ID: 1119815626

View in Genome Browser
Species Human (GRCh38)
Location 14:77564210-77564232
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1409
Summary {0: 2, 1: 48, 2: 168, 3: 379, 4: 812}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119815619_1119815626 8 Left 1119815619 14:77564179-77564201 CCGAAATTGTGCTGCTGCACTCC 0: 5
1: 110
2: 1554
3: 20361
4: 66468
Right 1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG 0: 2
1: 48
2: 168
3: 379
4: 812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900653686 1:3744438-3744460 CGACAGAGTGAGACTCCGTCAGG + Intergenic
900834730 1:4992069-4992091 CACCAGCGAGAGACTCTGGCCGG - Intergenic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901650635 1:10740936-10740958 CGACAGGGTGAGACCCTGTCTGG + Intronic
901693936 1:10992479-10992501 CAACAGAGTGAGACTTCGTGGGG + Intergenic
902507527 1:16947856-16947878 CAACAGAGCAAGACTCTGTCTGG - Intronic
902675682 1:18006931-18006953 CAGCAGGGGGAAACTCAGTCAGG - Intergenic
902910226 1:19590587-19590609 CAACAGAGTGATACTCTGTCTGG + Intergenic
903202545 1:21754139-21754161 CAACAGAGTGAGACTCCATCTGG + Intronic
903207770 1:21795710-21795732 TGACAGATCGAGACTCTGTCTGG + Intergenic
903303839 1:22398475-22398497 TGACAGAGTGAGACCCTGTCTGG + Intergenic
903520395 1:23943070-23943092 TGACAGAGTGAGACTCTGTCTGG + Intergenic
903832749 1:26184393-26184415 CAAGGGAGGCAGAGTCTGTCAGG - Exonic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903979031 1:27171827-27171849 CGACAGAGCAAGACTCTGTCTGG + Intergenic
904065122 1:27743743-27743765 CAACAGAGCAAGACCCTGTTTGG + Intronic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904410854 1:30324008-30324030 CATCAGAGGCAGCCTATGTCTGG - Intergenic
904591265 1:31616827-31616849 CAGGGGAGGGAGACTGTGTCTGG + Intergenic
904641441 1:31933701-31933723 CAACAGAGTAAGACTCTGTCTGG + Intronic
904869698 1:33608754-33608776 CCCATGAGGGAGACTCTGTCCGG - Intronic
905082333 1:35335254-35335276 TGACACAGCGAGACTCTGTCTGG - Intronic
905211313 1:36376162-36376184 CAACAGAGGGGCACTCTGAAGGG - Intronic
905218275 1:36425711-36425733 CAACAGAGCAAGACTCTATCTGG + Intronic
905632469 1:39526356-39526378 TGACAGAGTGAGACTCTATCTGG - Intergenic
905844153 1:41212854-41212876 CAACAAAGTGAGACTCTGTCTGG + Intronic
906031555 1:42724285-42724307 CGACAGAGTGAGACTGTCTCAGG + Intergenic
906246460 1:44278455-44278477 CAACAGAGCAAGACTGTCTCAGG + Intronic
906439753 1:45831008-45831030 CGACAGAGTGAGACCTTGTCTGG + Intronic
907049409 1:51319708-51319730 TGACAGAGTGAGACTCTGTCTGG - Intronic
907103935 1:51862988-51863010 TGACAGAGTGAGACTCTGTGTGG + Intronic
907526094 1:55054983-55055005 CAATAGAGCGAGACTCCGTCTGG + Intronic
907536242 1:55161350-55161372 CAACAGAGCGAGACTCTGTCTGG + Intronic
907869624 1:58431536-58431558 CAATAGAGCGAGACTCCATCTGG + Intronic
907996125 1:59634384-59634406 TGACAGAGCAAGACTCTGTCTGG + Intronic
908295274 1:62706844-62706866 TGACAGAGTAAGACTCTGTCAGG - Intergenic
908603794 1:65771169-65771191 CAGCAGAGGGAGGCTTAGTCTGG - Intergenic
908777135 1:67650921-67650943 CGACAGAGTAAGACTCTGTCTGG + Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909101722 1:71357383-71357405 CACCAGAGGGAGACCCAGTTAGG - Intergenic
909882007 1:80891428-80891450 CAACAGAGCAAGACTATCTCAGG + Intergenic
910770161 1:90822885-90822907 CGACAGAGGGAGGCTCTGACTGG + Intergenic
911080437 1:93923808-93923830 TGACAGAGTGAGACCCTGTCTGG + Intergenic
912372323 1:109183636-109183658 CAATGGAGAGAGACTCTGTTAGG - Intronic
912422762 1:109556953-109556975 CAACAGAGTGAGACTGTCTCGGG - Intronic
912651723 1:111445786-111445808 CAACAGAGTGAAACTGTCTCAGG - Intronic
912845970 1:113074886-113074908 AAACAGAGCGAGACTCCGTCTGG + Intronic
912987905 1:114453342-114453364 CAACAGAGAGAGTCTGTCTCAGG + Intronic
913997371 1:143662200-143662222 CAACAGAGCGAGACTCCGTCTGG - Intergenic
914413499 1:147455385-147455407 CAACAGAGCAAAACCCTGTCTGG + Intergenic
914673602 1:149890614-149890636 TGACAGAGTGAGACTCTGTCTGG - Intronic
914708182 1:150188665-150188687 AGACAGAGTGAGACTCCGTCTGG - Intergenic
914817568 1:151074328-151074350 CGACAGAGCGAGACTCCGTCTGG - Intronic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
915139633 1:153759252-153759274 CAACAGAGCAAGACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
915295276 1:154916867-154916889 CAACATAGTGAGACCTTGTCTGG - Intergenic
915338477 1:155162507-155162529 CTACAGAGGAAGACTCTGTCTGG - Intergenic
915426290 1:155829968-155829990 CCACAGAGCGAGACTCTGTCTGG - Intronic
915492171 1:156256944-156256966 CGACAGAGCGAGACTCTGTCTGG - Intronic
915841042 1:159213210-159213232 CGACAGAGTGAGACCTTGTCTGG + Intergenic
916077112 1:161207830-161207852 CGACAGAGCGAGACTCCGTAGGG - Intronic
916141440 1:161702690-161702712 TGACAGAGTGAGACTCTGTCTGG + Intergenic
916228434 1:162514267-162514289 CAACAGAGTGAGACCATCTCTGG + Intronic
916321935 1:163513639-163513661 AGAGAGAGGGAGACTCTGTTTGG + Intergenic
916479379 1:165201452-165201474 GAACTTTGGGAGACTCTGTCAGG + Intergenic
916694933 1:167224846-167224868 AGACAGAGCAAGACTCTGTCTGG - Intronic
916710811 1:167405665-167405687 GAACAGAGCGAGACCCTGTTTGG + Intronic
916929776 1:169564401-169564423 CAACCCATAGAGACTCTGTCTGG + Intronic
917104965 1:171483201-171483223 CAACAGAGTGAGACTCCATGGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917763962 1:178197587-178197609 CAACAGAGCTAGACTCCATCTGG + Intronic
917804830 1:178604277-178604299 TGACAGAGTGAGACTCCGTCTGG - Intergenic
917910293 1:179637693-179637715 CAACAGAGTAAGGCCCTGTCTGG + Intronic
917938044 1:179888433-179888455 CAACATACTGAGACCCTGTCTGG - Intronic
918025379 1:180739758-180739780 AAACATAGTGAGACCCTGTCTGG - Intronic
918430115 1:184450895-184450917 CGATAGAGGAAGATTCTGTCAGG - Intronic
918670025 1:187203335-187203357 CAACAGAGCAAGACTGTGTCTGG - Intergenic
918765108 1:188471976-188471998 AAACAGAGAGAGACTAAGTCTGG - Intergenic
918788414 1:188794252-188794274 GTACAGAGCGAGACTCTGTCTGG + Intergenic
918833191 1:189425202-189425224 CTACAGAGAGAGAGCCTGTCTGG - Intergenic
918943431 1:191029517-191029539 TGACAGAGGGAGACTCTGTCAGG + Intergenic
919204909 1:194409003-194409025 CAACAGAGCGAGGGTCTATCTGG + Intergenic
919288527 1:195598426-195598448 CAACAGAGCAAGACTCTGTCAGG - Intergenic
919508492 1:198430399-198430421 CGACAGAGCAAGACTCTGTCCGG - Intergenic
919700510 1:200626694-200626716 CAACAGAGCAAGACTGTCTCGGG + Intronic
919736658 1:200956761-200956783 CGACAGAGTGAGACTCCATCTGG + Intergenic
919975984 1:202613098-202613120 CGACAGAGCGAGACTCTGTCTGG - Intronic
920446226 1:206020825-206020847 CAGCACAGGGGGACTCTGGCAGG - Intronic
920599681 1:207311539-207311561 TGACAGAGTGAGACTCTGGCTGG - Intergenic
920962789 1:210679236-210679258 CAACAGAGGGAGGCTGTCTGGGG + Exonic
921782323 1:219180014-219180036 CAACAGAGTGAGACTCTGTCTGG - Intronic
922202415 1:223417102-223417124 CGAGAGAGCAAGACTCTGTCAGG + Intergenic
922571137 1:226635238-226635260 CGACAGAGTAAGACCCTGTCTGG - Intronic
922643291 1:227258153-227258175 CAACAGGGTGAAACCCTGTCCGG + Intronic
922657073 1:227394611-227394633 TGACAGAGCGAGACTCTGTCTGG + Intergenic
922731663 1:227951743-227951765 CAACAGAGTGAGACTCTGTCTGG + Intergenic
922831312 1:228555945-228555967 TCACAGAGCGAGACTCTGTCTGG - Intergenic
922831874 1:228558227-228558249 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922832354 1:228610209-228610231 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922832914 1:228612450-228612472 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922833475 1:228614691-228614713 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922834035 1:228616932-228616954 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922834592 1:228619173-228619195 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922835144 1:228621388-228621410 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922835703 1:228623608-228623630 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922836261 1:228625850-228625872 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922836819 1:228628089-228628111 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922837378 1:228630331-228630353 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922837939 1:228632572-228632594 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922838497 1:228634812-228634834 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922839055 1:228637037-228637059 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922839615 1:228639278-228639300 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922840175 1:228641509-228641531 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922840735 1:228643750-228643772 CGACAGGGCGAGACTCCGTCTGG + Intergenic
