ID: 1119811521

View in Genome Browser
Species Human (GRCh38)
Location 14:77524692-77524714
Sequence TGTCATTTGCACAAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 2, 1: 2, 2: 9, 3: 52, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119811519_1119811521 -3 Left 1119811519 14:77524672-77524694 CCATGAAAAGAATGAAATGCTGT 0: 1
1: 11
2: 214
3: 983
4: 2144
Right 1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG 0: 2
1: 2
2: 9
3: 52
4: 309
1119811518_1119811521 1 Left 1119811518 14:77524668-77524690 CCAGCCATGAAAAGAATGAAATG 0: 1
1: 0
2: 10
3: 54
4: 347
Right 1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG 0: 2
1: 2
2: 9
3: 52
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119811521 Original CRISPR TGTCATTTGCACAAGATGGA TGG Intronic
902967821 1:20022563-20022585 TGGCATTTGCACAACCTAGATGG - Intergenic
904960055 1:34325381-34325403 TCTCATTCCCACAAGAAGGATGG - Intergenic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906647360 1:47484990-47485012 TGACATTTTTACAAGTTGGATGG - Intergenic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907959871 1:59268875-59268897 TGTGGTTTGCACAAGAGTGATGG + Intergenic
909460160 1:75902506-75902528 TGTCCTTTACACAACATAGATGG - Intronic
910217384 1:84855914-84855936 TGGCATTTGAACAAGTGGGATGG + Intronic
910545385 1:88410063-88410085 TGTCATTTGCCAAAAATAGAAGG - Intergenic
910733644 1:90427287-90427309 TGTCATTTGCAACAAATGGATGG + Intergenic
911044698 1:93618803-93618825 TGTCTTTTGCTCTAGAAGGAGGG - Intronic
911856243 1:102879866-102879888 TGTCATTTGCACCATATTGATGG + Exonic
911961407 1:104307756-104307778 TGTCACTTGCAAATCATGGATGG + Intergenic
912019131 1:105083065-105083087 TGTTATTTACATAATATGGAGGG - Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915537113 1:156543441-156543463 TGTCAATTTCACAAAAAGGAAGG + Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916247286 1:162701327-162701349 TGGCATTTGCAGTAAATGGAAGG + Intronic
916301301 1:163277327-163277349 TGACATGTGCCCAAGATGGGTGG - Intronic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
923615742 1:235535571-235535593 GGTCATTTGCCGAAGATGCATGG - Intergenic
924740280 1:246790860-246790882 TCTCATGTGCACAGGAGGGAAGG + Intergenic
1063007981 10:1993033-1993055 TGTCTGTTGCATAAGATGCACGG + Intergenic
1065045384 10:21743642-21743664 TCTCATTTGGAGAGGATGGAGGG + Intergenic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1065820365 10:29519522-29519544 TTTCATTTTCACAAAAGGGAGGG + Intronic
1066673259 10:37861760-37861782 TGACATGTGCCCAAGATGGTCGG + Intergenic
1069108785 10:64417320-64417342 TGTCATTTGCAGCAGAGTGAAGG - Intergenic
1069143673 10:64861485-64861507 TGTCATGTGAACAATATGTATGG + Intergenic
1069253888 10:66308123-66308145 TTTCATTTGCAAAAAATGCAGGG - Intronic
1069258924 10:66369687-66369709 TGTCATTTGCAAATGTTGGCCGG + Intronic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1070590480 10:77797086-77797108 TGGCAGAGGCACAAGATGGAAGG + Intronic
1071436899 10:85655784-85655806 TGTCATTTTAAAAGGATGGAAGG - Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG + Intergenic
1073084668 10:100880396-100880418 TGTTATTTGCAGAACAGGGATGG - Intergenic
1073483769 10:103803819-103803841 TGACATGTGCCCAAGGTGGATGG + Intronic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073986791 10:109218837-109218859 TGGTGTTTCCACAAGATGGAAGG - Intergenic
