ID: 1119808540

View in Genome Browser
Species Human (GRCh38)
Location 14:77498416-77498438
Sequence CCGGGCTGCCGCGGACCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119808540_1119808547 1 Left 1119808540 14:77498416-77498438 CCGGCTGGTCCGCGGCAGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 187
Right 1119808547 14:77498440-77498462 TCGCGGTCACGCGCGAGGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 13
1119808540_1119808546 -4 Left 1119808540 14:77498416-77498438 CCGGCTGGTCCGCGGCAGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 187
Right 1119808546 14:77498435-77498457 CCGGCTCGCGGTCACGCGCGAGG 0: 1
1: 0
2: 1
3: 2
4: 76
1119808540_1119808549 26 Left 1119808540 14:77498416-77498438 CCGGCTGGTCCGCGGCAGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 187
Right 1119808549 14:77498465-77498487 GCCCCGAAGTCCGGCGCACCTGG 0: 1
1: 1
2: 0
3: 3
4: 57
1119808540_1119808548 17 Left 1119808540 14:77498416-77498438 CCGGCTGGTCCGCGGCAGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 187
Right 1119808548 14:77498456-77498478 GGAGTGGAAGCCCCGAAGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 115
1119808540_1119808551 27 Left 1119808540 14:77498416-77498438 CCGGCTGGTCCGCGGCAGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 187
Right 1119808551 14:77498466-77498488 CCCCGAAGTCCGGCGCACCTGGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119808540 Original CRISPR CCGGGCTGCCGCGGACCAGC CGG (reversed) Intronic
900255060 1:1693532-1693554 CGGGGCTGCCGCGGGACATCCGG + Intronic
900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG + Intergenic
901886968 1:12230169-12230191 CAGGGCCGGCGCGGACCCGCGGG + Intronic
902124923 1:14201440-14201462 CCTGGCTGCCCCGGAGCAGCTGG + Intergenic
905685043 1:39901846-39901868 CCGGGCTGCCCCGAGCCGGCGGG - Exonic
907540973 1:55215236-55215258 CCCGGCTGCTGCGGAGCACCCGG - Intergenic
907866497 1:58404481-58404503 CAGGGCAGCTGGGGACCAGCAGG + Intronic
908293107 1:62687938-62687960 CCGGGCCGCCGAGGAGCAGGAGG + Intronic
910127568 1:83860754-83860776 CCGGGACGCCCCGGACCACCTGG - Intergenic
915606196 1:156952892-156952914 CAGGGCTGCGGCTGCCCAGCTGG - Intronic
921046126 1:211479173-211479195 CCAGGCTGCCGCGGGGCCGCAGG + Exonic
921923108 1:220690322-220690344 CCGGGCTGGGGCGGAGGAGCGGG + Exonic
921944920 1:220879818-220879840 CGCGGCTGCCGCAGTCCAGCCGG - Exonic
1064209107 10:13348196-13348218 CCGGGCCGCCGCGCTCCCGCCGG + Exonic
1066126322 10:32346577-32346599 CCCGGCCGCCGCGGCCCAGCGGG - Intronic
1068965996 10:62912636-62912658 CCCAGCTGCCTCGGACCAGATGG + Intronic
1071285368 10:84139602-84139624 CCGGGCGCCCGCCGGCCAGCCGG - Intronic
1074365488 10:112854499-112854521 CTGGGCGGCCGGGGCCCAGCTGG - Intergenic
1075348070 10:121698991-121699013 CCTGGCTGCCACAGCCCAGCTGG + Intergenic
1076169241 10:128306104-128306126 GCTGGCTGCCGCTGATCAGCCGG - Intergenic
1076743901 10:132503167-132503189 CCGGGGAGCCGCTGACCTGCAGG + Intergenic
1077752477 11:4987970-4987992 CCGGGATGCTGAGGACCATCAGG + Intronic