922841299 1:228645981-228646003 CGACAGGGCGAGACTCCGTCTGG + Intergenic
923097867 1:230789741-230789763 GTACAGAGGAAGACTCAGTCTGG + Intronic
923157828 1:231293969-231293991 CAACAGAGTGAGACTCTGTCTGG + Intergenic
923415917 1:233759590-233759612 CAACAGAGCAAGACTCCATCTGG + Intergenic
923683663 1:236139780-236139802 CCACAGAGTGAGACTCCATCAGG - Intergenic
924090949 1:240500316-240500338 CAACAGAGCAAGACTCTGTCTGG - Intronic
924184343 1:241471998-241472020 TGACAGAGGGAGACTCCGTCTGG - Intergenic
924213202 1:241791650-241791672 CGAAAGAGTGAGACCCTGTCTGG + Intronic
924237887 1:242014431-242014453 CAACAGAGCAAGACCCTGTCTGG - Intergenic
924704337 1:246487438-246487460 CAACAGAGCAAGACTCTGTCTGG + Intronic
924918430 1:248599168-248599190 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063108799 10:3017383-3017405 CAGCAGAGTGAGACTCTGTTTGG + Intergenic
1063118675 10:3088949-3088971 CAACAGAGCAAAACTCTGTATGG - Intronic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063158434 10:3401019-3401041 CAACAAAGTGAGACTCTGTCTGG + Intergenic
1063237015 10:4127459-4127481 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1063344680 10:5300137-5300159 CAATAGAGGGAGAGTCTATTTGG - Intergenic
1064040294 10:11956838-11956860 TGACAGAGTGAGACTGTGTCTGG - Intronic
1064060907 10:12136467-12136489 CAACAGAGCGAGACTTTAGCTGG - Intronic
1064112958 10:12554175-12554197 CAACAGAGCGAGATTCTGTCAGG - Intronic
1064180642 10:13111674-13111696 CGACAGAGTGAGACTCTGTCTGG + Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1064997167 10:21306436-21306458 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1065542678 10:26785703-26785725 CGACAGAGTCAGACTCTGTCTGG + Intronic
1065574106 10:27101135-27101157 CGACAAAGCGAGACTCTGTTGGG - Intergenic
1065620126 10:27572333-27572355 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1065691328 10:28336741-28336763 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1065715232 10:28560339-28560361 CAACAAAGCGAGATCCTGTCGGG + Intronic
1065777071 10:29130932-29130954 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1065914742 10:30344722-30344744 CAATAGAGTGAGACTCTGTCTGG - Intronic
1065925283 10:30429626-30429648 CGACAGAGTGAGACTGTGTCTGG + Intergenic
1066360254 10:34723272-34723294 CAACAGAGCGAGGCTCTGTCTGG + Intronic
1066394337 10:35004488-35004510 TGACAGAGTGAGACTCTGGCAGG + Intergenic
1066423649 10:35285033-35285055 CAACAGAGCAAGACTCTGTCTGG - Intronic
1067260946 10:44690940-44690962 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1068308504 10:55247870-55247892 TGACAGAGTGAGACGCTGTCTGG + Intronic
1069010121 10:63363276-63363298 CGACAGAGCGAGACTCCATCAGG - Intronic
1069017417 10:63445892-63445914 AACCAGAGTGAGACTCTGTCTGG - Intronic
1069058619 10:63870655-63870677 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1069099397 10:64299589-64299611 CAACAGCGTGAGACCCTGTCTGG + Intergenic
1069323186 10:67199387-67199409 CAACAGAGCGAAACTCCATCTGG - Intronic
1070033358 10:72698522-72698544 CGACAGAGTAAGACTCTGTGAGG - Intronic
1070212886 10:74345320-74345342 CAACAAAGCAAGACCCTGTCTGG - Intronic
1070306576 10:75243165-75243187 CAACAGAGGGAGACTCCATCTGG - Intergenic
1071114312 10:82199150-82199172 TGACAGAGTGAGACTCTGTCCGG + Intronic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071548232 10:86545015-86545037 CAACACAGTGAGACCCTGTCTGG - Intergenic
1071699132 10:87910441-87910463 CGACACAGCGAGACTCTATCTGG - Intronic
1071831915 10:89380453-89380475 TGACAGAGGGAGGCCCTGTCTGG - Intronic
1071882963 10:89919175-89919197 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1072095214 10:92171632-92171654 CAACAGAGTGAGACTCTCTCTGG - Intronic
1072350573 10:94553266-94553288 TGACAGAGTGAGACTCCGTCCGG - Intronic
1072606715 10:96990185-96990207 CGACAGAGTGAGACCCTGTCTGG - Intergenic
1072959870 10:99919765-99919787 CGACAGAGGAAGACTCCATCTGG + Intronic
1073141375 10:101250551-101250573 CAACAGAGTGAGACTGTCTCAGG - Intergenic
1073337670 10:102722552-102722574 CGACAGAGTGAGACCCTGTCTGG - Intronic
1073371668 10:102995230-102995252 TGACAGAGCTAGACTCTGTCTGG - Intronic
1073603364 10:104868392-104868414 CAATAGTGTGAGATTCTGTCAGG - Intronic
1074215340 10:111378749-111378771 CAACAGAGTGAGACTCCATCTGG - Intergenic
1074347051 10:112697211-112697233 TAACAGAGCAAGACCCTGTCTGG - Intronic
1074956823 10:118399138-118399160 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1075169573 10:120101150-120101172 CAACATAGTGAGACCCTGTGTGG - Intergenic
1075320340 10:121486460-121486482 CAACAGAGCGAGACTCTGTCTGG - Intronic
1075377202 10:121988270-121988292 TGACAGAGTGAGACTCTATCTGG - Intergenic
1075387964 10:122070902-122070924 TAGCAGAGGAAGACCCTGTCTGG + Intronic
1076403669 10:130198547-130198569 CGACAGAGCAAGACTCTGTCTGG + Intergenic
1077616773 11:3681057-3681079 CAACACCGTGAGACCCTGTCTGG - Intronic
1077629308 11:3799946-3799968 CAACAGACGGAGCCTCCGACTGG + Intronic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078162595 11:8854730-8854752 TGGCAGAGTGAGACTCTGTCTGG - Intronic
1078245137 11:9567494-9567516 CAACAGAGCAACACCCTGTCTGG - Intergenic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078676158 11:13416332-13416354 CAACACAGTGAGACCCTGTCTGG + Intronic
1078791422 11:14546455-14546477 CAACAGAGCGAGACTCTGTCTGG - Intronic
1079134108 11:17766529-17766551 CAGCAGAGGGACCCTCTGCCTGG - Intronic
1079255770 11:18828398-18828420 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1079431749 11:20396616-20396638 CAACAGAGCAAGACTTTGTCGGG + Intronic
1079583972 11:22102553-22102575 CGACAGAGTGAGACTCCATCTGG - Intergenic
1080096476 11:28414361-28414383 TAACAGAGGGAGGCACTGGCAGG - Intergenic
1082047322 11:47740611-47740633 CGACAGAGTGAGACTGTCTCGGG - Intronic
1082859222 11:57838059-57838081 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1083840171 11:65299709-65299731 CGACAGAGTGAGACTCTGTCGGG - Intronic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1084350841 11:68597957-68597979 CGACAGAGTGAGACTCCATCTGG + Intronic
1084867195 11:72068599-72068621 TGACAGAGAGAGACCCTGTCTGG + Intronic
1085030547 11:73268602-73268624 TGACAGAGTGAGACCCTGTCTGG + Intronic
1085087647 11:73681787-73681809 CGACAGAGCAAGACTCTGTCTGG + Intronic
1085093677 11:73741154-73741176 CGACAGAGCAAGACTCTGTTGGG - Intronic
1085183464 11:74555961-74555983 TGACAGAGCAAGACTCTGTCAGG + Intronic
1085650502 11:78263611-78263633 CGACAGAGTGAGACTCTGTCTGG + Intronic
1086057110 11:82659505-82659527 CAACAGAGTGAGACTCTGTCAGG + Intergenic
1087080974 11:94170851-94170873 CAACACAAGGAGAGTCTTTCTGG + Intronic
1087403432 11:97697604-97697626 TGACAGAGCGAGACTCTGTCAGG - Intergenic
1087638839 11:100733803-100733825 CAACAGAGCAAGATTCTGTCTGG + Intronic
1087752287 11:102020061-102020083 CAACAGAGCAAGGCTGTGTCAGG + Intergenic
1088116591 11:106319542-106319564 TGACAGAGCGAGACTCCGTCTGG + Intergenic
1088162375 11:106888039-106888061 CTTCAGAGAGAGACTTTGTCAGG - Intronic
1088250307 11:107856675-107856697 TGACAGAATGAGACTCTGTCAGG + Intronic
1088290118 11:108227032-108227054 CAACAGAGGAAGGCTCTGCGGGG - Intronic
1088297312 11:108314133-108314155 CAACAGAGCCAGATCCTGTCTGG - Intronic
1088546103 11:110960733-110960755 CAACAGAGAGAGACTCTGTCTGG - Intergenic
1088707049 11:112473163-112473185 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1088868747 11:113874119-113874141 CGACAAAGTGAGACTCCGTCTGG + Intronic
1089328713 11:117675315-117675337 CAACAGAGCGAGATCCTGGCTGG - Intronic
1089597630 11:119591279-119591301 CAGAAGAGGGAGCCTCTGCCAGG + Intergenic
1089727562 11:120495992-120496014 CAACAGAGTGAGACTCAGTCAGG - Intergenic
1089811525 11:121135976-121135998 TGACAGAGCGAGACTCCGTCTGG - Intronic
1090018209 11:123104402-123104424 CAACAGGGCGAGACTCCGTCTGG - Intronic
1090122772 11:124050247-124050269 CGACAGAGCGAGATTCTGTCTGG - Intergenic
1090134537 11:124183575-124183597 CAACAGAGTGAGACTCAGGGAGG - Intergenic
1090456060 11:126850653-126850675 CAACAGAGGAAGACTTTACCAGG + Intronic
1090766233 11:129878628-129878650 CAACACAGAGAGATTCTATCAGG + Intronic
1090811152 11:130244645-130244667 CGACAGAGAGAGACTCTGTCTGG + Intronic
1091232224 11:133996076-133996098 TAACAGACTGAGACCCTGTCTGG + Intergenic
1091852606 12:3712472-3712494 CAACAGAGAGAGACACAGTTGGG + Intronic
1092124946 12:6068487-6068509 CAACAGAGCGAGACTGTCTCAGG - Intronic
1092172364 12:6381950-6381972 CGACAAAGCGAGACTCTGTATGG + Intronic
1092213653 12:6665274-6665296 CCACAGAGCGAGATTCTGTCTGG - Intergenic
1092466715 12:8739925-8739947 TGACAGAGCGAGACCCTGTCTGG - Intronic
