ID: 1119808485

View in Genome Browser
Species Human (GRCh38)
Location 14:77498170-77498192
Sequence CAGTGGGGCTCTCCAGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119808485_1119808496 30 Left 1119808485 14:77498170-77498192 CCGGCGGCTGGAGAGCCCCACTG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1119808496 14:77498223-77498245 CCTGACCGTTTGAACCTCAGCGG 0: 1
1: 0
2: 1
3: 3
4: 65
1119808485_1119808492 2 Left 1119808485 14:77498170-77498192 CCGGCGGCTGGAGAGCCCCACTG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1119808492 14:77498195-77498217 CCTCCGCTTGTCTCATGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 88
1119808485_1119808489 -3 Left 1119808485 14:77498170-77498192 CCGGCGGCTGGAGAGCCCCACTG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1119808489 14:77498190-77498212 CTGTGCCTCCGCTTGTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 139
1119808485_1119808490 1 Left 1119808485 14:77498170-77498192 CCGGCGGCTGGAGAGCCCCACTG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1119808490 14:77498194-77498216 GCCTCCGCTTGTCTCATGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1119808485_1119808493 3 Left 1119808485 14:77498170-77498192 CCGGCGGCTGGAGAGCCCCACTG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1119808493 14:77498196-77498218 CTCCGCTTGTCTCATGGAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119808485 Original CRISPR CAGTGGGGCTCTCCAGCCGC CGG (reversed) Intronic
900165299 1:1242105-1242127 CAGTGCTGCTCTCCAACCTCTGG + Intergenic
900398029 1:2461274-2461296 CAGTGGGGCTCTGCAGCCCGGGG + Intronic
900515148 1:3078234-3078256 CAGAGGACCTCTCCAGCTGCAGG + Intronic
900574718 1:3377381-3377403 CAGTGGGCATGGCCAGCCGCCGG - Intronic
900611778 1:3547287-3547309 CAGTGCGGCTCCCCTGCTGCTGG - Intronic
902769282 1:18636435-18636457 CAGTGGTTCGCTCCCGCCGCCGG + Intronic
902880638 1:19369845-19369867 CAGTGGGGCTCTGAGTCCGCAGG + Intronic
905651399 1:39659402-39659424 GAATTGGGCACTCCAGCCGCAGG + Exonic
909481671 1:76133314-76133336 CAGTGAGGCTCTGCAGCCACAGG - Intronic
920313470 1:205061924-205061946 CGTTGGGGCTGTGCAGCCGCCGG + Exonic
1069633362 10:69911046-69911068 CAGTGGGGCTCCCCAGAAACAGG + Intronic
1070665024 10:78336674-78336696 CAGTGGCTCCCTCCAGCAGCTGG - Intergenic
1073081788 10:100865136-100865158 CAGTGAGGCTCTCCTGGCTCTGG - Intergenic
1075131993 10:119748303-119748325 CAGTGGGGCTCTGCAGTTCCTGG - Intronic
1075488341 10:122846065-122846087 CTGTAGGGATCTCCAGCAGCTGG + Exonic
1075520518 10:123141086-123141108 CAGTGGGGCTCCCCAACAGGAGG - Intergenic
1075878009 10:125823590-125823612 AAGTGGGGTTCCGCAGCCGCCGG + Exonic
1076361107 10:129889437-129889459 CAGTGGGACGGCCCAGCCGCAGG - Intronic
1076777958 10:132708621-132708643 CAGCGGAACTCTCCAGCTGCGGG - Intronic
1076798768 10:132811206-132811228 CAGTGGACCTCGCCAGCCTCAGG + Intronic
1076856693 10:133119305-133119327 CAGTGAGACCCTCCACCCGCAGG - Intronic
1077000763 11:321121-321143 CAGTGGGGTCCTGCAGCTGCTGG - Intronic
1077028546 11:452552-452574 CAGGAGGGCTCTCCAGGAGCGGG + Intronic
1078450778 11:11439094-11439116 CAGTGGCCCTGTCCAGCCACTGG + Intronic