1074744955 10:116523328-116523350 TGTCAATTACTCAAGAAGGAAGG + Intergenic
1075394193 10:122114633-122114655 TGGCATTTGCACAAGGAGGGTGG - Intronic
1075767459 10:124905020-124905042 TGTTATTTCCAAATGATGGAAGG - Intergenic
1075870445 10:125769318-125769340 TGGCAATTGCTCAACATGGAAGG - Intronic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1081015456 11:37872745-37872767 TGACATTTTCACAACATGAATGG - Intergenic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1081714426 11:45238440-45238462 TGTTTTATGCACAAGATAGAAGG + Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1084131825 11:67141973-67141995 TGTCATTTTCGGAACATGGATGG - Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086112464 11:83215032-83215054 TGTCAGTGCCACAAGATGGATGG - Intronic
1086236564 11:84638251-84638273 TGTCCTTGGCACCAAATGGAAGG + Intronic
1088737356 11:112738683-112738705 TGACATTTCCAGAGGATGGAGGG - Intergenic
1089020757 11:115211950-115211972 TGTGATTTGCACAAAATGGGAGG - Intronic
1089511275 11:118998681-118998703 TGTGATTTGATCAAGAAGGATGG + Intronic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1092893649 12:12992658-12992680 TGTCAGATTCACCAGATGGAGGG - Intronic
1093819879 12:23601235-23601257 TGCAATTTGCAAAAAATGGAAGG - Intronic
1093865809 12:24226342-24226364 TGTCTTTTGCATAAGAAAGAAGG - Intergenic
1094468343 12:30778701-30778723 TGACATGTGCCCAAGATGGTTGG + Intergenic
1095389167 12:41685443-41685465 TGGCATTTGCACAACCTGGGTGG + Intergenic
1095594356 12:43941759-43941781 TGTCATTAGAACAAAATGGCAGG - Intronic
1095980416 12:47970656-47970678 TGTGATTTGCACAGGATCCAAGG + Intergenic
1096722006 12:53530094-53530116 TGTCATTTCCCCAAGAGAGAAGG + Intronic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1097764875 12:63514507-63514529 TGTCTTTTCCACAAGAGGGGAGG - Intergenic
1098118439 12:67206702-67206724 TGTCATTTGCACAACATAGATGG + Intergenic
1098684636 12:73403079-73403101 TATCACTGGCACAAGTTGGAAGG + Intergenic
1099186883 12:79524807-79524829 TGTCATTTGCATTATTTGGATGG - Intergenic
1099911646 12:88841016-88841038 TGACATGTGCACAAGGTGGTAGG + Intergenic
1100085949 12:90911119-90911141 TGTCTTTTGAGCAACATGGATGG + Intronic
1100130199 12:91483183-91483205 TGTGATTTGCAAAAGATGAGAGG - Intergenic
1100268521 12:93001355-93001377 TGTCATTTGCAAAACAGAGATGG - Intergenic
1100343187 12:93701206-93701228 AGTGATTTTAACAAGATGGAAGG + Intronic
1100675722 12:96864619-96864641 GGTCATTTGAACTGGATGGAGGG - Intronic
1102577289 12:113863744-113863766 TGTGATCTGAACAAGATGAAGGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1105949299 13:25215092-25215114 TGTCATTGTTACCAGATGGAAGG - Intergenic
1105981373 13:25519505-25519527 TATCTATTGCACATGATGGATGG + Intronic
1106217274 13:27714339-27714361 TTTGATTTGGGCAAGATGGAGGG + Intergenic
1106393851 13:29361262-29361284 TGACATTTCAGCAAGATGGATGG + Intronic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1107965973 13:45598610-45598632 TGCCATTTGCCCATGATGAATGG - Intronic
1108255385 13:48604745-48604767 TGTCATCTGCACAACATGGTTGG - Intergenic
1108328983 13:49365991-49366013 TGTCATTGCAACAACATGGATGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109129105 13:58558166-58558188 TGTCATTTCAGCAATATGGATGG - Intergenic
1109700188 13:66014815-66014837 TGTACTTGGCACAAGATAGAAGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1110869676 13:80435669-80435691 TGACATGTGCCCAAGGTGGATGG - Intergenic
