ID: 1119811168

View in Genome Browser
Species Human (GRCh38)
Location 14:77520840-77520862
Sequence GAATTGGAGCACCGTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119811168 Original CRISPR GAATTGGAGCACCGTGCCCC AGG (reversed) Intronic
900962541 1:5934490-5934512 GAAGTGGAGCACTGTGCTCATGG - Intronic
902223380 1:14981014-14981036 CCAGTGGAGCACCGTGCTCCTGG + Intronic
903792395 1:25903777-25903799 GAACTGGAGAAGCGTGCCTCAGG - Exonic
914676812 1:149912384-149912406 GAATTGGAGCCCCTTTCCCCAGG - Intronic
915674181 1:157515437-157515459 GAGTGGGAGCACCTTGCCACTGG + Exonic
922603941 1:226877387-226877409 GAATAGTAGCACCTTGCTCCAGG + Intronic
923725130 1:236499188-236499210 GAGAGGGAGCACCGTGCCCTCGG + Intergenic
1063635119 10:7775145-7775167 GAATTGGAGTACTGTTCCCCAGG - Intronic
1065396479 10:25244282-25244304 GAATTGGAGCACAGAGTCCCAGG - Intronic
1065554919 10:26905734-26905756 GAATTTGAGCACAGTGCCGTCGG - Intergenic
1067385232 10:45812645-45812667 GAATATGAGCCCCTTGCCCCCGG - Intergenic
1067449791 10:46375308-46375330 GAATATGAGCCCCTTGCCCCCGG + Intergenic
1067587459 10:47484456-47484478 GAATATGAGCCCCTTGCCCCCGG - Intergenic
1067634515 10:47992222-47992244 GAATATGAGCCCCTTGCCCCCGG - Intergenic
1067634704 10:47993556-47993578 GAATATGAGCCCCTTGCCCCCGG - Intergenic
1071610531 10:87027458-87027480 GAATATGAGCCCCTTGCCCCTGG + Intergenic
1076859268 10:133132885-133132907 GAATGGGAGCACTGGGCCCCTGG + Intergenic
1092902231 12:13070767-13070789 AACTGGGAACACCGTGCCCCAGG + Intronic
1094690262 12:32761608-32761630 AAATTTGATCAACGTGCCCCAGG - Intergenic
1108150354 13:47527368-47527390 GAATCGGAGCCCCGTGACACTGG - Intergenic
1119526709 14:75328572-75328594 AAATTGCAGCAGCCTGCCCCAGG + Intergenic
1119811168 14:77520840-77520862 GAATTGGAGCACCGTGCCCCAGG - Intronic
1122474805 14:101999944-101999966 GAATTGGAGCACAATGTCTCAGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1124232493 15:27957343-27957365 GAATTTGAGCGGCGTGCCCAGGG - Intronic
1129895649 15:79103919-79103941 GAAGTGGAGCAACTTGCCCAAGG - Intergenic
1137406977 16:48196942-48196964 GAAAAAGAGCACCGTTCCCCAGG - Intronic
1141986928 16:87586083-87586105 CATTTGGAGCCCCGTGACCCCGG - Intergenic
1142287232 16:89176417-89176439 GAAATGGAGCACCGAGAACCGGG - Intronic
1147431832 17:40376023-40376045 GAAATGGAGCACAGTGCCAGTGG - Intergenic
1148676243 17:49446925-49446947 GAAGTGAAGCAACGTGCCCAAGG - Intronic
1150626990 17:66848219-66848241 GAAATGGAGCAACGTCCCTCAGG - Intronic
1152052964 17:77996772-77996794 GAATCTGAGCACTGTGGCCCAGG + Intergenic
1154266376 18:12883099-12883121 GCATCGGAACACCGTGCCCCCGG + Intronic
1155076148 18:22357243-22357265 GAAGGTGAGCACCGTGACCCAGG - Intergenic
1156388873 18:36631669-36631691 GAGTTGAAGCACCTTGCCCAAGG + Intronic
1156500881 18:37557352-37557374 GAACTGCAGCACCCTGCCCTCGG + Intronic