1092522323 12:9287633-9287655 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1092544960 12:9444229-9444251 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1092675937 12:10919922-10919944 CTACAGAGCAAGACTCTGTCAGG - Intronic
1092793094 12:12086296-12086318 TGACAGAGTGAGACTCTGTCTGG + Intronic
1092851780 12:12635347-12635369 TGACAGAGTGAGACCCTGTCTGG + Intronic
1092932498 12:13329581-13329603 CAAGAGAGGGGGAATCTCTCTGG + Intergenic
1093225876 12:16482609-16482631 TTACAGAGCAAGACTCTGTCTGG + Intronic
1093470949 12:19501615-19501637 CTACAAAGTGAGACCCTGTCTGG + Intronic
1093849533 12:24018776-24018798 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1094427895 12:30334740-30334762 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1094529101 12:31256258-31256280 CAATAGGATGAGACTCTGTCAGG - Intergenic
1094534713 12:31310888-31310910 CGACAGAGTGAGACTCTCTCAGG - Intronic
1094564065 12:31583656-31583678 CAACAGAGCAAGACTGTGTCTGG + Intronic
1095224232 12:39660312-39660334 CAACAAAGGGAGCCTCAGTTGGG + Intronic
1095388906 12:41682019-41682041 GAATGAAGGGAGACTCTGTCAGG - Intergenic
1095443368 12:42260122-42260144 TGACAGAGAGAGACTTTGTCTGG + Intronic
1095473472 12:42561929-42561951 CAACAGAGCAAAACTCTGTCTGG - Intronic
1095887325 12:47202987-47203009 CAACAGAGCCAGACTGTCTCAGG - Intronic
1095964110 12:47855306-47855328 CATCAGAGCGAGAATCTGTCTGG + Intronic
1096162230 12:49388391-49388413 TGACAGAGAGAGACCCTGTCAGG - Intronic
1096347119 12:50859233-50859255 CAACAGAGCAAGACTCTGTCTGG - Intronic
1096394024 12:51252111-51252133 TGACAGAGCGAGACTCTGTCTGG - Intronic
1096623376 12:52878389-52878411 CAACAGAACGAGACCCTGTCTGG + Intergenic
1096681473 12:53258269-53258291 CGACAGAGGGAGACTCCACCTGG + Intergenic
1096828030 12:54294390-54294412 CAGCAGAGGGAGCCGCTGTGTGG + Intronic
1096998408 12:55855042-55855064 CGACAGAGCGAGACTCCGTTAGG + Intergenic
1097677914 12:62622958-62622980 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1098543933 12:71690173-71690195 CAACAGAGCAAGACTGTCTCGGG - Intronic
1098762741 12:74445802-74445824 CGACAGAGCGAGACTCCATCTGG + Intergenic
1098849698 12:75580813-75580835 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1099355585 12:81630914-81630936 CAACAGAGCTAGACTCTGTCTGG - Intronic
1099433897 12:82620358-82620380 TAACAGAGGCAGACTCTGTTTGG + Intergenic
1100157822 12:91821520-91821542 GTCCAGAGTGAGACTCTGTCTGG - Intergenic
1100197989 12:92269297-92269319 CAACAGACTAAGACTCTATCTGG - Intergenic
1100222797 12:92524114-92524136 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1100457378 12:94765568-94765590 CAATAGAATGAGACTCCGTCTGG - Intergenic
1100535629 12:95506075-95506097 CGACAGAGTGAGACTTCGTCTGG + Intronic
1100625516 12:96327565-96327587 CAACAGAGCAAGACCCTGCCTGG - Intronic
1100983368 12:100181766-100181788 CAACAGGATGAGACTCTGTCTGG + Intergenic
1100985732 12:100200076-100200098 CGACAGAGCGAGACTCCGGCAGG - Exonic
1101018578 12:100528345-100528367 CAACAGAGTGAGGCTCCATCTGG + Intronic
1101179682 12:102201449-102201471 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1101502489 12:105317008-105317030 CAACATAGGAAGACCCTGTGAGG + Intronic
1101916978 12:108903456-108903478 CGACAGAGCAAGACTCTGTCGGG - Intergenic
1101925567 12:108968811-108968833 CAACAGAGCGAGACTCTGTCTGG - Intronic
1102069806 12:110008863-110008885 CGACAGAGCGAGACTCAGTCTGG + Intronic
1102070599 12:110015969-110015991 CAACAGAGCGAGATACTGTATGG - Intronic
1102094490 12:110225950-110225972 CGACAGAGCTAGACTCCGTCTGG + Intergenic
1102287252 12:111668185-111668207 CGACAGAGCAAGACTCCGTCTGG + Intronic
1102532007 12:113553522-113553544 CAAGTGATGGAGACTCTTTCTGG + Intergenic
1102662674 12:114543422-114543444 TGACAGAGCGAGATTCTGTCTGG + Intergenic
1102686014 12:114725273-114725295 CAACAAAGAGAGACCCTGTCTGG - Intergenic
1102776724 12:115526148-115526170 CAACAGAATGAGACTCCATCTGG - Intergenic
1103069333 12:117927671-117927693 CGACAGAGCAAGACTCAGTCTGG + Intronic
1103309469 12:119992971-119992993 CGACAGAGCGAGACTCCATCTGG - Intronic
1103401446 12:120645807-120645829 TGACGGAGGAAGACTCTGTCTGG + Intronic
1103406587 12:120680151-120680173 CAACAGAGTAAGACTCTGTATGG + Intergenic
1103599732 12:122046921-122046943 CGACAGAGCAAGACTCCGTCTGG - Intronic
1103640355 12:122346520-122346542 TGACAGAGTGAGACTCTGTCTGG - Intronic
1103662971 12:122536537-122536559 CCACAGAGCGAGACTGTCTCAGG - Intronic
1104453403 12:128889792-128889814 CAACGGAATGAGACTCTGTCAGG - Intronic
1104598075 12:130133446-130133468 CACCTGAGTGAGACTCTGCCAGG + Intergenic
1104829700 12:131741721-131741743 CAACAGAGGGGGAGGCTGTGAGG - Intronic
1104839405 12:131814703-131814725 CAACATATTGAGACCCTGTCTGG + Intergenic
1104869971 12:131988012-131988034 CAACAGAGCAAGACCCTGTCTGG - Intronic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1105496180 13:20932929-20932951 CAACAGAGCAAGACTCTGTTGGG - Intergenic
1105659997 13:22483731-22483753 CAATAGAGGGCAACTGTGTCTGG - Intergenic
1106175688 13:27329137-27329159 CGACAGAGCAAGACTCCGTCTGG + Intergenic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1106601990 13:31196219-31196241 CGACAGAGTGAGATTCTGTCTGG - Intergenic
1106648733 13:31666068-31666090 CAACAGAGTGAGAATCCGTCTGG - Intergenic
1106666465 13:31856325-31856347 TGACAGAGCGAGACTCCGTCAGG + Intergenic
1106718556 13:32416834-32416856 CGACAGAGCAAGACTCCGTCTGG - Intronic
1106898271 13:34328737-34328759 CACCAGAGGGAGATTCTATGAGG - Intergenic
1107184194 13:37497849-37497871 CAACAGAGTAAGACTATGTCCGG + Intergenic
1107524088 13:41213386-41213408 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1107917203 13:45164704-45164726 TGACAGAGTGAGACCCTGTCTGG + Intronic
1108953467 13:56119859-56119881 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1109222261 13:59652091-59652113 AAACAGAGGCACACTCTGTGGGG + Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1109534472 13:63698449-63698471 CAACAGAGTGAAACCCTGTCAGG + Intergenic
1109554528 13:63955006-63955028 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1110415948 13:75253002-75253024 AAATATAGGGAGACTTTGTCAGG - Intergenic
1110431267 13:75426854-75426876 CAACATGGGGAGACCCTGTCTGG + Intronic
1110441760 13:75533987-75534009 CAACAGACTGAGATCCTGTCTGG - Intronic
1110515133 13:76402401-76402423 CGACAGAGTGAGACTCCATCTGG + Intergenic
1110566574 13:76963405-76963427 CAACAAAGTAAGACCCTGTCTGG + Intergenic
1110762690 13:79248115-79248137 CGACAGAGTGAGACTCCATCTGG - Intergenic
1110773283 13:79376217-79376239 CAACTGAGCAAGACCCTGTCTGG - Intronic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1111667515 13:91288025-91288047 TTACAGGGTGAGACTCTGTCTGG - Intergenic
1111703970 13:91724835-91724857 CGACAGAGTGAGATCCTGTCTGG + Intronic
1111768965 13:92572013-92572035 CAACAGAATGAGCCCCTGTCTGG + Intronic
1111879983 13:93944221-93944243 CGACAGAGCAAGACTCCGTCAGG - Intronic
1111957587 13:94775536-94775558 CAACAGAGTGAGGCCTTGTCAGG + Intergenic
1112419816 13:99237933-99237955 CGACAAAGTGAGACTCTCTCTGG + Intronic
1112451953 13:99520586-99520608 CGACAGAGCAAGACTCTGTCTGG - Intronic
1112763856 13:102719856-102719878 CAACAGAGTAAGACCCTGTCTGG + Intergenic
1113119913 13:106915081-106915103 TGACAGAGCGAGACCCTGTCTGG + Intergenic
1113189374 13:107726627-107726649 CAACAGAGTGAGACTCCATCTGG - Intronic
1113225144 13:108151616-108151638 CAGCAGAGTGAGACCCTGTCTGG + Intergenic
1113723707 13:112581463-112581485 CGACAGAGTGAGACCTTGTCTGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114175830 14:20318780-20318802 CGACAGAGTGAGACCCTATCTGG - Intronic
1114413896 14:22526110-22526132 CGACAGATGGAGCCTCTGACAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114446021 14:22788682-22788704 CGACAGAGTGAGACTCTGTCTGG + Intronic
1114470600 14:22958342-22958364 CAACAGAGCAAGACTCCGTCTGG - Intronic
1115233060 14:31182208-31182230 CGACAGAGCAAGACCCTGTCTGG - Intronic
1115273794 14:31584163-31584185 CAACAAAGCAAGACCCTGTCAGG - Intronic
1115560331 14:34577101-34577123 CAACAGAGCAAGACTTCGTCTGG - Intronic
1115581025 14:34758558-34758580 CGACAGAGTGAGACTGTCTCAGG + Intronic
1115632569 14:35260029-35260051 CAACAGAGTGAAACCCTATCTGG - Intronic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1116983106 14:51191789-51191811 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1117016133 14:51519182-51519204 CGACAGAGTGAGACTCCGTTGGG - Intronic
1117304133 14:54457094-54457116 CAACAGAGCAAAACCCTGTCTGG + Intergenic
1117361245 14:54976380-54976402 CAACATAGAGAGACCCTGCCAGG - Intronic
1118181533 14:63498575-63498597 TGACAGAGTGAGACCCTGTCTGG - Intronic
1118206159 14:63725352-63725374 CAACAGAGCGAGACTCCGTCAGG + Intronic