1110887791 13:80659523-80659545 TGTCTTTTGCGCAACTTGGATGG - Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111882071 13:93969874-93969896 TGTCATTTGCGCAACGTGGATGG - Intronic
1112126456 13:96473666-96473688 TGGCTTTTGCAGATGATGGATGG + Intronic
1112317501 13:98376425-98376447 TGTCATTTGCACAGCATGATTGG - Intronic
1112983896 13:105422544-105422566 TGTCATTTGCACACTTTTGATGG - Intergenic
1113528608 13:111002724-111002746 TGACATTTGCCCAAGGTGGTTGG + Intergenic
1113670216 13:112171011-112171033 TGGCAGGTGCACAAGAAGGAAGG + Intergenic
1114028232 14:18549664-18549686 TGGCATTTGAACAAAATGAAGGG - Intergenic
1114634782 14:24181399-24181421 TGTCAGTTGCACCTGATGCAAGG - Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115022662 14:28701712-28701734 TGACATTTGTTAAAGATGGAAGG + Intergenic
1115328114 14:32165172-32165194 TCTCCTCTACACAAGATGGATGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117042915 14:51783908-51783930 ACTCATTTGGAGAAGATGGACGG + Intergenic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1119995951 14:79253816-79253838 TGTAATTTCCACATGTTGGAGGG - Intronic
1120169271 14:81232691-81232713 TGGCCTATGCAAAAGATGGATGG + Intergenic
1120581318 14:86254259-86254281 TGTCTTTTGCTCAAGAGGGTGGG + Intergenic
1121441018 14:93949510-93949532 TGCCAGTTGCTCAGGATGGAAGG + Intronic
1122270124 14:100565249-100565271 TGTCATGTGGACAAGAAGGCAGG + Intronic
1122383341 14:101326267-101326289 TATCATTTGCACAAGTGGGGTGG + Intergenic
1123507251 15:20956024-20956046 TGTGATTTGCCTAAGAAGGATGG + Intergenic
1123564479 15:21529773-21529795 TGTGATTTGCCTAAGAAGGATGG + Intergenic
1123600731 15:21967056-21967078 TGTGATTTGCCTAAGAAGGATGG + Intergenic
1126828426 15:52574451-52574473 TGTCATTTGCAGCAACTGGATGG - Intergenic
1127936542 15:63645538-63645560 TGCCATTTACAATAGATGGATGG + Exonic
1132317211 15:100898828-100898850 TGCCATGTCCACAAGAGGGAAGG + Intronic
1202972839 15_KI270727v1_random:256876-256898 TGTGATTTGCCTAAGAAGGATGG + Intergenic
1135580607 16:23622968-23622990 TGACGTTTGCAGAAGATGGAGGG - Exonic
1135632291 16:24045838-24045860 TGTCTTTTCCACTAGATGGCAGG + Intronic
1138853504 16:60658759-60658781 TGTCTTCTTCACAACATGGATGG - Intergenic
1139970302 16:70770135-70770157 TGTCATTTGCACACCAGGGCTGG - Intronic
1140800267 16:78481002-78481024 TTTACTTTGCACAAGATGAAGGG - Intronic
1140807776 16:78548961-78548983 TGGCATTTCCAACAGATGGATGG + Intronic
1141171795 16:81696314-81696336 TGTCAGCTGCACAGGAGGGAGGG - Intronic
1144286097 17:13776198-13776220 AGTCATTTGTACAACAAGGAAGG + Intergenic
1149519342 17:57306569-57306591 TGTCATTTGTCCTAAATGGAGGG + Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154461018 18:14586252-14586274 TGTTATTTGCAAAGCATGGATGG + Intergenic
1155630801 18:27889835-27889857 TGTCCTTTGCACAACATTCAAGG + Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158123132 18:54072358-54072380 TGTCATTTGTAGAATATGAATGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161137505 19:2628628-2628650 TCTCAGTTTTACAAGATGGAAGG - Intronic
1167922480 19:52793249-52793271 TGACATGTGCCCAAGGTGGACGG - Intronic
927294892 2:21442707-21442729 TGTCATTGCAACAACATGGATGG + Intergenic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
928634146 2:33225884-33225906 TGTCATTTGTGTAACATGGATGG - Intronic
