCCTGGGG + Intronic
946713861 2:222533216-222533238 CCCTCTTCTGGTCCCTCCTGAGG - Intronic
948338463 2:237230168-237230190 CCCTCCATTGGCATCTTCTGTGG - Intergenic
948509779 2:238456054-238456076 CTCTGATTTGGCATCTCCTGTGG - Intergenic
1169928171 20:10804388-10804410 TTCTCTTCTGGCATCTCTGGAGG + Intergenic
1170940427 20:20844151-20844173 CCCCCTTCTGACATCTCCAGGGG - Intergenic
1171159540 20:22908872-22908894 TCCTCACCTGGCATTTCCTGGGG + Intergenic
1171752091 20:29061722-29061744 CCCTTTTCTGCCACCTCATGTGG + Intergenic
1173253006 20:41374540-41374562 CCCCTTTCTGGCCCCTCCTGGGG - Intergenic
1176162100 20:63653255-63653277 GCCTCGTCTGGCCTCGCCTGGGG - Intronic
1177925414 21:27208323-27208345 CCCGATTCTGGCAGCTTCTGGGG + Intergenic
1178012110 21:28300660-28300682 CCATCTTCTGTCATCCCATGGGG - Intergenic
1178756049 21:35350790-35350812 CCTTTTTCTGGCATCCCCTCAGG + Intronic
1179141006 21:38725242-38725264 CCCTTTTGTATCATCTCCTGGGG - Intergenic
1179711453 21:43265800-43265822 CCCTCTTCTGGAATTTTCAGAGG - Intergenic
1180054199 21:45348796-45348818 CCCTCCTCTGGGTTCTCCTGGGG + Intergenic
1180192597 21:46173216-46173238 TCGTCTGCTGGCCTCTCCTGGGG + Intronic
1183475815 22:38035173-38035195 CCCTTCTGTGGCATCGCCTGTGG + Intronic
1183481504 22:38068018-38068040 CCTGCTTCTGCCATCTCCTCTGG + Intronic
1183522312 22:38302770-38302792 CCATCCTCTGGCATCCTCTGGGG + Intronic
1184970617 22:48017281-48017303 TCCTCTGCTGGCCTCTCCCGGGG - Intergenic
950882742 3:16336303-16336325 CCCTAGACTGGGATCTCCTGGGG - Intronic
953149447 3:40310339-40310361 CCGTTCTCTGGCAGCTCCTGGGG + Intronic
953979690 3:47407418-47407440 CCCTCTGCTGGCATCTACATGGG + Intronic
954692400 3:52402518-52402540 CCCTCCCCTGGCCTCTCCTGAGG - Intronic
954707591 3:52489349-52489371 GCCTCTGCTGGGACCTCCTGGGG - Exonic
954951424 3:54477683-54477705 CCCTCTCCTGGCTTGTCCTCTGG + Intronic
955506590 3:59638991-59639013 CCCTCCCCTGGCATAACCTGGGG - Intergenic
955527942 3:59840062-59840084 CCCTCTTCTGACTCCTCCTGTGG - Intronic
956349990 3:68323915-68323937 CCTTCTTCTGGTATTTCCTCAGG - Intronic
958419250 3:93912721-93912743 CCCTCTTTTGCCATCTGCTGTGG - Intronic
961110449 3:124279001-124279023 CCCTGTCCTGGCATCTCCTCAGG + Intronic
961988007 3:131158105-131158127 TGATCTTCTGGCCTCTCCTGAGG + Intronic
962057377 3:131886501-131886523 CCCTCTTCTCACAGCTCCTCTGG - Intronic
962202373 3:133412546-133412568 CCATCTTCTGGCATCTTCCTTGG - Intronic
962273111 3:133992629-133992651 CCCTCTGCTGGCAGAGCCTGGGG - Intronic
962897195 3:139726531-139726553 CTCTGTTCTAGCATTTCCTGAGG + Intergenic
963150855 3:142044146-142044168 GCCTCTTCTGTCCTCTGCTGTGG - Intronic
963308474 3:143680916-143680938 CCCTCCTCTGATATCTTCTGGGG - Intronic
964011934 3:151901978-151902000 CCATCTTCAGCCATCTCCAGAGG + Intergenic
964494712 3:157275901-157275923 CCCTCTTTTTGCATATCCTCTGG - Intronic
965398211 3:168186422-168186444 CCCTCTTCTGGCAACCACTCTGG - Intergenic
969449279 4:7263981-7264003 CCCTCTCCTCACATGTCCTGAGG + Intronic
969603646 4:8191094-8191116 CCCTCTTCTGAAATCTCCTCTGG + Intronic
973907757 4:55547448-55547470 ACATCTTCTCCCATCTCCTGAGG + Intergenic