1077910986 11:6571136-6571158 CAGGGCGGCTGCGGACCGGCCGG - Exonic
1078845302 11:15114622-15114644 CCGGGCTCCCCCGGGCCAGGCGG - Intronic
1081811679 11:45917736-45917758 CCCGGCCGCCACGGCCCAGCTGG - Exonic
1081874929 11:46401974-46401996 CAGGGCTGCCGGGTACCTGCAGG - Intronic
1082011006 11:47449441-47449463 CCTGGCTTCCCCGGACCTGCAGG - Intergenic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1083634958 11:64115936-64115958 CCGTGCTGCCGCGGCCCTCCTGG - Intronic
1084184599 11:67464912-67464934 CCGGGCTGCCGCTGACTGCCCGG + Intronic
1089302321 11:117506044-117506066 CAGGGGTGCCGAGGAGCAGCAGG - Intronic
1092894532 12:13000005-13000027 CAGGGCTGCCGAGGACCTGAAGG - Intronic
1093464936 12:19439753-19439775 CCGGGCTGCCGGGGGGCAGAGGG - Exonic
1095444963 12:42273956-42273978 CCTTGCTGCCCAGGACCAGCAGG + Intronic
1097083343 12:56449316-56449338 CCGGGCTTCTGAGGACCCGCAGG - Exonic
1100246025 12:92757732-92757754 CCTGGCTGCCTTGGTCCAGCTGG + Intronic
1102253961 12:111405731-111405753 CCTGGCAGCCGCGGACTAGCGGG + Intergenic
1102349609 12:112182719-112182741 CAGGCCTGCCGCGTTCCAGCTGG - Intronic
1103856556 12:123973836-123973858 CCGGGCGGCTGCGGAGGAGCCGG + Exonic
1103926649 12:124427134-124427156 CCGGGCTCCCTGGGCCCAGCTGG - Intronic
1105409500 13:20160507-20160529 CCGGGCTGTCCCGGACCGTCAGG - Intronic
1106087640 13:26557746-26557768 CCGGGCGGCCGCGGCGCGGCGGG + Exonic
1116945420 14:50831113-50831135 CCGGGTGGCCGCGGCCGAGCCGG - Exonic
1118366842 14:65103064-65103086 TCTGGCTGCGGCGGACCAGGGGG + Intergenic
1119808540 14:77498416-77498438 CCGGGCTGCCGCGGACCAGCCGG - Intronic
1121201604 14:92122331-92122353 ACGGGCTGCCGCAAAACAGCTGG - Intronic
1124237501 15:28003071-28003093 CGTGGCTGACGCGGACCCGCAGG - Intronic
1125513148 15:40303489-40303511 CCAGGCTGCCCAGGGCCAGCTGG + Intronic
1127966963 15:63929726-63929748 CCGGGCTGCTGCTGAAGAGCAGG - Intronic
1128508791 15:68300792-68300814 CTGGGCTGCATCTGACCAGCAGG + Intronic
1131052925 15:89360005-89360027 CCGGGCTGTGGGGGAGCAGCTGG + Intergenic
1132701184 16:1222791-1222813 CAGGACAGCCGGGGACCAGCGGG - Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1136229842 16:28879705-28879727 GCGGGCTGGCGCGCAGCAGCGGG + Intronic
1136382004 16:29900191-29900213 CCGGGCTGCCTAGGGCCAGCGGG + Intergenic
1136778488 16:32883745-32883767 CCAGGCTGCCCAGGCCCAGCGGG + Intergenic
1136892132 16:33977769-33977791 CCAGGCTGCCCAGGCCCAGCGGG - Intergenic
1139468133 16:67164913-67164935 CCGGGCTCCAGCGGATCAGGTGG - Exonic
1140354881 16:74297057-74297079 CGCGGCGGCCGCGGACGAGCTGG + Intronic
1140512312 16:75517150-75517172 CCGGTGTGCCGCTGACCTGCTGG - Intergenic
1142185747 16:88694004-88694026 CCGAGCTGCCGCGGCCCCGGTGG + Intergenic
1203080910 16_KI270728v1_random:1145854-1145876 CCAGGCTGCCCAGGCCCAGCGGG + Intergenic
1145828165 17:27893065-27893087 CCGGGCGGCCTCGGAGGAGCAGG - Intronic
1146181000 17:30698027-30698049 CCTGGCGGCCGCAGAGCAGCGGG + Intergenic
1150433463 17:65137237-65137259 CCGGGACCCCGCGGAGCAGCAGG - Intergenic
1151894501 17:76970875-76970897 CGGCTCTGCCGCTGACCAGCTGG + Intergenic