1083808255 11:65087857-65087879 CAGGGCTTCTCTCCAGCCGCGGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084363960 11:68685727-68685749 CAGAGGGTCTGCCCAGCCGCAGG - Intronic
1084546930 11:69819280-69819302 CCGCGGGGCTCCCCACCCGCCGG - Intergenic
1084604070 11:70162342-70162364 CAGTGGGAAGCTCCAGCAGCAGG + Intronic
1085018138 11:73188640-73188662 CAGTGGGACTCTCCAGGCAGTGG - Intergenic
1087791092 11:102406960-102406982 CAGTGGGCCTCTCCTCCAGCTGG - Intronic
1088771259 11:113038002-113038024 TAGTGGTGCTCCCCACCCGCAGG - Intronic
1091738984 12:2946425-2946447 CATTGGGGCTCTCAAGCCACAGG + Intergenic
1093622468 12:21308554-21308576 CAGTGTGCCTCTCCAGACTCTGG - Intronic
1096095973 12:48935986-48936008 CATTTGGGCTCCCCCGCCGCGGG + Exonic
1096234631 12:49917839-49917861 CAGTGGGTCTCTCCACACTCAGG + Intergenic
1103166261 12:118773134-118773156 GAGTCGGGCTGCCCAGCCGCTGG + Intergenic
1106699743 13:32216565-32216587 CTGTGGCGCTCTCCACCCGACGG + Intronic
1113426791 13:110214705-110214727 CCCTTGGGCTCTCCAGCCGCTGG + Intronic
1113904288 13:113812077-113812099 GAGTGGGGCCCTCCAGACCCAGG + Exonic
1114265258 14:21069862-21069884 CGGGGAGGCTTTCCAGCCGCAGG + Intronic
1117602688 14:57391015-57391037 CAGCGGGGCTCGACCGCCGCCGG - Exonic
1119808485 14:77498170-77498192 CAGTGGGGCTCTCCAGCCGCCGG - Intronic
1120991846 14:90383886-90383908 CAGCGGGCCCCTCCTGCCGCAGG - Intergenic
1121588254 14:95078835-95078857 CAGTGTGGATCTCCAAGCGCTGG - Intergenic
1122629913 14:103102934-103102956 CCGTGGGGCGCTCCCGCCCCAGG + Intronic
1122904328 14:104795127-104795149 CCGTGGGGCTCCCCGGGCGCTGG - Intronic
1123972928 15:25525899-25525921 CAGGAGTGCTCTCCAGCCTCAGG - Intergenic
1124610164 15:31202566-31202588 CAGTGGGGGTTTCCACCCCCAGG + Intergenic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1128580546 15:68806946-68806968 CAGTGTGACTCTCCTGCAGCTGG - Intronic
1129239182 15:74241536-74241558 CCGTGGGGCCCTCCAGGAGCTGG - Intronic
1129717927 15:77862722-77862744 CACTGGGGCACTACAGCAGCAGG - Intergenic
1130545876 15:84857477-84857499 GAGTGGGGGTCCCCAGCCCCAGG - Exonic
1130952272 15:88602142-88602164 CAGTGGGTCTTTCCAGCAGAAGG + Intergenic
1131393879 15:92071284-92071306 CAGTGGGCCTCTCCAGGCTTGGG - Intronic
1131557757 15:93414294-93414316 GAGTCGGGCTGTCCAGCGGCTGG + Intergenic
1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG + Intronic
1132692131 16:1186292-1186314 CAGTGGGGCTGTTCAGAAGCTGG + Intronic
1132868375 16:2104740-2104762 CAAGTGGGCTCTCCAGCTGCAGG - Intronic
1133169793 16:3975094-3975116 CACTGTGGCTCTCCAGCTCCAGG + Intronic
1134523356 16:14928261-14928283 CAAGTGGGCTCTCCAGCTGCAGG + Intronic
1134710948 16:16326745-16326767 CAAGTGGGCTCTCCAGCTGCAGG + Intergenic
1134948635 16:18341864-18341886 CAAGTGGGCTCTCCAGCTGCAGG - Intergenic
1135647787 16:24178394-24178416 CAGAGGTGCCCTCCAGCCTCAGG + Intronic
1135989629 16:27210121-27210143 CAGTGGGTGTCTCCAGCCATCGG - Exonic
1138327835 16:56190935-56190957 CTCCGTGGCTCTCCAGCCGCTGG - Intergenic
1141697881 16:85628624-85628646 GCGTGGGGCTGTCCAGCCACAGG - Intronic
1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG + Intergenic
1147550642 17:41439135-41439157 CAGGGGAGCTCCCCAGCCCCGGG - Intronic
1149772723 17:59333334-59333356 CAGTTGGGCTTTGCCGCCGCAGG + Intronic
1151665721 17:75544169-75544191 CAGTGTGGCTCTTCAGCTCCCGG + Intronic