975190616 4:71456772-71456794 CCCACTACTGGTATCTCTTGGGG - Intronic
975586741 4:75957552-75957574 TCCTCTTCTGGGATTTCCCGGGG + Exonic
976300224 4:83509435-83509457 TCCTCTACTGCCCTCTCCTGAGG - Intronic
976948520 4:90799590-90799612 TAGTCTTCTGGCTTCTCCTGGGG - Intronic
977169159 4:93739084-93739106 CCCTCTTCTATCATCCCCTGAGG - Intronic
978407892 4:108399045-108399067 CCCTTGTCTCGCACCTCCTGAGG - Intergenic
978587657 4:110291547-110291569 CCCTCCTCAGGCAGCTCCTCAGG - Intergenic
978596138 4:110379420-110379442 CAGTCTGCTGGCCTCTCCTGAGG + Intronic
982227622 4:153180819-153180841 CACTCCTCTGCCAACTCCTGTGG + Intronic
982483008 4:155934425-155934447 CCCTCTTCTCGCAGCTCCTGTGG - Intronic
983654784 4:170071822-170071844 CCCACATCTTGCTTCTCCTGTGG - Intronic
984057631 4:174949159-174949181 CCATCTACTGGCATCTCCTGGGG - Intronic
984763699 4:183383790-183383812 CCCACTTCTGGCACCTGCTCTGG + Intergenic
985518868 5:361337-361359 CCCACTCCTGGCCTCTGCTGAGG - Intronic
985774488 5:1833772-1833794 CCCTCCTGTGGCATATCCTTGGG + Intergenic
985899585 5:2778210-2778232 ACCTCTTATGGCCTCTCCTGAGG + Intergenic
986293683 5:6420195-6420217 GCCTTTTCTGGCATCTTCAGAGG - Intergenic
986540123 5:8836147-8836169 ACCTCTGCTGGAAGCTCCTGAGG + Intergenic
987830374 5:23087563-23087585 ACCTCGTCTGTCATCTCTTGAGG + Intergenic
987861422 5:23492476-23492498 CCATCTGCTGTCCTCTCCTGGGG - Intergenic
987991960 5:25224312-25224334 CCTTCTTCTGCCATCTCCTAGGG - Intergenic
988738741 5:34048734-34048756 CCCTCTTCTGTCACCCCCTATGG + Intronic
990362136 5:55031243-55031265 CCCTGTTCTGGGATCTACTTTGG - Intronic
990494654 5:56335305-56335327 CCCTCTTCTCACAACTCCAGTGG + Intergenic
992694795 5:79275492-79275514 CCTTCTTTTGGCATCCACTGGGG + Intronic
992745424 5:79815744-79815766 CACTCTTCTATCATCTCCTCTGG + Intergenic
992997237 5:82345687-82345709 CCATCTCCTGGCCTCTCTTGGGG - Intronic
994677826 5:102847204-102847226 CCTTCTGCTGGAATCACCTGAGG + Intronic
996067160 5:119091833-119091855 CTCTCATGTGGCATCTCCTTTGG + Intronic
997193759 5:131963616-131963638 GCCTCTCCTGGGATCTCCAGTGG + Intronic
998172193 5:139879205-139879227 CCCTGTTCTCCCCTCTCCTGAGG + Intronic
999357741 5:150953070-150953092 CCCTCATCTGGCATGGCCTTAGG + Intergenic
1000993346 5:167933994-167934016 CACTTTTCTGTCATCTCCTTTGG - Intronic
1002991955 6:2246109-2246131 CGCTCTTCTGGCCTTTCCTGAGG + Intergenic
1003940174 6:11016717-11016739 ACCTCTTTTGGTAACTCCTGGGG + Intronic
1004013400 6:11710789-11710811 CCCTCTTCTTGTAGCTACTGTGG - Intergenic
1005928752 6:30465382-30465404 CCCACCTCTTGCCTCTCCTGGGG - Intergenic
1006101302 6:31687874-31687896 CCCTCCTCTGCCATCACCCGGGG + Exonic
1006253194 6:32807829-32807851 TGGTCTTCTGGCCTCTCCTGGGG - Intergenic
1006276681 6:33009743-33009765 ACTTCCTCTGGCCTCTCCTGGGG - Intergenic
1007353678 6:41294432-41294454 CTGTCTGCTGGCCTCTCCTGGGG + Intergenic
1007838435 6:44696221-44696243 ACCTCCTCTGGCCTCTGCTGAGG - Intergenic
1009637553 6:66285222-66285244 CCCAGTTCAGGGATCTCCTGTGG + Intergenic
1009851316 6:69202852-69202874 CTTTCTTCTGGCAACTCCTCAGG - Intronic
1011044439 6:83066153-83066175 TTCTGTTCTTGCATCTCCTGGGG - Intergenic