928863510 2:35889523-35889545 TGTCACTTGCAACAAATGGATGG - Intergenic
929979574 2:46666013-46666035 TATCATTTCCACACCATGGAAGG - Intergenic
930060940 2:47287859-47287881 TGTCAGTTTTACAAGATGAAGGG + Intergenic
931237696 2:60425417-60425439 TGACATGTGCCCAAGATGGTCGG - Intergenic
931599214 2:63986412-63986434 TGTCATTTGCAACAGATGGATGG - Intronic
931983075 2:67714760-67714782 TGTCTTTTGCACAGCATGAATGG - Intergenic
932238554 2:70140267-70140289 TCTCACTCGCCCAAGATGGAGGG + Intergenic
932622172 2:73271190-73271212 TGGCATTTCCACAGGATGTATGG + Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
936095189 2:109525876-109525898 TGTCATTGGAAGCAGATGGAGGG + Intergenic
937458505 2:122065407-122065429 TCCCATTTGCACAAGTTGAAAGG + Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
938659810 2:133474237-133474259 TGTCATTTCTACAACATAGATGG + Intronic
939046581 2:137257293-137257315 TGTGAATTACACAGGATGGATGG - Intronic
939409347 2:141804116-141804138 TGTCATTTGAAAATTATGGAAGG - Intronic
939487198 2:142829391-142829413 TAATTTTTGCACAAGATGGAAGG + Intergenic
943484230 2:188458997-188459019 AGTCATTTGCAACAAATGGATGG - Intronic
943572471 2:189589992-189590014 TGTCATTTGAGCAATATGGATGG - Intergenic
943606822 2:189986131-189986153 GGCCATTTGCCCAAGAAGGAGGG - Intronic
943866713 2:192933656-192933678 TGTGGTTTGCCCAACATGGATGG - Intergenic
945353357 2:208808431-208808453 TGTAATTTCCATTAGATGGAGGG + Intronic
945804096 2:214469173-214469195 TGTTATTGGCACAATATGTATGG - Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
945973006 2:216248495-216248517 TGTCATTGCAACAACATGGATGG - Intergenic
946918680 2:224554272-224554294 TCTCGTTTTCAGAAGATGGATGG + Intronic
947223424 2:227817154-227817176 TTTCACTTGCACATCATGGAGGG + Exonic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
1168792780 20:591208-591230 TGTCGTTTGAACAGAATGGAGGG + Intergenic
1170269812 20:14512900-14512922 TGTTATTTGCACATGATGTCAGG - Intronic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1172000362 20:31770974-31770996 TCTCACTGGCACAAGATGGCTGG + Intronic
1176813484 21:13571588-13571610 TGTTATTTGCAAAGCATGGATGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177912431 21:27049449-27049471 TTTCATAGGCACAAGATGGGTGG - Intergenic
1178945551 21:36944210-36944232 TGAGATATGCACAACATGGATGG + Intronic
1179465943 21:41572873-41572895 TTTCATTTGTACAAGATGATAGG - Intergenic
1180452354 22:15476717-15476739 TGGCATTTGAACAAAATGAAGGG - Intergenic
1181999514 22:26908860-26908882 TGTGAGTTGTACAAGATGGGAGG - Intergenic
1182453889 22:30437475-30437497 TGCCATGTGCCCAAGATGGTTGG + Intergenic
1184574043 22:45347845-45347867 GGTCATTTCTAGAAGATGGATGG + Intronic
1184586040 22:45448776-45448798 AGCCATGTGCACAAGATGAATGG + Intergenic
1184898517 22:47427191-47427213 TGACAGATGCAAAAGATGGATGG + Intergenic
1185223857 22:49642237-49642259 TGTCACCTGCACAAGAGGCAGGG + Intronic
949638666 3:6011620-6011642 TGTCCTGTGCACAAGACAGATGG + Intergenic
951270839 3:20621932-20621954 TGTCATTTCAACAGCATGGATGG - Intergenic
951754061 3:26069800-26069822 TCTCATTTCAACAACATGGATGG - Intergenic
952482310 3:33774349-33774371 TGTCATTTGTACACCATGGTTGG + Intergenic
952798359 3:37263477-37263499 TGTCATGTGAACATCATGGAGGG - Intronic
954122713 3:48509223-48509245 TCTCATTTGCATCAGAAGGATGG - Intergenic
954883833 3:53854816-53854838 TGTCCTTTTCAAATGATGGATGG + Intronic