1152388914 17:79991670-79991692 CAGTGCTGCCCTCCAGCCACAGG + Intronic
1154214779 18:12408029-12408051 CGGTGGGGCCGTCCAGACGCCGG + Intronic
1157384808 18:47251610-47251632 ACTTGGGGCTCTCCTGCCGCGGG - Intergenic
1157985938 18:52437330-52437352 CACTGGGGCTCTCCACAGGCTGG + Intronic
1158441669 18:57480077-57480099 CAATGGGGCTCTCTAGGGGCAGG - Exonic
1158674582 18:59506688-59506710 CAGTAGGGCTCCCCTGCCCCTGG - Intronic
1160214866 18:76919885-76919907 CCGTGGCGCTCTCCTGCGGCCGG - Exonic
1160437768 18:78865050-78865072 CAGCTGGGCTCACCAGCAGCAGG + Intergenic
1161085276 19:2332318-2332340 CAGACGGGCTCTCCAACAGCCGG - Intronic
1162022053 19:7872532-7872554 CGGTGGGGGTCTCCAGAGGCCGG - Exonic
1162341989 19:10096707-10096729 CCCTGGGGCCCTCCAGCCGTGGG - Intronic
1164273737 19:23698808-23698830 CAGTGGAGCTCTACAGCTCCAGG + Intergenic
1164502400 19:28831137-28831159 CTGTTGGGCTCTCCAGAAGCAGG + Intergenic
1164535508 19:29083995-29084017 CAAAGGGGCTATCCAGCCTCTGG + Intergenic
1165311819 19:35033139-35033161 GAGTTGGGGTCTCCAGCTGCTGG + Intronic
1165394205 19:35555427-35555449 CAGCAGGGCTCACCAGCCGCTGG + Exonic
1167124520 19:47540028-47540050 CTGTGTGGCTCTCCAGGGGCAGG - Intronic
1167985245 19:53309154-53309176 CAGTGTGCTTCTCCAGCCCCAGG - Intergenic
925240324 2:2320148-2320170 CAGTGGGACTTTCCAGCCACTGG - Intronic
926108851 2:10169573-10169595 CAGGGGGGCTCCCCAGCAGAGGG + Intronic
927960722 2:27239257-27239279 GAGGGGGGCTCTCCAGCCCTAGG + Intronic
928293882 2:30065073-30065095 CAGTGAGGCTATCCAGTCTCTGG - Intergenic
929951075 2:46409964-46409986 CTGTGGGTCTCTCCAGTAGCAGG - Intergenic
931355953 2:61537891-61537913 CAGGGGGACCCTCCAGCCACAGG + Exonic
933606997 2:84393684-84393706 CAATGCTGCTCTCCAGCCTCTGG + Intergenic
936340790 2:111630900-111630922 TAGTGGGGACCTCCAGCCTCAGG - Intergenic
937408663 2:121653583-121653605 CAGTGGGGCTCCTCTGCCTCTGG - Intergenic
938392181 2:130915128-130915150 GAGTGGGGCTCCCCATCTGCAGG + Intronic
946747606 2:222861333-222861355 CCGAGGGGCTCCCCAGCCTCGGG + Intronic
948271094 2:236673896-236673918 CAGTGGGGCTCCCAAATCGCCGG + Intergenic
1170816292 20:19717253-19717275 CCGTGGGGCACTCCAGCCAGGGG + Intronic
1172933643 20:38603089-38603111 CAATGGGGGTCTCCTGCTGCAGG - Intronic
1173487236 20:43450055-43450077 CAGTGTGGCTCTGGAGCCACTGG - Intergenic
1175929568 20:62487365-62487387 GAGTGGGGCTCTCCCTGCGCGGG + Intergenic
1176220560 20:63967575-63967597 CTGTGGGCCTGTGCAGCCGCCGG - Intronic
1176258789 20:64167999-64168021 CAGTGGGGCTGTCCTGGAGCGGG - Intronic
1179820007 21:43931065-43931087 CAGTTGGGCTGTCCAGTCACGGG - Intronic
1179976767 21:44873007-44873029 CGGTGTGTCTCTACAGCCGCCGG - Intronic
1180183868 21:46130000-46130022 CAGCGAGGCTCACCAGCCTCTGG - Intronic
1182257729 22:29050414-29050436 GACTGGGGCTCCCCACCCGCCGG - Exonic
950129209 3:10530418-10530440 CGGTGGGACACTCCGGCCGCAGG - Intronic
950584162 3:13880694-13880716 CAGTGGGGCGCCTGAGCCGCGGG + Intergenic
952970079 3:38645253-38645275 CTGTGGGGCTCTCCCGTCCCAGG + Intronic
968929792 4:3572836-3572858 CAGTGGGGCTCACCACGTGCAGG - Intergenic
969258201 4:6017261-6017283 CTGTGTGGCTGTCCAGCCCCAGG - Intergenic
971498095 4:27289123-27289145 CTCTGGTGCTCTCCAGCCCCTGG - Intergenic