1011337393 6:86276196-86276218 TGGTCTTCTGGCCTCTCCTGAGG - Intergenic
1011850022 6:91614954-91614976 CCCTCTTCTGCCATCTCTGCTGG - Intergenic
1012253694 6:97008364-97008386 CTGTCTTCTGGCCTCTCCTAGGG - Intronic
1015521377 6:134134999-134135021 CCCTCTACTTGCAGCTTCTGAGG - Intergenic
1015577817 6:134691285-134691307 CTGTATTCTCGCATCTCCTGGGG - Intergenic
1016544146 6:145201767-145201789 CCACCTTCTGGTATCTTCTGTGG - Intergenic
1018454941 6:163943578-163943600 CCCTCTTCAAGCAGCTCATGAGG - Intergenic
1019131342 6:169879145-169879167 CTCTCGTTTGGCGTCTCCTGTGG + Intergenic
1019303870 7:322995-323017 CCCTCTCCTGGCAGCTGCTCAGG - Intergenic
1019647084 7:2136677-2136699 CCATCTCTTGGCATCTCCTCGGG + Intronic
1021608070 7:22429472-22429494 CACTCTTCAGACATCTACTGGGG - Intronic
1022966421 7:35477656-35477678 CTCTGTTTTGGCATCTCCTTTGG - Intergenic
1022975484 7:35551909-35551931 CCCCCTCATGGCATTTCCTGTGG + Intergenic
1025149897 7:56539795-56539817 CCCCCTTCGGGCTTATCCTGAGG - Intergenic
1025252590 7:57361741-57361763 CCCTCTTCTGGCCTGTAATGTGG + Intergenic
1025601549 7:63003390-63003412 CCTTCATATGGCATCTCCTCAGG + Intergenic
1027528684 7:79302603-79302625 ACATCTTTTTGCATCTCCTGTGG - Intronic
1028482564 7:91323746-91323768 CCCACTCCTGGCATGTCCTTTGG - Intergenic
1028830080 7:95318011-95318033 CCCTCTTCTGCCATCTCCTCAGG + Intronic
1029306679 7:99624808-99624830 CGCTCTGCTGGCAGCCCCTGTGG - Intronic
1030401679 7:109059349-109059371 CTGTCTGCTGGCTTCTCCTGGGG - Intergenic
1031330020 7:120452911-120452933 CTGTCTGCTGGCCTCTCCTGGGG + Intronic
1031547538 7:123068568-123068590 CCCACTAGTGGCCTCTCCTGGGG - Intergenic
1032084055 7:128874440-128874462 CCATCTTCCTGCAGCTCCTGTGG - Intronic
1032440985 7:131943044-131943066 CCCTCTCCTGACATCACATGTGG - Intergenic
1033077456 7:138262889-138262911 CCCTCTTCTGGCATGATGTGGGG + Intergenic
1033613334 7:142986962-142986984 CCCTGTCCTGGCTTCTACTGTGG + Intergenic
1034404949 7:150896945-150896967 CCCTCCTCTGCCATGTCTTGTGG - Intergenic
1035192172 7:157180116-157180138 GCCGCTTCTAGCATCTTCTGTGG + Intronic
1038102489 8:24394059-24394081 CTCTCTACAGGCACCTCCTGGGG + Exonic
1038303676 8:26379714-26379736 TCCTCTTCTGGGATTTCCCGGGG + Intergenic
1038440568 8:27568609-27568631 CCTTCCCCTGGCATCTCCAGAGG - Intergenic
1039322230 8:36445073-36445095 CCCTCTTCTAGTGTCTCATGTGG + Intergenic
1039759487 8:40558958-40558980 CCCTTTTCTGGCATGGCCTTAGG - Intronic
1040290988 8:46124477-46124499 CCTTCTCCTGGCAGCACCTGGGG - Intergenic
1041427470 8:57738773-57738795 CTGTCTGCTGGCCTCTCCTGGGG - Intergenic
1041550636 8:59096901-59096923 TCTTCATCTGGCATCTCTTGGGG + Intronic
1041577890 8:59420995-59421017 CGATCGTCTGGCCTCTCCTGAGG - Intergenic
1042976783 8:74478533-74478555 CAGTCTGCTGGCATCTCCTGGGG - Intronic
1044729757 8:95220386-95220408 ACCTCTTCTAGGATCTCCCGGGG + Intergenic
1044739780 8:95314434-95314456 CCCTATCCTGGCATAGCCTGGGG + Intergenic
1047110830 8:121787408-121787430 CCCTCTTCTGCCACCTTGTGAGG - Intergenic
1048727250 8:137400557-137400579 CTGTCTGCTGGCCTCTCCTGGGG + Intergenic