1162346000 19:10118612-10118634 GAATTGGAAAACCGTGCTCCCGG - Intronic
1165450143 19:35877753-35877775 GAATTGGAAGCCCCTGCCCCTGG + Exonic
1167122124 19:47523781-47523803 GAGGTGGAGCACAGTGCCTCCGG + Intronic
937258880 2:120572942-120572964 GACTGGCAGCCCCGTGCCCCGGG - Intergenic
937292820 2:120792085-120792107 GAATTAGAGCATTGTTCCCCAGG - Intronic
939784671 2:146494628-146494650 GACTTGGTGCACTGTGTCCCAGG - Intergenic
945618667 2:212106769-212106791 GACTTGGTGCCCTGTGCCCCAGG + Intronic
948722253 2:239908447-239908469 GTCTGGGAGCACCGTGCCCAGGG - Intronic
1172939772 20:38646242-38646264 GAAGGGAAGCACCGCGCCCCAGG - Intronic
1182622625 22:31626316-31626338 GAACTTGAGCCCCGTGCTCCAGG + Intronic
951758288 3:26117442-26117464 GCATTCGAGCACCATGCCCAGGG - Intergenic
954454969 3:50592836-50592858 GACCTGGAGCACTGTGCCCGAGG + Intergenic
954543831 3:51415962-51415984 GAAATGGAGGACCTTGGCCCTGG - Intronic
956183930 3:66544828-66544850 GAATTCGAGCACAGTGCCGTTGG + Intergenic
970177473 4:13353940-13353962 GAATGGGAGTGCCGTGCCCTAGG + Intergenic
973041791 4:45477520-45477542 GAATTCGAGCACAGTGCCAGTGG + Intergenic
976406394 4:84664880-84664902 GAAATGGAGCGCAGTGCCCGTGG - Intergenic
976680791 4:87753676-87753698 GACGTGGGGCACCATGCCCCAGG + Intergenic
978991222 4:115084589-115084611 GATTTGGTGCCCCGTGCCTCAGG + Intronic
980729941 4:136812127-136812149 GACCTGGAGCCCCCTGCCCCAGG - Intergenic
981169548 4:141605566-141605588 GAAATCGAGCACAGTGCCCGTGG + Intergenic
985523181 5:388679-388701 CAATGGGAGGACGGTGCCCCTGG - Intronic
985780669 5:1869321-1869343 GAATGGGAGCCACTTGCCCCTGG + Intergenic
990665704 5:58069305-58069327 GAATTCGAGCACAGTGCCGGCGG + Intergenic
992835877 5:80640947-80640969 GAATCGGAGGACCCTGCCACAGG - Intronic
998394952 5:141812287-141812309 GAAATGCAGCCCCCTGCCCCGGG - Intergenic
1010760234 6:79714195-79714217 GAATTGGAGCATAATGCCTCTGG - Intergenic
1019558790 7:1645649-1645671 GAGTGGGACCTCCGTGCCCCGGG + Intergenic
1019834577 7:3369915-3369937 GACTGGGAGCACAGTGCCCTAGG + Intronic
1024976850 7:55121352-55121374 CAATGGGAGCCCCGTGCCTCTGG + Intronic
1026213151 7:68324514-68324536 CAATAGGAGCACCTTCCCCCAGG + Intergenic
1030676472 7:112390905-112390927 GAATAGGAACACCGGGCACCGGG - Intergenic
1036229864 8:6990489-6990511 GCATTGGAGCACAGAGCACCAGG - Intergenic
1036232315 8:7009592-7009614 GCATTGGAGCACAGAGCACCAGG - Intronic
1036953925 8:13166874-13166896 GAATTGGTGCCCTGTGGCCCTGG + Intronic
1037478442 8:19280213-19280235 GAATTTGGGCACTGAGCCCCCGG - Intergenic
1038411130 8:27360656-27360678 GTATTGGGGCATCGTACCCCAGG - Intronic
1057025942 9:91733834-91733856 GAAGTGCAGTACCGAGCCCCAGG + Intronic
1059841436 9:118222020-118222042 GAATGTAAGCACCTTGCCCCAGG - Intergenic
1195695247 X:107662254-107662276 GAAGTGGAGGACTGTGCCCTGGG - Intergenic