955287866 3:57661132-57661154 TGTCACTTGCTACAGATGGAAGG - Intronic
955657357 3:61258916-61258938 TGTCTTTTGTATAAGATGTAAGG + Intergenic
955896883 3:63709848-63709870 TGTGATTTGCCCAGGATGAATGG + Intergenic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957482732 3:80819356-80819378 TGTCCTTTGTGCAACATGGATGG + Intergenic
958023462 3:88023885-88023907 TGTCATTTGCAGCAACTGGATGG + Intergenic
958765853 3:98367400-98367422 TGACATGTGCCCAAGATGGTCGG - Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960034020 3:113085095-113085117 TGTGATTTGCACAAGATCCAAGG - Intergenic
960070597 3:113425705-113425727 TGTCCTTTGCACAAGTGGAAAGG - Intronic
960133000 3:114077218-114077240 TGTAATTGGCACAAGAATGAGGG - Intronic
960709727 3:120515800-120515822 ATTCATTTGAACATGATGGAGGG - Intergenic
960962342 3:123080951-123080973 TGGAATTTGGACAAGATGGCTGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964105716 3:153037243-153037265 TTTGATTTGAACAGGATGGAGGG - Intergenic
964301236 3:155287778-155287800 TGACATTTGCTTAAGATGAATGG - Intergenic
965989265 3:174796526-174796548 TGTCTTTAGCACAACATGGATGG - Intronic
966607426 3:181835305-181835327 TTTCATTGGCACAAAAGGGAAGG + Intergenic
966925065 3:184639395-184639417 TGTCAATTACACATGACGGAGGG + Intronic
966966798 3:185002753-185002775 TGGCATTTGCACAATCTGGATGG - Intronic
971521034 4:27550663-27550685 CATCATTTGCACAACATAGAAGG + Intergenic
971668695 4:29528048-29528070 TGACATTTGTACATGATGAAAGG - Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972297616 4:37755180-37755202 TGTTATTTGTAAAAAATGGAAGG + Intergenic
972950974 4:44321904-44321926 TGTCACTTCAACAACATGGATGG - Intronic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973791160 4:54379460-54379482 TGTATTTTGCACAAAATTGAGGG + Intergenic
974337151 4:60563968-60563990 AGTCATTTGTACAACATGGATGG - Intergenic
974609958 4:64204710-64204732 TGGCATTTGCCCAGGATGGTCGG - Intergenic
975493364 4:75012411-75012433 TGGCTTTTCCACAGGATGGAGGG + Exonic
975856696 4:78632447-78632469 TGGCACTTCCACAAGATGGATGG - Intergenic
976009073 4:80465566-80465588 TAGAATGTGCACAAGATGGAAGG - Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
979212511 4:118122307-118122329 TTTCATTTACTTAAGATGGAGGG + Intronic
979504993 4:121485457-121485479 TGTTATCTGCACAAGAGGGTGGG + Intergenic
979553787 4:122021589-122021611 TGTCCTTTGCACAACATCGTTGG + Intergenic
980072058 4:128253828-128253850 TGACATGTGCCCAAGATGGTAGG + Intergenic
981054242 4:140343624-140343646 TGAAAATTGAACAAGATGGACGG + Intronic
981453302 4:144924417-144924439 TGTCATTTGCAATAACTGGATGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
983099708 4:163610022-163610044 TGCCATTAGCACAACAGGGATGG - Intronic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
984071359 4:175117356-175117378 TGTCATTTGCCCATTTTGGAAGG - Intergenic
984896489 4:184546116-184546138 TGTTACTTGGCCAAGATGGATGG - Intergenic
984978922 4:185258386-185258408 TGTCAGTAGCACATGCTGGAGGG - Intronic
986220228 5:5762367-5762389 TGACATGTGCCCAAGATGGTTGG - Intergenic
987015207 5:13810918-13810940 TGTCATTTGAACAACATGAATGG + Intronic
987201862 5:15585207-15585229 TGTAATTTGCATTAGATGAAAGG + Intronic
987433836 5:17868705-17868727 AGTCATTTCAACAACATGGATGG - Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988845554 5:35124147-35124169 TGTAATTTCCACCAGTTGGAAGG - Intronic