1152181808 17:78827009-78827031 CCAAGCCGCCCCGGACCAGCAGG + Intronic
1152867612 17:82733830-82733852 CAGGGCTGCCGCAGAACAGCAGG - Intergenic
1153900605 18:9614495-9614517 CCGGGCGGCCGCGGAGGAGGGGG - Exonic
1160562394 18:79766803-79766825 CCAGGCTGCAGTGGACCAACAGG - Intergenic
1160854825 19:1212045-1212067 CTGGGCAGCCGCAGAACAGCGGG + Intronic
1160932601 19:1577796-1577818 CCGAGCTGCCGGGCACCTGCTGG + Exonic
1161014911 19:1978744-1978766 CCCGCCCGCCGCGCACCAGCTGG - Exonic
1161233906 19:3188724-3188746 CCGGGAGCCCACGGACCAGCTGG - Intronic
1161257991 19:3320402-3320424 CCGGGCGGGCGCGGGCCAGGGGG - Intergenic
1161557891 19:4954801-4954823 CCGGGCTGCCGCTCGCCGGCCGG - Exonic
1162372489 19:10287795-10287817 CCGAGCTGTTGCGGACCACCAGG - Exonic
1162977598 19:14217552-14217574 CCTGGCGGCCGCAGAGCAGCGGG - Intergenic
1163507994 19:17719631-17719653 CCGGGCTCCCGCGGGCCCCCAGG - Intronic
1163525910 19:17821339-17821361 CCTGGCTTCGGTGGACCAGCGGG + Exonic
1163638662 19:18449663-18449685 CTGGGCTGCCCTGGGCCAGCTGG + Intronic
1163714646 19:18866691-18866713 CCTCGCCGCCGCGGGCCAGCAGG - Exonic
1164852987 19:31500240-31500262 CAGGGCTGCCCCAGTCCAGCCGG + Intergenic
1164990113 19:32676775-32676797 CCGGGCTTGCACGGTCCAGCGGG - Exonic
1165073283 19:33267788-33267810 CCGAGCTGCCTCAGGCCAGCTGG + Intergenic
1165097262 19:33416487-33416509 TCGTGCAGCCCCGGACCAGCTGG + Intronic
1165188485 19:34042099-34042121 CCTGGCTGCCACTCACCAGCAGG + Intergenic
1165471399 19:36006749-36006771 CCAGGCTGTAGCTGACCAGCTGG + Exonic
1165772633 19:38387940-38387962 CCGGGCTCCCGCGGGCTCGCAGG - Intronic
1166960921 19:46495384-46495406 CCGGGATGCCGGTGACCAGCAGG + Exonic
1168107673 19:54174325-54174347 CCTGGCTGCCGAGGGCCGGCTGG - Exonic
1168146847 19:54424419-54424441 CCGGGATGCTGCGCTCCAGCGGG + Intronic
926027238 2:9555858-9555880 CCGGGATGCCGCGCGGCAGCCGG - Intergenic
926155867 2:10453766-10453788 CCGGGTTCCTGGGGACCAGCAGG + Intergenic
926756844 2:16243413-16243435 CAGGGCTGCTCTGGACCAGCAGG - Intergenic
929242433 2:39666199-39666221 CCGGGCCGCCCGGGAGCAGCCGG - Exonic
930730685 2:54724979-54725001 TGGGGCTGCGGCGGACCTGCAGG - Exonic
931904004 2:66822466-66822488 CTGGGCTGCCGCACAGCAGCAGG + Intergenic
934656056 2:96117191-96117213 CCGGGCTGCCGCTGACGGGCTGG - Intergenic
934756629 2:96828763-96828785 CCGGGCAGTCTCAGACCAGCTGG - Intronic
934896934 2:98127434-98127456 CCGGGCTGCAGCAGAGCAGGAGG + Intronic
936165401 2:110115807-110115829 GCGAGCTGCCGCGGAGCACCCGG - Exonic
941309752 2:163913644-163913666 CCGCGCTTGCGCGGGCCAGCTGG + Intergenic
942212693 2:173687592-173687614 CTGGGCTGCCAGAGACCAGCTGG - Intergenic
947623312 2:231604535-231604557 CTGCGCTGCCGCGGGCCAGGCGG + Intergenic
948663924 2:239523022-239523044 CGGGGATGCGGCAGACCAGCAGG + Intergenic
1169120483 20:3092964-3092986 CCGGGGTGGCGCCGACCCGCGGG - Intergenic
1169211399 20:3767919-3767941 CCCGGCAGGCGCGGACTAGCAGG - Intronic
1171464835 20:25320108-25320130 CCGGTCTGCCGGAAACCAGCAGG - Intronic
1172162779 20:32879985-32880007 CCGGGCAGCCCAGGCCCAGCAGG - Intronic