1118263107 14:64266899-64266921 TGACAGAGTGAGACTCTGTCTGG - Intronic
1118834306 14:69465459-69465481 CAACAGAACAAGACTCTGTCTGG + Intergenic
1119233899 14:73003688-73003710 CAACAGAGCAAGACTCTAACTGG + Intronic
1119337641 14:73847691-73847713 CAACAGAGGACAACTCTGACTGG + Intergenic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119548407 14:75490441-75490463 CAACATAGTGAGACTCTGTCTGG - Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1120907298 14:89631545-89631567 CGACAGAGCGAGACTCCGTCTGG + Exonic
1121036729 14:90711439-90711461 CAACAGAGCGAGACTCCATCGGG - Intronic
1121266023 14:92603167-92603189 TTACAGAGGGAGACTCAGGCAGG + Intronic
1121734881 14:96211269-96211291 CCACAGAGGGAGGCTCTCTGGGG + Intronic
1121853825 14:97248205-97248227 CAACAGAGAGAGAATCTGATTGG - Intergenic
1121971366 14:98359517-98359539 AGACAGAGCTAGACTCTGTCAGG - Intergenic
1122058436 14:99120882-99120904 CAACATAGAGAAACCCTGTCAGG + Intergenic
1122085564 14:99299562-99299584 AAAAAGAGTGAGACCCTGTCTGG + Intergenic
1122233076 14:100316918-100316940 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1122581613 14:102775401-102775423 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1122608698 14:102965935-102965957 CAACAGAGTGAGACTGTCGCGGG + Intronic
1122672298 14:103382132-103382154 CAAGAGAGCAAGACCCTGTCTGG + Intergenic
1122686770 14:103512253-103512275 CGACAGAGTGACACTCTGTCTGG - Intergenic
1122954065 14:105061690-105061712 CAACACAGGAAGCCTCTGCCTGG - Intronic
1123677862 15:22729928-22729950 CGACAGAGTAAGACTCCGTCTGG - Intergenic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1123912661 15:24983766-24983788 TGACAGAGTGAGACTCCGTCTGG + Intergenic
1123966933 15:25468541-25468563 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1124033214 15:26030003-26030025 CAACAGAGTGAGACACTCTTGGG + Intergenic
1124045860 15:26149173-26149195 CGACACAGCCAGACTCTGTCTGG + Intergenic
1124330063 15:28804195-28804217 CGACAGAGTAAGACTCAGTCTGG - Intergenic
1124379997 15:29157075-29157097 CGACAAAGCGAGACTCTGTCTGG + Intronic
1124447621 15:29752120-29752142 TGACAGAGCGAGACTCCGTCTGG - Intronic
1124844158 15:33274679-33274701 ACACAGAGGGAGACTTTGTTTGG - Intergenic
1124908087 15:33891081-33891103 CAACAGAGTGAGACTCTGTCTGG + Intronic
1125662808 15:41407630-41407652 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1125758296 15:42080913-42080935 CACCAGAGGGACACTTTGTGTGG - Intronic
1125958834 15:43811525-43811547 TGACAGAGTGAGACTCTATCTGG - Intronic
1126030422 15:44491859-44491881 CAAAAGAGCCAGACCCTGTCTGG + Intronic
1126285689 15:47008562-47008584 CAGTAGAGTGAGACTCTGTTTGG - Intergenic
1126355367 15:47789615-47789637 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1126600547 15:50423626-50423648 CAGCAGAGCAAGACTCCGTCTGG - Intergenic
1126605561 15:50472575-50472597 AGACAGAGCGAGACTCTGTCTGG + Intronic
1126606918 15:50487102-50487124 CAACAGAGCAAGACTCCATCTGG + Intronic
1126766124 15:52012965-52012987 CGACAGAGTGAGACTCCGCCTGG + Intronic
1127122645 15:55785038-55785060 CGACAGAGCAAGACTCCGTCTGG + Intergenic
1127145881 15:56023245-56023267 CAACAGAGAGAGACTCCGTGTGG - Intergenic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127358696 15:58226318-58226340 CAAGAGAGGCAGACACTGTGTGG - Intronic
1127429263 15:58886284-58886306 CTACAGAGCCAGACCCTGTCTGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127685728 15:61341730-61341752 CGACAGAGCAAGACTCTATCTGG + Intergenic
1127785483 15:62351367-62351389 CCACAGAGTGAGACTCCGTCTGG + Intergenic
1127965341 15:63918823-63918845 CGGCAGAGTGAGACTCTGTGCGG + Intronic
1128305696 15:66597671-66597693 TGACAGAGCGAGACTCTGTCTGG - Intronic
1128364600 15:66988801-66988823 CAACACAGAGAGACTCTGTTTGG + Intergenic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128581156 15:68811040-68811062 CCACAGAGTGAGACTCTGTCTGG + Intronic
1128832863 15:70785504-70785526 CGACAGAGTGAGACTCCATCTGG - Intergenic
1129024253 15:72554403-72554425 CAACAAAGTGAGACTCTATTTGG - Intronic
1129074354 15:72978933-72978955 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1129145001 15:73639115-73639137 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1129339480 15:74875753-74875775 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1130030841 15:80312103-80312125 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1130078193 15:80708333-80708355 CGACAGAGCAAGACTCTGTCTGG - Intronic
1130165120 15:81448100-81448122 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1130706491 15:86237787-86237809 CAAAAGCGGGGGAATCTGTCAGG - Intronic
1130876321 15:88017721-88017743 CAACACAGGGAGCCTGTGCCTGG - Intronic
1131281264 15:91023305-91023327 CAAAAGGGCGAGACTCTGTCAGG - Intergenic
1131318928 15:91367882-91367904 CGACAGAGCAAGACTCCGTCTGG - Intergenic
1131486825 15:92827934-92827956 CGACAGATAGAGACTCTGTCGGG - Intergenic
1131912177 15:97219437-97219459 CAACAGAGTGAGACTCTATAGGG - Intergenic
1131949764 15:97669352-97669374 CAACAGAGCAAGACCCTGACTGG - Intergenic
1132104064 15:99050251-99050273 CAACAGAGCCAGACCCTGTTTGG + Intergenic
1132181603 15:99757615-99757637 CAACAGAGTGAACCCCTGTCTGG - Intergenic
1132276767 15:100573136-100573158 CAACAGATGGAGATCCTTTCAGG - Intronic
1132391415 15:101441359-101441381 CAGCAGAGACAGACTCTGTGGGG - Intronic
1132521533 16:392288-392310 CAACAGGGCGAGACCCGGTCTGG - Intergenic
1132837267 16:1960237-1960259 CAACAGAGTGAGACTGTCTCAGG - Intronic
1133048897 16:3105645-3105667 CGACAGACCAAGACTCTGTCTGG + Intergenic
1133105885 16:3509227-3509249 CAACAGAACGAGACCTTGTCTGG + Intronic
1133124447 16:3636798-3636820 CAACAGAGTGAGACTCTGTCTGG + Intronic
1133329240 16:4961346-4961368 CAACAGAGTGAGACTCAGTCTGG - Intronic
1133369468 16:5237125-5237147 CAAGAGAGTGAGACCCTGTCTGG + Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133819834 16:9226346-9226368 CAACAGAGCCAGACCCTGTCAGG - Intergenic
1133849184 16:9485878-9485900 TGACAAAGTGAGACTCTGTCTGG + Intergenic
1133947999 16:10365341-10365363 CAACAGAGCAAGACTATCTCAGG + Intronic
1133949236 16:10376459-10376481 CAAGAGAGAGGCACTCTGTCAGG - Intronic
1133987892 16:10682345-10682367 TGACAGAGTGAGACTCTGTCTGG - Intronic
1134014936 16:10881276-10881298 CAACAGAGCAAGACTGTCTCAGG + Intronic
1134060259 16:11195239-11195261 CGATAGAGCGAAACTCTGTCTGG - Intergenic
1134068691 16:11247105-11247127 TGACAGAGTGAGACTCTGTCGGG - Intergenic
1134103996 16:11472210-11472232 TGACAAAGTGAGACTCTGTCTGG - Intronic
1134118524 16:11567398-11567420 CAACAGAGCAAGACTCCGTCTGG + Intronic
1134130416 16:11645867-11645889 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1134241625 16:12510974-12510996 CGACAGAGTGAGACTCTGTGGGG - Intronic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134448929 16:14351597-14351619 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1134464703 16:14464734-14464756 CAACAGAGGAAGATTCTGTTTGG + Intronic
1134493950 16:14717424-14717446 CAACAGAGGGAGACTCGTCTTGG - Intronic
1134499330 16:14756548-14756570 CAACAGAGGGAGACTCGTCTTGG - Intronic
1134525881 16:14943174-14943196 CAACAGAGGGAGACTCCTTTTGG - Intronic
1134546526 16:15113188-15113210 CAACAGAGGGAGACTCGTCTTGG + Intronic
1134547011 16:15117671-15117693 CAACAGAGGGAGACTCGTCTTGG + Intronic
1134581239 16:15372463-15372485 CAACAGAGGGAGACTCCTCTTGG + Intronic
1134713461 16:16341662-16341684 CAACAGAGGGAGACTCCTCTTGG - Intergenic
1134721331 16:16385020-16385042 CAACAGAGGGAGACTCCTCTTGG - Intronic
1134744501 16:16577335-16577357 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1134946095 16:18326864-18326886 CAACAGAGGGAGACTCCTCTTGG + Intronic
1134953358 16:18367008-18367030 CAACAGAGGGAGACTCCTCTTGG + Intergenic
1135000986 16:18776417-18776439 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1135019825 16:18954211-18954233 CAACAGAGCCAGACTCTCTCGGG - Intergenic
1135029985 16:19030596-19030618 TGACAGAGAAAGACTCTGTCTGG - Intronic
1135035496 16:19073471-19073493 TGACAGAGTGAGACCCTGTCTGG + Intronic
1135036034 16:19077606-19077628 AGACAGAGTGAGACTGTGTCTGG - Intronic
1135079627 16:19422926-19422948 CCACAGAGCGAGACTCAGTCTGG + Intronic
1135108015 16:19667712-19667734 CGACAGAGCAAGACCCTGTCTGG + Intronic
1135176617 16:20235495-20235517 CAAGAGAGGAAGACTTTATCTGG - Intergenic
1135283936 16:21176878-21176900 TGACAGAGCTAGACTCTGTCTGG + Intronic
1135697307 16:24601216-24601238 CAACAGAGCTAGACTCTGTCTGG - Intergenic
1135706185 16:24677180-24677202 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1135760791 16:25136567-25136589 CAACAGAGTGAGACTCTGACGGG - Intronic
1135773024 16:25231837-25231859 TGACAGAGCAAGACTCTGTCTGG + Intergenic