975064232 4:70041142-70041164 CAGTCGGACTCTTCAGCTGCAGG + Intergenic
978532516 4:109729705-109729727 CAGGGTGGCTCTCCAGTCGGTGG + Exonic
985802039 5:2010825-2010847 CTGTGGGGCTCGCCATCAGCGGG - Intergenic
988410351 5:30878095-30878117 CAGTGGGGCTCACACCCCGCTGG - Intergenic
996082258 5:119268946-119268968 CAGCGCGCCTCTCCCGCCGCTGG + Intronic
997645096 5:135476694-135476716 CAGTGGGGCTCCCCAGCACTCGG + Intergenic
998385202 5:141753456-141753478 CAGGGCCTCTCTCCAGCCGCGGG - Intergenic
1000125377 5:158238650-158238672 CTGTGGACCTCTCCAGCAGCAGG + Intergenic
1002427681 5:179185741-179185763 CAGTGGAGCTCCCCAGCCAGGGG - Intronic
1003498852 6:6687440-6687462 CAGTGCGCCTCCCCAGCCCCAGG + Intergenic
1003639129 6:7861977-7861999 CAGTGGGGACCTCAAGCTGCTGG - Intronic
1007358162 6:41335676-41335698 AAGTGGGGATCTCCAGCTGTAGG - Intronic
1007788573 6:44296428-44296450 GAGTGGTGCTCTCCTGCCCCTGG + Intronic
1009712777 6:67346760-67346782 GAATGGGGATCTCCAGACGCAGG + Intergenic
1016581221 6:145630927-145630949 CAGTGTGACTCTGAAGCCGCAGG + Intronic
1018632642 6:165834239-165834261 CAGTGGGACTCACCAGATGCTGG + Intronic
1025978838 7:66391424-66391446 GAGTAGGGGTCTCCATCCGCAGG - Intronic
1026062271 7:67036972-67036994 CAGTGGGGCAGACCAGCAGCTGG + Intronic
1026716075 7:72790477-72790499 CAGTGGGGCAGACCAGCAGCTGG - Intronic
1029611470 7:101628763-101628785 CAGTTAAGCTCTCCAGCCCCTGG - Intronic
1034462407 7:151205149-151205171 CAGTGGGGCCCTCCAGGTGTGGG + Intronic
1035650666 8:1261531-1261553 TCGGGGGGCTCTCCAGCCGAGGG + Intergenic
1036344961 8:7955231-7955253 CAGCGGGGGTATCCAGCCTCAGG - Intergenic
1036650406 8:10638735-10638757 CAAGGGGGCTCTCCAGACGGAGG + Intronic
1036798038 8:11769910-11769932 CAGTGGGGGCCTCCAGGCGTGGG - Exonic
1036821364 8:11942548-11942570 CAGTGGGGCTCTCAGCCCTCTGG + Intergenic
1036840299 8:12115998-12116020 CAGCGGGGGTATCCAGCCTCAGG - Intergenic
1036862090 8:12362235-12362257 CAGCGGGGGTATCCAGCCTCAGG - Intergenic
1039075840 8:33689788-33689810 GAGTGGGGCTGCCCAGCGGCCGG - Intergenic
1040298072 8:46173567-46173589 CAGTTGGGCTGTACAGCCCCAGG + Intergenic
1042998243 8:74725199-74725221 CAGTGCAGCTCTGCAGCCACAGG - Intronic
1043741302 8:83815305-83815327 CACTGGGGAACTCCAGCAGCTGG + Intergenic
1047528655 8:125655851-125655873 CAGTCAGGCACTCCAGCGGCTGG + Intergenic
1048970287 8:139641575-139641597 CGGTGGGCCTCTCCAGAAGCTGG + Intronic
1049424093 8:142530391-142530413 CAGTTGGGCTTTCCAGCCTGAGG + Intronic
1053503477 9:38621165-38621187 CAGTGGCCCTCTGCAGCCACGGG + Intergenic
1054460486 9:65459636-65459658 CAGTGGGGCTCACCAAGCGCAGG + Intergenic
1057152655 9:92808744-92808766 CAGTGGCCCTCTGCAGCCACCGG - Intergenic
1059350103 9:113658436-113658458 GAGTGGGGCGCTCCAGGCACAGG - Intergenic
1061458018 9:130713115-130713137 CGGAGGGGCTCCTCAGCCGCAGG - Intergenic
1062121208 9:134835024-134835046 CAGAGGCGCTCAGCAGCCGCAGG - Exonic
1062615838 9:137395308-137395330 CGGTGGCGCTCGCCAGCGGCAGG + Exonic
1189252756 X:39613918-39613940 CTGTGATGCTCTGCAGCCGCCGG + Intergenic
1200977278 Y:9226788-9226810 CACTGGGGCTCTCCAGTTTCTGG - Intergenic
1201763723 Y:17562077-17562099 CAGTGGGGTTCTGGAGTCGCTGG - Intergenic
1201837830 Y:18343913-18343935 CAGTGGGGTTCTGGAGTCGCTGG + Intergenic