1174204238 20:48827738-48827760 CCGGGCGGCCGCGCACGGGCCGG + Exonic
1174441854 20:50561983-50562005 CAGGGCTGCCACAGGCCAGCAGG - Intronic
1175598400 20:60253618-60253640 CTGGGCTGCCCCAGCCCAGCAGG - Intergenic
1179539168 21:42073066-42073088 CGGCTCTGCTGCGGACCAGCTGG + Intronic
1179549578 21:42135503-42135525 CCGGGCTGCAAAGGGCCAGCAGG + Intronic
1180190902 21:46161987-46162009 CCAGGATGCGGCGGTCCAGCTGG + Exonic
1181007652 22:20021565-20021587 GCGGCCTGCTGCGGGCCAGCAGG + Intronic
1183698231 22:39435347-39435369 CCCGGCAGCCGGGGACCTGCTGG - Intronic
1183745793 22:39691024-39691046 CCGGGCTGGTGCGGATCTGCCGG + Intergenic
1184163952 22:42716556-42716578 CCGCTCTGCCGCTGCCCAGCAGG - Intronic
1184176374 22:42791851-42791873 CGGGGCCCCCGCGGACCTGCTGG - Intergenic
1185139909 22:49094318-49094340 CTGGGCTGCCAGGGACCTGCAGG + Intergenic
1185409308 22:50674106-50674128 GCGGGCATCCGCGGACCACCGGG - Intergenic
950522291 3:13504497-13504519 CCCGGCGGCCACGGACCATCCGG - Exonic
952287242 3:31981036-31981058 CCCGGCCGCCGCCGACCGGCTGG + Exonic
952382694 3:32817290-32817312 GCGGGCAGCCGCGGCCCGGCTGG + Intergenic
961734668 3:128993918-128993940 CCGGGCTGCGGCGGCCGAGGTGG + Intronic
968490580 4:888754-888776 CCTGGCTGCGGTGGAACAGCTGG - Intronic
968701147 4:2058919-2058941 CCGGGCGGCCGCGGAGGAGGAGG + Intergenic
968750566 4:2386947-2386969 CCTGACTGCCGGGGGCCAGCGGG - Intronic
968927650 4:3558315-3558337 CCAGGCTACCGAGGGCCAGCTGG + Intergenic
969303106 4:6309065-6309087 CCGGCGTGCCGCGGAGCAGGGGG + Intergenic
977874738 4:102135647-102135669 TGGGGCTGCAGAGGACCAGCGGG - Intergenic
979664765 4:123298387-123298409 CTGGGCCTCAGCGGACCAGCTGG - Intronic
981044521 4:140253043-140253065 CGGGGCTGCTGCGGCCTAGCCGG - Intergenic
981920121 4:150078183-150078205 CGGGGCTGCCCGGGACCCGCAGG + Intergenic
985316030 4:188659537-188659559 CCGAGCTGGCGCGAACCTGCAGG - Intergenic
987374017 5:17217834-17217856 CCGCGCCGCCGCGGACCCGGGGG + Intronic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
992409934 5:76495452-76495474 CTGGGCTGCCAGGGACCAGCTGG + Intronic
997120113 5:131164959-131164981 CCTGGCTGCCCTGGTCCAGCGGG - Intronic
1003824897 6:9942273-9942295 CGGGGCTGGCGGGGGCCAGCCGG - Intronic
1006162582 6:32046994-32047016 CCTGGCTGCCCCGGCCCAGTGGG - Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1014137656 6:117907614-117907636 CCGGGCGGCCGCGGCCCGGGAGG - Exonic
1014755893 6:125301810-125301832 CCGGGAGGCCGCGGCCGAGCGGG - Intronic
1017002322 6:150005077-150005099 CCGCCCTGACCCGGACCAGCCGG + Intergenic
1017946589 6:159100983-159101005 CCAGGCTGCTGTGGAACAGCTGG - Intergenic
1024062578 7:45709945-45709967 CCGGACAGCTGCAGACCAGCTGG - Intronic
1027111396 7:75442622-75442644 CGGGGCTGCGGCGGGCCGGCCGG - Intronic
1028989493 7:97034447-97034469 CCGCACTGCCGTGGGCCAGCAGG - Intergenic
1033452271 7:141472518-141472540 CAGGGCTGCTGGGCACCAGCAGG - Exonic
1034446047 7:151114881-151114903 CCGCGCTGCCGCCGCCCTGCAGG + Intronic
1035269442 7:157711083-157711105 CCGGGCTGCCCCGGAACCTCCGG - Intronic
1037910163 8:22739534-22739556 CTGGGCTGCCTCTGTCCAGCCGG - Intronic