1136039115 16:27564042-27564064 CAACAGAGCAAGACCCTGTCTGG + Intronic
1136151318 16:28351623-28351645 CAACAGAGGGAGACTCGTCTCGG + Intronic
1136167550 16:28465463-28465485 CAACAGAGGGAGACTCGTCTCGG + Intronic
1136195427 16:28649555-28649577 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136211765 16:28763671-28763693 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136256485 16:29043617-29043639 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136465731 16:30442357-30442379 CAACAGAGTGAGACTTTGTCCGG + Intergenic
1136484909 16:30565449-30565471 CAACATAGTGAGACCCTGTCTGG + Intergenic
1136579028 16:31140942-31140964 CGACAGAGCAAGACTCTGTCTGG - Intronic
1136603753 16:31316365-31316387 TAACAGAGCAAGACTCCGTCTGG + Intronic
1137333993 16:47530153-47530175 TGACAGAGCAAGACTCTGTCTGG - Intronic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137466450 16:48714151-48714173 CAACATAGTAAGAATCTGTCAGG - Intergenic
1137794403 16:51203129-51203151 CTATAGAGTGAGACCCTGTCAGG - Intergenic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138472234 16:57246782-57246804 CGACAGAGCGAGACTCCGTCTGG + Intronic
1138494785 16:57401502-57401524 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1138687548 16:58738942-58738964 CAACAGAGTGAGACGCTGTCAGG + Intergenic
1138693102 16:58787146-58787168 CAATAGAGCGAGACTCTGTCGGG - Intergenic
1139709794 16:68767212-68767234 CAACAGAGCGAGACTGTCTCAGG - Intronic
1139779770 16:69340740-69340762 CGACAGAGTGAAACTGTGTCAGG - Intronic
1139849947 16:69945103-69945125 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139878934 16:70168011-70168033 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139902676 16:70340698-70340720 CGACAGAGCGAGACTCCGTCTGG - Intronic
1139939008 16:70591370-70591392 GGACAGAGGGTGACTCTGGCAGG + Intronic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140366176 16:74382940-74382962 CAACAGAGGGAGACTCGTTTCGG - Intronic
1140373584 16:74427482-74427504 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1140503053 16:75451528-75451550 TGACATAGGGAGACCCTGTCTGG + Intronic
1140571629 16:76113214-76113236 CTACAGAGCAAGACTCTGTCTGG + Intergenic
1140692577 16:77498711-77498733 TAACAGAGCGAGACCCTGTCTGG + Intergenic
1140784813 16:78330415-78330437 CAACAGAGCAAGACTTTCTCAGG - Intronic
1141147298 16:81540320-81540342 CAACAAAGTGAGACTCAGCCAGG - Intronic
1141251592 16:82363815-82363837 TAACAGTGGGAGAGTCTGTCTGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1141668499 16:85479039-85479061 CGACAGAGCGAGACTCCATCTGG - Intergenic
1142238253 16:88932947-88932969 CGACAGAGTGAGATTGTGTCTGG + Intronic
1142570539 17:870733-870755 CAACAGAGTGAGACTCTGTCTGG + Intronic
1142606046 17:1081595-1081617 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142643380 17:1297621-1297643 CGACAGAGCAAGACTCTGTCTGG - Intronic
1142750468 17:1984381-1984403 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142781446 17:2184341-2184363 CAACAGAGCAAGACTCTGGGGGG + Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143133390 17:4695300-4695322 CAACAGAGTGAGACTCCGTCTGG + Intronic
1143361679 17:6376271-6376293 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1143596950 17:7920435-7920457 CGACGGAGCAAGACTCTGTCTGG - Intergenic
1143774714 17:9190830-9190852 CAACAGAGCAGGACTGTGTCTGG + Intronic
1144292314 17:13838225-13838247 CGACAGAGCGAGACGCCGTCCGG + Intergenic
1144394474 17:14830872-14830894 CGACAGAGCAAGACTCCGTCTGG - Intergenic
1144805788 17:17966099-17966121 CAACAGAGCAAGACTCCATCTGG + Intronic
1144943530 17:18958088-18958110 CAACAGAGTGAAATCCTGTCTGG - Intronic
1144962236 17:19051357-19051379 GGACAGAGCGAGACTTTGTCTGG + Intergenic
1144972925 17:19123163-19123185 GGACAGAGCGAGACTTTGTCTGG - Intergenic
1145088280 17:19963233-19963255 TGACAGAGCAAGACTCTGTCTGG - Intronic
1145930596 17:28682599-28682621 CAACAGAGCGAGACCGTCTCAGG + Intronic
1146068082 17:29653604-29653626 CAACAGAGTGAGACTCTGTCTGG - Intronic
1146162516 17:30567568-30567590 CAAATGAGAGAGACGCTGTCTGG - Intergenic
1146245837 17:31282038-31282060 CAATGGAGAGAGACCCTGTCTGG + Intronic
1146392511 17:32435760-32435782 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1146801994 17:35832056-35832078 CAACAGAGCAAGACTCCGTCTGG + Intronic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1146888429 17:36487769-36487791 CTACAGAGCCAGACTCAGTCTGG + Intronic
1146961662 17:36985561-36985583 CGACAGAGCAAGATTCTGTCTGG - Intronic
1146973453 17:37091597-37091619 CAACAGGAGGAGACCCTGTCTGG - Intronic
1147005658 17:37401577-37401599 CAACAGAGTGAGACCTCGTCTGG - Intronic
1147021045 17:37533379-37533401 TGACAGAGTGAGACTCTGTCTGG + Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147203046 17:38816702-38816724 CAACAGAGTGAAACTCTGTCTGG - Intronic
1147209932 17:38867057-38867079 TTACAGAGGAAGACTCCGTCTGG + Intergenic
1147211324 17:38874106-38874128 CAGCAGAGGTAGGGTCTGTCTGG + Intronic
1147280109 17:39352659-39352681 CAACAGAGTGAAGCTCTGTCTGG + Intronic
1147288931 17:39425780-39425802 CGACAGAGTGAGACTCTGTCTGG + Intronic
1147340001 17:39747605-39747627 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1147579511 17:41620349-41620371 CAAATGAGAGAGACACTGTCTGG - Intronic
1147621033 17:41866834-41866856 CGACAGAGTGATACCCTGTCTGG + Intergenic
1147658819 17:42106137-42106159 TAACAGAGTGAGACTCTGTCTGG + Intronic
1147742652 17:42677603-42677625 CAAGACAGCGAGACCCTGTCTGG - Intergenic
1147781831 17:42948658-42948680 CAACAGAGTGAGACTATATCTGG + Intergenic
1147820229 17:43237170-43237192 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147822334 17:43249055-43249077 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147823258 17:43254501-43254523 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147823627 17:43256642-43256664 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824086 17:43259406-43259428 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824300 17:43260701-43260723 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824787 17:43263537-43263559 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824847 17:43263846-43263868 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147827964 17:43281365-43281387 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147829072 17:43287527-43287549 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147830168 17:43293667-43293689 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147831111 17:43298864-43298886 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147833382 17:43312897-43312919 CAATAGAGTGAGACTGTGTTGGG + Intergenic
1148091630 17:45025769-45025791 CGACAGAGTGAGACTGTCTCAGG - Intronic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1148465364 17:47861719-47861741 AGACAGAGTGAGACTCCGTCTGG + Intergenic
1148944178 17:51244433-51244455 CAACAAGGGGAGACTGTCTCAGG - Intronic
1149307151 17:55358908-55358930 AGAAAGAGTGAGACTCTGTCAGG + Intergenic
1149318451 17:55460407-55460429 GACAAGAGTGAGACTCTGTCTGG + Intergenic
1149748691 17:59124410-59124432 CAACAGAGTGAGACTCTGTCTGG + Intronic
1149760387 17:59223889-59223911 CGACAGTGCGAGACTCCGTCAGG + Intronic
1149896135 17:60429842-60429864 TGACAGAGCGAGACTCCGTCTGG - Intronic
1149968836 17:61195377-61195399 CAACAGAATGAGACCTTGTCTGG - Intronic
1150127094 17:62644397-62644419 CAAAAGAGAAAGACTCCGTCTGG + Intronic
1150570841 17:66385674-66385696 CAACACAGCGAGACTCTTCCTGG + Intronic
1150741109 17:67779606-67779628 CGACAGAATGAGAATCTGTCTGG - Intergenic
1150767286 17:68012218-68012240 CAACAGAGCAAGACCGTGTCTGG + Intergenic
1150912263 17:69400514-69400536 CACCAGAGTGAGACTGTCTCGGG + Intergenic
1150972038 17:70039802-70039824 CAACAGAGCAAGAATCTGTCTGG - Intergenic
1151011592 17:70504152-70504174 CAACAGAGCAAGACTCTATCTGG + Intergenic
1151203031 17:72482857-72482879 CAACAGAATGGGACTCTATCTGG + Intergenic
1151230951 17:72684710-72684732 AAACAGAGTGAGCCTCAGTCAGG - Intronic
1151289496 17:73139251-73139273 CAACAGAGTGAGACTCCGCATGG + Intergenic
1151528657 17:74689421-74689443 TGACAGAGCAAGACTCTGTCTGG + Intronic
1151538899 17:74754420-74754442 CAACAGAGCAAGACTGTCTCAGG - Intronic
1151576584 17:74955479-74955501 CGACAGAGTGAGACGCCGTCGGG + Intronic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1151861834 17:76770049-76770071 CGACAGAGCGAGACTCTGTCTGG - Intronic
1151862296 17:76773627-76773649 CAACTGAGCGAGACTCCGTCTGG - Intronic
1151882423 17:76903529-76903551 CACCTGAGGGAGACTCTTTCTGG - Intronic
1152106795 17:78334897-78334919 CAGCAGAGTGAGACGCTGTCTGG - Intergenic
1152127301 17:78454927-78454949 TGACAGAGTGAGACTCTGTCAGG - Intronic