989101303 5:37825797-37825819 AGTGATTTGAACAAGAAGGAGGG + Intronic
990560602 5:56979920-56979942 TGTCCTTGTGACAAGATGGAGGG - Intergenic
990723346 5:58724089-58724111 TGACATTTGCAAAAGAGAGATGG - Intronic
992210899 5:74478575-74478597 TGTTATTTGCAAATGATGTATGG - Intergenic
992323604 5:75638314-75638336 TTTCATTTGCACAAAATTAAGGG + Intronic
992331968 5:75726382-75726404 TATCATTTGAACAAAATGGATGG - Intergenic
993057926 5:83003736-83003758 TGTCACATGCACAACATGGAAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993744480 5:91579953-91579975 TATCATTTGCCCAATCTGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995458893 5:112381816-112381838 TGTCATTTTCACATTATGGAAGG - Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996531018 5:124527012-124527034 TCGCATTTGCACAAGAAGTAAGG - Intergenic
997328529 5:133042340-133042362 AGTCACATGCACAAGAAGGAAGG - Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
997845084 5:137278805-137278827 TGTCATGTGGACAAGACGGATGG + Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998634406 5:143937020-143937042 TGTCATTTGCACAGCATGGATGG + Intergenic
998790783 5:145764360-145764382 TGCCATGGGCACAGGATGGAAGG - Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1001015863 5:168140433-168140455 TGCCATTTGGAGCAGATGGAAGG - Intronic
1001178895 5:169499782-169499804 TGTCCTTTGTGCAACATGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004523682 6:16385543-16385565 TGCCATTTGCACAAGAGATATGG + Intronic
1004572137 6:16857025-16857047 TATCATTTGCACAGACTGGATGG + Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1006013658 6:31063345-31063367 TCTCTGTTGCCCAAGATGGAGGG - Intergenic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007552117 6:42738118-42738140 TGTCATTTGCAACAAATGGATGG + Intergenic
1007962916 6:45977432-45977454 TTTAATTTACAAAAGATGGAGGG - Intronic
1010242864 6:73632840-73632862 TGTCATTTTCTCAACATTGATGG - Intronic
1011233954 6:85194448-85194470 TTTCATTTCCACAAGAAAGATGG - Intergenic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014879900 6:126710864-126710886 TTTCATTTGCACCAAATGAAGGG - Intergenic
1015208514 6:130669471-130669493 TGTCATTGGAACAACATGAATGG + Intergenic
1016633835 6:146264838-146264860 TGTCTTTTGTGCAACATGGATGG - Intronic
1017020301 6:150134510-150134532 TGTCATTTTCTCAAGCTGGAGGG + Intergenic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1022885826 7:34642717-34642739 TCTCATTTCCACAAAAAGGAAGG + Intergenic
1024504946 7:50154540-50154562 TGCCATTTGCACAACACAGATGG - Intronic
1025114705 7:56247767-56247789 TATCATTTGTAAAACATGGAGGG - Intergenic
1025164418 7:56699350-56699372 TGTCATTTCAACAAGATGGATGG + Intergenic
1025705856 7:63862722-63862744 TGCCATTTCAACAAGATGGTTGG - Intergenic
1026607609 7:71829099-71829121 TGACATGTGCACAAGGTGGTTGG - Intronic
1028905116 7:96144933-96144955 TGTCATTTTGACAAGATGCCAGG - Intronic
1030191399 7:106813861-106813883 GGTCTTTTGCACCAGAAGGATGG - Intergenic
1030568336 7:111188728-111188750 TGGCACTTGCACACAATGGAAGG + Intronic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1032215079 7:129951788-129951810 TGTCATACCCACAATATGGAGGG + Intronic
1032661639 7:133990419-133990441 TGTCATTCGAGCAACATGGATGG - Intronic
1032712869 7:134476819-134476841 TGTCATTTCAACAATATTGAGGG + Intergenic
1032962267 7:137050053-137050075 TGTCATTTGCACCATTTGGAAGG - Intergenic