1038229943 8:25690453-25690475 CGGGGCTTCCGGGGAGCAGCAGG + Intergenic
1038485769 8:27934206-27934228 CCAGGGTGCAGAGGACCAGCTGG + Intronic
1038554085 8:28494433-28494455 GCGGGCTGAGGCGGAGCAGCAGG - Intronic
1038828750 8:31033835-31033857 CCGCGCTGCCGAGTACAAGCCGG - Exonic
1039579406 8:38651432-38651454 GCCGGCTGCCGTGGACAAGCGGG - Intergenic
1039873621 8:41567416-41567438 CCGGGCTGCTGCGCCCCAGGAGG + Intergenic
1044569316 8:93700212-93700234 CCGGTCCGCCGGGGACCAGGAGG - Intronic
1044821783 8:96160233-96160255 CCTGGCTGCCGAGCTCCAGCGGG + Intronic
1049013216 8:139901794-139901816 CGGCTCTGCCACGGACCAGCTGG + Intronic
1049612683 8:143562723-143562745 CCGGGCTCCTGGGGAACAGCTGG + Exonic
1049686728 8:143942119-143942141 CCAGGCTGACGTGGAACAGCCGG + Intronic
1049726392 8:144148386-144148408 CCGGGCTCCCGCGGAGGGGCGGG - Intronic
1051711367 9:19934438-19934460 CCGGGCTCCCGCGCACCACAAGG + Intergenic
1053802509 9:41773394-41773416 CCAGGCTACCGAGGGCCAGCTGG + Intergenic
1054142728 9:61541676-61541698 CCAGGCTACCGAGGGCCAGCTGG - Intergenic
1054190817 9:61984740-61984762 CCAGGCTACCGAGGGCCAGCTGG + Intergenic
1054462479 9:65472826-65472848 CCAGGCTACCGAGGGCCAGCTGG - Intergenic
1054647556 9:67602977-67602999 CCAGGCTACCGAGGGCCAGCTGG - Intergenic
1057716694 9:97501643-97501665 CCGGGCGGCCGCGGGCGGGCGGG - Exonic
1058687156 9:107489185-107489207 TCGGGCTGCCGAGGACCTTCTGG - Exonic
1060991056 9:127849432-127849454 CAGGGCTGCCTCTGACCTGCTGG + Intronic
1061545577 9:131302334-131302356 CTGGGCTGGAGAGGACCAGCTGG + Intronic
1062428261 9:136515956-136515978 GCGGGCTGGCGCCCACCAGCGGG - Intronic
1203761010 EBV:13021-13043 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203761117 EBV:13315-13337 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203761939 EBV:16093-16115 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203762046 EBV:16387-16409 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203762868 EBV:19165-19187 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203762975 EBV:19459-19481 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203763797 EBV:22237-22259 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203763904 EBV:22531-22553 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203764726 EBV:25309-25331 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203764833 EBV:25603-25625 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203765655 EBV:28381-28403 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203765762 EBV:28675-28697 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203766584 EBV:31453-31475 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203766691 EBV:31747-31769 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203767513 EBV:34525-34547 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1203767620 EBV:34819-34841 CCGGGCTGCCGGGGTCCCTCCGG - Intergenic
1200101343 X:153690311-153690333 CCAGGCTGCCCAGGCCCAGCGGG - Intronic
1200142631 X:153909593-153909615 CCTGGCTGGCGCGGAGCTGCTGG - Intronic