1152177096 17:78794986-78795008 CGACAGAGGGAGACTCTGTTCGG + Intronic
1152391540 17:80006676-80006698 TGACAGAGAGATACTCTGTCTGG - Intronic
1152398232 17:80048238-80048260 CAACAGAGCAAGACTCTGTCTGG + Intronic
1152439339 17:80296037-80296059 CCACAGAGTGAGACGCCGTCTGG - Intronic
1152495112 17:80665562-80665584 TGACAGAACGAGACTCTGTCAGG - Intronic
1152605768 17:81289058-81289080 TGCCAGAGTGAGACTCTGTCTGG - Intronic
1153009305 18:523373-523395 CCACAGAGTGAGACTCTGTCTGG + Intergenic
1153187097 18:2498185-2498207 CTCCAGAGTGAGACTCTGTCTGG - Intergenic
1154182988 18:12153570-12153592 TGACAGAGCGAGACTCTGCCTGG + Intergenic
1154346343 18:13546386-13546408 CAACAGGGCAAGACTCTGTCAGG - Intronic
1154946841 18:21170229-21170251 CAACAGTGCGAGACTCTGTCTGG + Intergenic
1154960613 18:21304997-21305019 CAACAGAGCGACACTCTGTCTGG - Intronic
1154992087 18:21607050-21607072 CAACAGAGCGAGACTCCATCTGG - Intergenic
1155026499 18:21945483-21945505 AGACAGAGTAAGACTCTGTCTGG - Intergenic
1155035808 18:22023943-22023965 CAACAGAGCGACACCCTGCCAGG + Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155330149 18:24707476-24707498 CAACAGAACAAGACTCCGTCTGG - Intergenic
1155443541 18:25885845-25885867 AAAGAGAGAGAGACTCTGTTGGG + Intergenic
1155481451 18:26292539-26292561 CATCAGAGCAAGACTCCGTCTGG - Intronic
1155501613 18:26492220-26492242 CAATAGAGTGAGACCCTATCTGG + Intronic
1155860495 18:30891559-30891581 AGACAGAGCGAGACTCTGTCTGG + Intergenic
1155955310 18:31951902-31951924 CGACAGAGTGAGACCCCGTCTGG + Intronic
1156082446 18:33354628-33354650 CGACAGAGTGAGACTCTGTCTGG - Intronic
1156132870 18:33999670-33999692 TAACAGAGCAAGACTCTCTCAGG - Intronic
1156968339 18:43124043-43124065 TAACAGAATGAGACCCTGTCTGG - Intergenic
1157039193 18:44018105-44018127 TGACAAAGTGAGACTCTGTCTGG + Intergenic
1157358142 18:46953995-46954017 GAACAGAGGAAGACTTTGTGGGG + Intronic
1157462424 18:47911329-47911351 CAACAGAGCGAGACTCCATCTGG + Intronic
1157683242 18:49623211-49623233 CGACGGAGCAAGACTCTGTCTGG - Intergenic
1157997713 18:52578958-52578980 CAACAGAGTGAGACTCCGTCTGG + Intronic
1158210239 18:55040787-55040809 CAACAGATGAAAAGTCTGTCTGG - Intergenic
1158345323 18:56510586-56510608 AAACAGAGCAAGAGTCTGTCTGG - Intergenic
1158506763 18:58053326-58053348 CGACAGAGTGAGACTCCATCTGG - Intronic
1158575702 18:58635769-58635791 CAACAAAGTGAGACTTTGTCTGG + Intergenic
1158954950 18:62528577-62528599 CGACAGAGTGAGACTGTCTCGGG + Intronic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1160713800 19:565794-565816 CGACAGAGCGAGACTCCATCAGG - Intergenic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1161124570 19:2548459-2548481 CGACAGAGCGAGGCTCTGTCTGG + Intronic
1161188931 19:2942392-2942414 CAACAGAGCTAGACCCTGTCTGG - Intronic
1161405099 19:4087072-4087094 CGACAGAGCAATACTCTGTCTGG + Intergenic
1161424245 19:4193815-4193837 CGACAGAGCGAGACTCCGTCGGG + Intronic
1161439655 19:4283596-4283618 CGACAGAGTGAGACTCCGCCTGG - Intronic
1161603198 19:5197983-5198005 CGACAGAGCGAGACTCCATCTGG + Intronic
1161616754 19:5275088-5275110 CGACAGAGTGAGACACTGTCTGG - Intronic
1161682937 19:5689209-5689231 CGACAGAGCAAGACCCTGTCTGG + Intronic
1161716439 19:5878708-5878730 CGACAGAGGGAGACTCCGTCTGG - Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1162094932 19:8304715-8304737 CAACAGAGTAAGACTGTCTCAGG - Intronic
1162214612 19:9123013-9123035 CAACAGAGTGAGACTTTGTCTGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162313669 19:9923535-9923557 CAACAAAGTGAGACTGTCTCAGG + Intronic
1162451714 19:10758959-10758981 CAATAGAGCGAGACTCTGTGTGG - Intronic
1162455996 19:10785135-10785157 CAACAGAGCGAGACTCCATCTGG - Intronic
1162664342 19:12196899-12196921 GCACAGAGTGAGACTCTGCCGGG - Intergenic
1162759848 19:12882172-12882194 CAACAGAGCGAGATATTGTCCGG - Intergenic
1162761706 19:12892309-12892331 CAACAGAGCCAGACTCTGTTGGG - Intronic
1162842025 19:13363674-13363696 CCACAGAAGAAGATTCTGTCTGG - Intronic
1163135811 19:15310378-15310400 CCACAGAGTGAGACTCCTTCGGG - Intronic
1163141473 19:15352024-15352046 CAACAGAGCGAGATTCCATCTGG - Intergenic
1163261340 19:16192073-16192095 CAAGAGAGTGAAACTCTGTCTGG - Intergenic
1163348873 19:16762802-16762824 TGACAGAGCAAGACTCTGTCAGG - Intronic
1163589576 19:18184719-18184741 CAACAGAGCAAGACTCTTTCAGG - Intergenic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1163805214 19:19392410-19392432 TGACAGAGCGAGACTCTGTCTGG - Intronic
1163879411 19:19904037-19904059 CAACAGAGCGAGATTCTGGCTGG + Intronic
1164027782 19:21368754-21368776 CAACAGAGTAAGAATTTGTCTGG - Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164921645 19:32092915-32092937 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1164979910 19:32606170-32606192 CGACAGAGCGAGACTCTGTCTGG - Intronic
1165131031 19:33632157-33632179 TGACAGAGGGAGACCCTGTCTGG - Intronic
1165323274 19:35099369-35099391 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1165771463 19:38382890-38382912 TGACAGAGCGAGACTCTGTCTGG + Intronic
1166189799 19:41168766-41168788 CAACAGAGCAAGACCCTTTCTGG - Intergenic
1166392316 19:42415788-42415810 TGACAGAGTGAGACTCCGTCTGG + Intronic
1166547330 19:43640986-43641008 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1166664066 19:44666648-44666670 CGACAGAGTGAGAATCTGTCAGG + Intronic
1166698647 19:44868890-44868912 CGACAGAGTGAGACTCTGTCTGG + Intronic
1166894070 19:46012625-46012647 TGACAGAGGGAGACTCTATGTGG + Intronic
1166900190 19:46055275-46055297 CAACACAGTGAGACCCTATCTGG - Intronic
1166941604 19:46369904-46369926 CAGCAGAGCGAGACTCCGTCTGG + Intronic
1166946328 19:46399152-46399174 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1167067293 19:47196063-47196085 CAACAGAGCGAGACTCCGTCTGG - Intronic
1167076186 19:47250923-47250945 CAACAGAGCCAGGCTCTGTGGGG - Intergenic
1167127286 19:47558762-47558784 CAACAGAGTGAAACTGTCTCAGG - Intergenic
1167421461 19:49406394-49406416 CGACAGAGCGAGACTGTCTCAGG - Intronic
1167765005 19:51476253-51476275 GGACAGAGTGAGACTCTGTCTGG + Intergenic
1167818307 19:51903797-51903819 CAACAGAGCTAGATTCCGTCTGG + Intronic
1167891777 19:52545758-52545780 CAATAGAGTGAGACTCCATCTGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167996007 19:53402747-53402769 CAACACAGCAAGACCCTGTCTGG - Intronic
1168001493 19:53449875-53449897 CAACACAGCAAGACCCTGTCTGG - Intronic
1168218471 19:54943579-54943601 CGACAGAGCGAGACTCCGTCTGG + Intronic
1168349825 19:55669384-55669406 GAGCAGAGGGAGACTGGGTCTGG + Intronic
1168551333 19:57298488-57298510 TGACAGAGCGAGACTATGTCTGG - Intergenic
1168564847 19:57414352-57414374 CGACAGAGTTAGCCTCTGTCTGG - Intronic
1168596305 19:57680546-57680568 CAACAGAGTGAGACTCCGTCTGG + Intergenic
1168672035 19:58247932-58247954 TGACAGAGTGAGACTCTGTCTGG - Intronic
1168708538 19:58483628-58483650 CAACAGGATGAGACCCTGTCTGG + Intronic
925007959 2:459602-459624 CAGCAGAGGGAGGCTCCCTCAGG + Intergenic
925371031 2:3345603-3345625 CAATAGAGCGAGACTCTGTCTGG + Intronic
925429853 2:3781843-3781865 TGACAGAGAGAGACTCTGTCTGG + Intronic
925489811 2:4378319-4378341 TGACAGAGTGAGGCTCTGTCAGG + Intergenic
926249331 2:11145001-11145023 CGACAGTGCGAGACTCTGTCTGG - Exonic
926379780 2:12275379-12275401 CAACAAAGCGAGACTCCGTCTGG + Intergenic
927042685 2:19245735-19245757 CGATAGAGTAAGACTCTGTCTGG - Intergenic
927632439 2:24786227-24786249 CAACAGAGTGAGACTTTGTCTGG - Intergenic
927915172 2:26930952-26930974 CGACAGAGCAAGACTCCGTCTGG + Intronic
928150561 2:28824454-28824476 CAACAGAGCAAGATGCTGTCAGG + Intronic
928159591 2:28909851-28909873 CAACACAGTGAGACCCTGTTTGG + Intronic
928344695 2:30480732-30480754 CAATAGAGTGAGACTGTTTCTGG + Intronic
928667696 2:33567186-33567208 CAACAGAGCGACACACTGTCTGG + Intergenic
930059986 2:47280288-47280310 TGACAGAGCGAGACCCTGTCTGG - Intergenic
930110462 2:47674691-47674713 TGACAGAGTGAGACCCTGTCTGG + Intergenic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
931960208 2:67473982-67474004 CGACAGAGCGAGACTCCTTCTGG - Intergenic
932067244 2:68577919-68577941 CAACAGATGAAGATTCTGACTGG + Exonic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
932559278 2:72852909-72852931 TGACAGAGTGAGACCCTGTCTGG + Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
932967329 2:76492120-76492142 CAACAGAGTAAGACTCTCTAGGG - Intergenic
933592488 2:84248305-84248327 CAACAGAGTGAGACTCTGTCAGG - Intergenic
933761064 2:85672442-85672464 CAACAGAGCAATACTCCGTCTGG + Intergenic
933945548 2:87283366-87283388 TGACAGAGTGAGACTCTGTCTGG - Intergenic
934081830 2:88475127-88475149 CTACAGAGTGAGACTCCATCTGG + Intergenic
934706048 2:96481936-96481958 CAACAGAGCGAGACTCTGTCTGG + Intergenic
935023194 2:99251855-99251877 CGACAGAGTGAGACTCCATCTGG - Intronic