1033147897 7:138886795-138886817 TGTCATTTGCAAAAGGCTGAGGG - Intronic
1033649413 7:143329500-143329522 GGTCATTTGCACCAGGGGGAGGG - Intronic
1033685339 7:143635216-143635238 TGTCATTTTCACCATATTGAAGG - Intronic
1033688509 7:143714434-143714456 TGTCATTTTCACCATATTGAAGG - Intronic
1033699276 7:143822404-143822426 TGTCATTTTCACCATATTGAAGG + Intergenic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1034364309 7:150533487-150533509 TGCAATTAGCCCAAGATGGAGGG + Intergenic
1036106949 8:5851471-5851493 TGTCTTTTGCACAATTTGGATGG + Intergenic
1036662129 8:10715459-10715481 TGGGAGGTGCACAAGATGGAGGG - Intergenic
1040874512 8:52137072-52137094 TGTTATTTGCCCAGGATTGAGGG + Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1043793971 8:84511846-84511868 TTGCATTTGCACAGCATGGATGG - Intronic
1044238941 8:89866202-89866224 CCTAATTTGCACAAGATGAAAGG - Intergenic
1045650675 8:104339059-104339081 TTTCATTTGAACAGGAAGGATGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1050078567 9:1890702-1890724 TGTTAATTGCACAGGATGTAGGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051516048 9:17931444-17931466 TGTCATTTGGAAAAGTTGGGAGG + Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1054911541 9:70459696-70459718 TGACATGTGCCCAAGGTGGATGG - Intergenic
1055931977 9:81568275-81568297 TGTCATGTGCACAAAATTTAAGG + Intergenic
1056106519 9:83352600-83352622 TGTCATCTTCAGATGATGGAAGG - Intronic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056567871 9:87790773-87790795 TGTCATTTGCGTGAAATGGATGG + Intergenic
1057980406 9:99655852-99655874 TGTCATTTGTGCAACATGGATGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1058938326 9:109790063-109790085 TTTCTTTTGCATAAGATCGAAGG + Intronic
1060482931 9:124028404-124028426 TGTCAGTTTCAGAAGATGGGTGG + Intronic
1185732181 X:2470084-2470106 TGCCATTTGCGCAACATGGATGG + Intronic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186927158 X:14346785-14346807 TGTCATTTGTAAAACATGGATGG - Intergenic
1187144291 X:16623563-16623585 TGTCATTTGCACAGCACAGATGG - Intronic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188229119 X:27639127-27639149 AGTCATTTCAACAACATGGATGG + Intronic
1188287260 X:28342963-28342985 TGTCATTACAACAACATGGATGG - Intergenic
1188288604 X:28360799-28360821 TCTCATATGCATAACATGGAAGG + Intergenic
1188419141 X:29975183-29975205 TGTCATTTGAACAACATGGATGG - Intergenic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190927095 X:54920348-54920370 TCTGAATTGCATAAGATGGACGG + Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1192063383 X:67854559-67854581 TGACATGTGCCCAAGATGGTTGG - Intergenic
1193112710 X:77745426-77745448 TGTCATTGCAACAACATGGATGG + Intronic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1195082924 X:101387716-101387738 TCACATTTGCACAAGACAGATGG + Intronic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196602011 X:117612456-117612478 TTTCATTTGCACAACACAGATGG + Intergenic
1197044334 X:121977590-121977612 TGGCCTGTGCAGAAGATGGATGG + Intergenic
1197484903 X:127036753-127036775 TGGCCTTTGAACAAAATGGATGG + Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199547347 X:149019862-149019884 TGGCACTTCCACAAGATGGAAGG + Intergenic
1200792323 Y:7310670-7310692 TGCCATTTGAACAACATGGTAGG + Intergenic
1201369286 Y:13243777-13243799 TGTCATTTGGAGAAAATGAATGG + Intergenic