1049641675 8:143718835-143718857 CCATCTTCTACCAGCTCCTGCGG + Exonic
1049695773 8:143983703-143983725 TCCTCCTCTGGCTGCTCCTGAGG + Exonic
1049707170 8:144048344-144048366 CCCTGTCCTGGGAGCTCCTGAGG + Intergenic
1049915544 9:314328-314350 CTCTCTTCTGGCATCCACTTTGG - Intronic
1050204238 9:3180825-3180847 CCCACTTTTGGCATCTCTTAAGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1050475302 9:6034632-6034654 TGCTCTGCTGGCCTCTCCTGGGG + Intergenic
1051596459 9:18829026-18829048 CCCTCTTCCTGCATCTCCTGAGG - Intronic
1051859345 9:21606785-21606807 TCCTCTACTGGCCTCACCTGGGG + Intergenic
1053221387 9:36316071-36316093 CCCTCCTTTGGCTCCTCCTGGGG - Intergenic
1053404357 9:37858937-37858959 CCCACTTTTGCCATCTCCTGAGG + Intronic
1053577061 9:39364003-39364025 CCAGCTTGTGGCTTCTCCTGGGG + Intergenic
1053902305 9:42806883-42806905 ACCACTGCTGGCGTCTCCTGAGG + Intergenic
1054532673 9:66198636-66198658 ACCCCTGCTGGCGTCTCCTGAGG - Intergenic
1055590252 9:77805179-77805201 TCCTCATCTGGCAAATCCTGTGG + Intronic
1056254479 9:84784710-84784732 CCCTTTAGTGACATCTCCTGAGG + Intronic
1057354037 9:94320724-94320746 CCCTCCTGTGGCGTCTCCTCCGG - Intronic
1057979856 9:99650085-99650107 CAGTCTACTGGCCTCTCCTGGGG + Intergenic
1059045511 9:110861929-110861951 CCCTCTTCTTGCAGCTCCACTGG - Intergenic
1059431106 9:114250821-114250843 CCCTTTCCTGGCATCCCTTGGGG + Intronic
1060014740 9:120077305-120077327 CCACCTTCTGGCATCTTCTAGGG + Intergenic
1060409361 9:123389943-123389965 CCCTCTCCTGGCCTCCCCTGCGG + Intronic
1061084143 9:128389589-128389611 CCCTGTTCTCCCAACTCCTGGGG + Exonic
1061577126 9:131514160-131514182 CCCTCTACTCCCACCTCCTGGGG + Intronic
1062374318 9:136255123-136255145 CCCTCTCTTAGCAGCTCCTGTGG - Intergenic
1185604836 X:1362659-1362681 CCCGCTTCTCCCAGCTCCTGGGG + Intronic
1187607850 X:20905804-20905826 CTGTCTTCTGGCATCTCCCAGGG - Intergenic
1188510961 X:30936133-30936155 CCTTCTACTGCCATCTCCAGGGG - Intronic
1189390260 X:40570558-40570580 CCCTCTTCTCTCATCACCTCTGG - Intergenic
1190092385 X:47450828-47450850 CACTCCTCTGGCATCTCCTGGGG - Intronic
1190258447 X:48782840-48782862 CTCCCTCCTGGCATCTTCTGGGG - Intergenic
1190930291 X:54943285-54943307 CTGTCTTCTGGCTTCTACTGTGG - Intronic
1192012383 X:67288916-67288938 CCCAATTCTGTCATCCCCTGAGG + Intergenic
1192364574 X:70460462-70460484 CCATCTTTTGGCTCCTCCTGGGG - Intronic
1192872240 X:75195319-75195341 TGCTCTGCTGGCCTCTCCTGGGG - Intergenic
1192996625 X:76519556-76519578 CGGTCTACTGGCTTCTCCTGGGG + Intergenic
1194624536 X:96213162-96213184 CCCTCTTCTTGCAGCTCCACTGG + Intergenic
1194736891 X:97523021-97523043 CCTTCTTCTGGGATCTCCAAAGG - Intronic
1195283310 X:103357757-103357779 TCCTCTTCTGGCTTTTCCTCAGG - Exonic
1196123996 X:112081038-112081060 CCCGCTTCAGGCTTTTCCTGAGG + Intronic
1196563216 X:117175413-117175435 CTCTCTTCTGGATTCTCCAGGGG - Intergenic
1196574477 X:117302279-117302301 CTGTCTGCTGGCCTCTCCTGGGG - Intergenic
1199727576 X:150599716-150599738 CCAACTTCTGGAATCTCCTCTGG + Intronic
1202177570 Y:22111934-22111956 GCCCCTTCAGGCATCTTCTGTGG + Intergenic
1202213791 Y:22474450-22474472 GCCCCTTCAGGCATCTTCTGTGG - Intergenic