935265998 2:101394808-101394830 CCACAGAGCGAGGCCCTGTCCGG - Intergenic
936011067 2:108925635-108925657 CAACAGAAGGAGACTGTTTCAGG - Intronic
936334664 2:111578220-111578242 TGACAGAGTGAGACTCTGTCTGG + Intergenic
936939482 2:117869785-117869807 CGAAAGAGTGAGACTCTGTCTGG - Intergenic
937012723 2:118576247-118576269 CCAGAGAGGGGGCCTCTGTCTGG - Intergenic
937202692 2:120215613-120215635 CGACAGAGCGAGACTCCGTCTGG - Intergenic
937291465 2:120784680-120784702 CAGCAGATGGAGGCTGTGTCTGG - Intronic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
938010459 2:127824704-127824726 CGACAGAGCAAGATTCTGTCTGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938275621 2:130018971-130018993 CAACAGAGTGAAACTCTTTCTGG - Intergenic
938399125 2:130974250-130974272 CAACAGAGTGAGATCTTGTCTGG + Intronic
938413351 2:131083922-131083944 CGACAGAGCGAGACTCCGTCTGG - Intronic
938413858 2:131088224-131088246 CAACAGAGCAAGACTCTGTCTGG + Intronic
938660386 2:133480642-133480664 CAACTGAGGGTCAATCTGTCTGG - Intronic
938894124 2:135733938-135733960 CAACAGAGCGAGACGCCGTCTGG + Intergenic
938957794 2:136314819-136314841 CAACAGAGTGAGACGCCTTCTGG - Intergenic
938994713 2:136665952-136665974 GCACAGATGGAGATTCTGTCTGG - Intergenic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
939896256 2:147794396-147794418 TGACAGAGAGAGACTCTGTCTGG + Intergenic
940194486 2:151078663-151078685 TAACAGAGCAAGACTCCGTCTGG + Intergenic
940304134 2:152207607-152207629 CAACAGAGCCAGACTCTGTGTGG - Intergenic
940509842 2:154599298-154599320 CGACAGAGCAAGACTCTGTCTGG + Intergenic
942001464 2:171652480-171652502 ACACAGAGAGAGACTCTGTTTGG - Intergenic
942316565 2:174701781-174701803 TGACAGAGCGAGACACTGTCTGG + Intergenic
942623834 2:177877525-177877547 GAACAGATGGAAAGTCTGTCTGG + Intronic
942654269 2:178198320-178198342 CGACAGAGCGAGATTCTGTCTGG - Intronic
943032700 2:182704189-182704211 CAAGAGAGAGACACTCCGTCTGG + Intergenic
943374439 2:187057393-187057415 CAACAGTGCAAGGCTCTGTCTGG + Intergenic
943753500 2:191534853-191534875 AAACAGTGGGAGACTCTGTGTGG + Intergenic
944446196 2:199792675-199792697 CATCAGAGGGAAATGCTGTCAGG - Intronic
944504473 2:200395989-200396011 CAAAAGAGTGAGACTCGATCTGG + Intronic
944576487 2:201095887-201095909 CAACATAGCAAGACACTGTCTGG - Intergenic
944704973 2:202279772-202279794 CAACAGAGCGAGACTCCTTCTGG + Intronic
944717167 2:202386698-202386720 CGACAGAGCAAGACTCTGTCTGG - Intronic
944724521 2:202456532-202456554 CGACAGAGCGAGACTCCCTCTGG - Intronic
944780924 2:203015478-203015500 CGACAGAGCAAGACTCCGTCTGG - Intronic
944839030 2:203607846-203607868 TGACAGAGTGAGACTCCGTCTGG - Intergenic
944840837 2:203622084-203622106 CAACAGAGGGAAAATCTTTGGGG + Intergenic
945190181 2:207179797-207179819 TGACAGAGTGAGACTCCGTCTGG + Intergenic
945280800 2:208033664-208033686 CAACAGAGTGAGACTCCATCTGG + Intergenic
945388094 2:209228433-209228455 TGACAGAGTGAGACTCTGTCTGG - Intergenic
946221078 2:218227608-218227630 CGACAGAGCAAGACGCTGTCTGG - Intronic
946231426 2:218293603-218293625 TGACAGAGCGAGACCCTGTCTGG - Intronic
946969799 2:225079263-225079285 CAACAGAGCAGGACTCTGTATGG - Intergenic
947078066 2:226365845-226365867 CGACAGAGTGAGACTCTATCTGG - Intergenic
947116500 2:226776884-226776906 CAACACAGTGAGACTCTTTGTGG + Intronic
947205176 2:227654293-227654315 CGACAGAGCAAGACTCTGCCTGG + Intergenic
947297178 2:228643894-228643916 CGACAGAGTGAGACTCTGTCTGG + Intergenic
947442542 2:230135919-230135941 CAACAGAGTGAGATCCTGTGTGG - Intergenic
947487159 2:230561826-230561848 TGACAGAGTGAGACTCTGTCTGG + Intergenic
947493732 2:230617713-230617735 TGACAGAGCGAGACTCCGTCTGG + Intergenic
947505174 2:230703285-230703307 CAACAGAGTGAGACTCTGTCTGG - Intergenic
947562918 2:231173504-231173526 CAACAGGGCAAGACCCTGTCTGG + Intergenic
947723772 2:232384391-232384413 CAACAGAGCAAGACCCTGTCTGG + Intergenic
947730215 2:232424154-232424176 CAACAGAGCAGGACTCTGTTGGG - Intergenic
948008826 2:234634258-234634280 CGACAGAGCTAGACTCTGTCGGG - Intergenic
948742884 2:240059513-240059535 CGACAGAGCAAGACTCTGTCTGG + Intergenic
948972152 2:241437483-241437505 CAAGAGAGTAAGACTCTCTCTGG - Intronic
1169164349 20:3409000-3409022 CGACAGAATGAGACTCAGTCTGG - Intergenic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169419898 20:5451471-5451493 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1170249010 20:14258960-14258982 TAACAGAGCAAGACTCTGTCTGG - Intronic
1171546508 20:26006117-26006139 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1171812361 20:29755332-29755354 CGACACAGTGAGACTCCGTCTGG + Intergenic
1172069815 20:32248425-32248447 CAATAGAGCAAGACTATGTCTGG - Intergenic
1172411570 20:34727741-34727763 CGACAGAGTGACACTCTGTCTGG - Intronic
1172551661 20:35805216-35805238 CAACAGAATGAGACCTTGTCTGG - Intronic
1173005151 20:39134564-39134586 AAGCAGAGGGAGCCCCTGTCTGG + Intergenic
1173008381 20:39158360-39158382 CAACACAGTGAGACCCTGTCTGG - Intergenic
1173604425 20:44320914-44320936 TGACAGAGCAAGACTCTGTCGGG + Intergenic
1173681036 20:44882035-44882057 CAACAGAGTGAGACTCTCTCTGG + Intergenic
1174014334 20:47475613-47475635 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1174042968 20:47713019-47713041 TAACAGAGCCAGACCCTGTCTGG + Intronic
1174412550 20:50345407-50345429 GAAAATAGGGAGACTCTGGCAGG + Intergenic
1174602119 20:51733391-51733413 CAACAGAATTAGACTCTGTCTGG - Intronic
1174610376 20:51793439-51793461 TGACAGAGTGAGACCCTGTCTGG + Intronic
1174810370 20:53640368-53640390 CGACAGAGTGAGACTTTGTTTGG - Intergenic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175235331 20:57506321-57506343 CAACAGAGCGAGACTGTCTCAGG - Intronic
1175631131 20:60537255-60537277 CGACAGAGCAAGACTCTATCTGG + Intergenic
1175709630 20:61208982-61209004 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1175848833 20:62075897-62075919 CAACAGAGTGAAACTTTGTCTGG + Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1175970003 20:62680922-62680944 TGACAGAGTGAGACCCTGTCTGG - Intronic
1176888604 21:14286363-14286385 CAACAGAGCAAGAGTCTGTGGGG + Intergenic
1176969391 21:15248368-15248390 CAACAGAGTGACATCCTGTCTGG - Intergenic
1177120600 21:17132834-17132856 CAGCAGAGGGAAACTGGGTCAGG + Intergenic
1177846596 21:26296048-26296070 CAACAGAATGAGACTCTGTCTGG - Intergenic
1178131167 21:29573831-29573853 CGACAGAGCAAGACTCCGTCTGG + Intronic
1178608703 21:34061073-34061095 CAAAAGAGTGAAACTCTGTCTGG + Intergenic
1178614168 21:34116025-34116047 TAACAGAGTGAAACCCTGTCGGG - Intronic
1178628303 21:34236858-34236880 CAACAAAATGAGACTCTGTCTGG + Intergenic
1178839222 21:36125351-36125373 CGACAGAGTGAGACTGTCTCAGG + Intergenic
1179457543 21:41509297-41509319 CAACAGAGTGAGACCCCTTCTGG - Intronic
1179663836 21:42896001-42896023 CAACAGAGTGAGACTGTCTCAGG - Intronic
1180166175 21:46031104-46031126 CCACAGAGTGAGACTCTGTCGGG - Intergenic
1180608444 22:17079475-17079497 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1180847041 22:18989198-18989220 CAACAGAGCAAGAACCTGTCTGG + Intergenic
1180915704 22:19484956-19484978 AAACAGAGAGAGACCCCGTCTGG - Intronic
1181754762 22:25016038-25016060 CAACAGAGCGAGACTCCGTCTGG - Intronic
1181776672 22:25164926-25164948 CAACAGAGTGAGACTGTCTCGGG + Intronic
1181945598 22:26515031-26515053 TGACACAGTGAGACTCTGTCTGG - Intergenic
1182033381 22:27178161-27178183 CAACAGAGTGAGACTCTTCTCGG + Intergenic
1182221646 22:28763466-28763488 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1182231779 22:28842947-28842969 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1182234795 22:28866760-28866782 TGACAGAGGGAGACCCTGTTAGG + Intergenic
1182308045 22:29384846-29384868 CGAAAAAGCGAGACTCTGTCTGG + Intronic
1182323828 22:29496376-29496398 CAACAGAGCAAGACTCCATCTGG + Intergenic
1182340346 22:29615162-29615184 CAACAAAGCAAGACTCTGTCTGG + Intronic
1182373589 22:29829677-29829699 CGACAGAGCAAGACTCTGTCTGG + Intronic
1182479963 22:30601790-30601812 AAACAGAGCGAGACTGTGTCTGG - Intronic
1182565373 22:31194706-31194728 TGACAGAGCAAGACTCTGTCTGG + Intronic
1182655889 22:31889567-31889589 CAACAGAGCGAGACTCTGTCTGG - Intronic
1182686566 22:32124795-32124817 CAATAGAGCAAGACTCTGTCTGG - Intergenic
1182715038 22:32351678-32351700 CAACAGAGCAAGATTCCGTCGGG + Intergenic
1182979636 22:34656970-34656992 CAACAGAGTGAGACTCCTTCTGG - Intergenic
1183444039 22:37841060-37841082 CAACAAAGTGAGACTGTCTCAGG + Intronic
1183647720 22:39136068-39136090 CGACAGAGCGAGACTCTGTCTGG + Intronic
1183793690 22:40097323-40097345 AAACAGAGAAAGACCCTGTCTGG - Intronic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1183879887 22:40818684-40818706 CAACAGAGCAAGACCCTGTCCGG + Intronic
1183945585 22:41324048-41324070 CGACACAGCGAGACTCTGTCTGG + Intronic
1184200351 22:42964396-42964418 CGACAGAGCGAGACTCCGTCTGG + Intronic
1184479799 22:44739585-44739607 TGACAGAGCGAGACTCTGTTGGG - Intronic
1184513904 22:44948669-44948691 TGACAGAGTGAGACTCTGTCTGG + Intronic
949152881 3:791680-791702 TGACAGAGTGAGACTCTGTCTGG + Intergenic
949183721 3:1165987-1166009 CAAGAGAGGGAGACTTTCTGTGG - Intronic
949268650 3:2188823-2188845 AAACAAAGGGAGACTCTGTTGGG + Intronic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950211015 3:11123357-11123379 CAACAGAGCAAGACCCTGTCTGG + Intergenic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
951574401 3:24099284-24099306 CAACAGGAAGAGACACTGTCTGG - Intergenic
951918459 3:27826803-27826825 CAACATAGACAGACTCTGTAGGG + Intergenic
952171120 3:30808010-30808032 CAACAGAGAGAGACCCCTTCGGG + Intronic
952303341 3:32124083-32124105 CTACAGAGGAAGACTCTGTCTGG - Intronic
952368203 3:32693559-32693581 TGACAGAGTGAGACCCTGTCTGG - Intronic
952433352 3:33247505-33247527 AGACAGAGGAAGACCCTGTCTGG - Intergenic
952768727 3:36977725-36977747 TGACAGAGGGAGACCCTGTCAGG + Intergenic
952792951 3:37214760-37214782 TAACAGAGTGAGACCCTGTCTGG + Intergenic
953306680 3:41837581-41837603 TGACAGAGTGAGACTCTGTCTGG - Intronic
953343687 3:42157130-42157152 AGAGAGAGTGAGACTCTGTCTGG + Intronic
953365800 3:42343875-42343897 CAACAGAGCGAGACTCTGTCTGG - Intergenic
953475547 3:43202893-43202915 CGACAGAGCAAGATTCTGTCTGG + Intergenic
953552639 3:43915929-43915951 CAACGGAGCAAGACTCTGTCTGG - Intergenic
953647100 3:44765850-44765872 TGACAGAGCGAGACTCCGTCTGG - Intronic
953744986 3:45567240-45567262 CAGCAGAGGGAGGATCTGTGAGG + Intronic
953752694 3:45621248-45621270 CAACAGAGCAAGACCCTGTAAGG - Intronic
954052873 3:47996061-47996083 CCATGGAGGGAGGCTCTGTCTGG - Intronic
954058602 3:48049916-48049938 CAACAGAGTGAGACTTCGTCTGG + Intronic
954061046 3:48067657-48067679 TGGCAGAGTGAGACTCTGTCTGG - Intronic
954070877 3:48142075-48142097 CGACAAAGCGAGACTCTGTCTGG - Intergenic
954188312 3:48937425-48937447 CAAGAGTGACAGACTCTGTCTGG - Intronic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954526007 3:51271829-51271851 CAACAGAGCGAGACTGTCTCAGG + Intronic
954547058 3:51446011-51446033 TGACAGAGCAAGACTCTGTCTGG - Intronic
954661818 3:52230514-52230536 CAACAGAGGGGATCTCTGACAGG + Intronic
954678712 3:52329803-52329825 CAACAGAGTGAGACTCCATCTGG + Intronic
955328406 3:58027170-58027192 TGACAGAGGGAGACCCTGTCTGG - Intronic
955361060 3:58275347-58275369 TGACAGAGTGAGACTCTGTCTGG - Intronic
955625115 3:60910429-60910451 CGACAAAGCGAGACTCCGTCTGG - Intronic
955680378 3:61494380-61494402 TGACAGAGTGGGACTCTGTCTGG - Intergenic
955844229 3:63144357-63144379 AAACAGAGAGAGGCTCTGTTTGG - Intergenic
956101736 3:65775427-65775449 CAACAGAGTGAGACCTTCTCTGG + Intronic
956432167 3:69198102-69198124 TGACAGAGTAAGACTCTGTCTGG + Intronic
956680873 3:71779621-71779643 TGACAGAGCAAGACTCTGTCTGG - Intronic
956863453 3:73347269-73347291 TGACAGAGCGAGACTCTGTCAGG - Intergenic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957701948 3:83726399-83726421 CAGGAGAGGGGGACTATGTCTGG + Intergenic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
958608675 3:96395080-96395102 TGACAGAGTGAGACTCTGTCTGG - Intergenic
958792193 3:98664541-98664563 CAAAAGAGCGAGACTCCGGCGGG - Intergenic
958930361 3:100201447-100201469 CGACAGAGCAAGACTCTGTCTGG - Intergenic
959332829 3:105027419-105027441 CAACAGAGTGAGACTCTATCTGG - Intergenic
959374005 3:105565008-105565030 CAACAGAGCAAGACTCTGTCTGG + Intronic
960117560 3:113911745-113911767 GGACAGAGCAAGACTCTGTCAGG - Intronic
960605380 3:119499111-119499133 CGACAGAGCAAGACCCTGTCTGG - Intronic
960830344 3:121840167-121840189 CGACAGAGTGAGATTCTCTCAGG + Intronic
961143274 3:124573519-124573541 TAATAGAGTGAGACCCTGTCTGG - Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961597596 3:128030980-128031002 TGACAGAGAGAGACCCTGTCTGG - Intergenic
961952414 3:130763272-130763294 ACACAGAGGGAGACTCTGTTAGG + Intergenic
962015273 3:131432390-131432412 ACACAGAGAGAGACTCTGTTTGG + Intergenic
962244535 3:133780990-133781012 TGACAGAGCAAGACTCTGTCTGG + Intergenic
962519870 3:136188411-136188433 CAACAGAGCAAGACTCCATCTGG + Intronic
962864941 3:139440721-139440743 CAACAGAGGGGAAATCTGCCTGG - Intergenic
962947499 3:140185231-140185253 CATCAGTGGCTGACTCTGTCCGG + Intronic
963023937 3:140900033-140900055 TGACACAGAGAGACTCTGTCTGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963810162 3:149768559-149768581 CAACAGAGCAAGACTCTGTCTGG - Intronic
963893712 3:150663472-150663494 CAACAGAGCAAGACCCTGTTAGG - Intronic
964113216 3:153108321-153108343 CAACAGAGTGAGACTCCGTCTGG + Intergenic
964342229 3:155719821-155719843 AGACAGAGTGAGAGTCTGTCTGG - Intronic
964356506 3:155855886-155855908 CGACAGAGTGAGACTCCGTCTGG + Intergenic
964573583 3:158139384-158139406 CAACAGAGCAAGACTTAGTCTGG + Intronic
964621623 3:158724843-158724865 TAACATAGTGAGACCCTGTCTGG - Intronic
964622320 3:158730443-158730465 CAACAGAGTGAGACCCTATGGGG - Intronic
965398797 3:168193756-168193778 TGACAGAGGGAGACTCCGTTTGG - Intergenic
965724613 3:171700971-171700993 CAGCAGAGGTAGACTATGTCAGG + Intronic
965770175 3:172173798-172173820 CAACAGAGCAAGACCCTGTCTGG + Intronic
966528874 3:180951201-180951223 TGACAGAGTGAGACCCTGTCTGG + Intronic
966820605 3:183921405-183921427 CAAAAGAAGGAGACGCCGTCAGG + Intronic
966872047 3:184297112-184297134 CGACAGAGCGAGACTCCGTCTGG + Intronic
967058654 3:185851967-185851989 CGACAGAGAGAGACCCTGTGTGG + Intergenic
967172735 3:186835936-186835958 TGACAGAATGAGACTCTGTCTGG - Intergenic
967478656 3:189949394-189949416 CAACATATGGAGATACTGTCAGG - Intergenic
967722766 3:192832770-192832792 CAACAGAATGAAACTCTGCCTGG + Intronic
967798957 3:193632836-193632858 CAATAGAGCAAGACCCTGTCTGG + Intronic
967914111 3:194565391-194565413 CAACAGAGCGAAACTCCATCTGG + Intergenic
968036346 3:195551333-195551355 CAATAGAGTGAGACTCAGTCTGG + Intergenic
968130163 3:196188557-196188579 CAACAGAGTGAGACTCCATCTGG - Intergenic
968193220 3:196685984-196686006 CGACAGATCAAGACTCTGTCTGG + Intronic
968326213 3:197819104-197819126 CAACAGAGTGAGATTCCGTCTGG + Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
969113445 4:4857468-4857490 CCACAAAGGGAGATTCTGGCTGG + Intergenic
969311578 4:6355971-6355993 TGACAGAGTGAGACTCTGCCTGG + Intronic
969397539 4:6932349-6932371 CGACAGAGCAAGACTCTGTCTGG + Intronic
969595270 4:8145201-8145223 CGACAGAGCGAGACTCTGTCTGG - Intronic
969656270 4:8500474-8500496 CAACAGAGCGAGACTCCCTCTGG + Intergenic
969725397 4:8915396-8915418 AGACAGAGGAAGACTCTGTATGG - Intergenic
969869216 4:10094406-10094428 CAACAGAGAGAAACTCAGTGGGG + Intronic
970081997 4:12298022-12298044 CAACAGAGTGAGACTGTCTCAGG - Intergenic
970192997 4:13532921-13532943 CAACAGAGCAAGACTCTGGACGG - Intergenic
970488494 4:16547976-16547998 TGACAGAGCAAGACTCTGTCTGG - Intronic
970758772 4:19457065-19457087 ACACAGAGCGAGACTCCGTCTGG + Intergenic
971364823 4:25969258-25969280 CAACAGAGCAAGATTCCGTCTGG + Intergenic
971849191 4:31961328-31961350 CCACAGAGTGAGACTCTGTCTGG - Intergenic
972090049 4:35270016-35270038 CAATAGAGTGAGACCTTGTCTGG - Intergenic
972331306 4:38066895-38066917 CGACAGAGCGAGACTCCATCGGG - Intronic
972425189 4:38926472-38926494 CAACAGAATGAGACTCTATCTGG - Intronic
972513709 4:39793534-39793556 CGACAGAGCAAGACTCCGTCAGG - Intergenic
972528578 4:39940197-39940219 TGACAGAGCGAGACCCTGTCTGG + Intronic
972531182 4:39962774-39962796 CAACAGAGCGAGACTCCGTCTGG + Intronic
972646606 4:40973869-40973891 CGACAGAGTGAGACTCTGTCTGG - Intronic
973061810 4:45735567-45735589 TGACAGAGTGAGACTCTGCCTGG - Intergenic
973111407 4:46402594-46402616 AAAAAGAGTGAGACACTGTCAGG - Intronic
973677545 4:53280494-53280516 CGACAGAGGGAAACTCTGTCTGG + Intronic
974050435 4:56936913-56936935 CGACAGAGCAAGACTCCGTCTGG - Intergenic
974148416 4:57974513-57974535 CGACAGAGCGAGACTCTGTCTGG - Intergenic
974403976 4:61441537-61441559 CAGCAGAGCAAGACTCCGTCTGG - Intronic
974501249 4:62706337-62706359 GAACAGAGCAAGACGCTGTCAGG + Intergenic
975068513 4:70100924-70100946 CGACAGAGCGAGACTCTGTCTGG + Intergenic
975119280 4:70711042-70711064 CCACAGAGCAAGACTCCGTCTGG + Intronic
975201080 4:71590296-71590318 CCACAGAGGAAGGCTCTTTCTGG - Intergenic
975581704 4:75912532-75912554 TGACAGAGGGAGACTCTGTCTGG + Intergenic
976155149 4:82136060-82136082 TGACAGAGTGAGACTCTGTCTGG + Intergenic
976434428 4:85000947-85000969 CAAGAGAGGGTAACTCTGTGAGG - Intergenic
976612240 4:87041988-87042010 CGACAGAGCGAGACTCCATCTGG + Intronic
976664666 4:87577698-87577720 CAACAGAGCAAGACTCTGTCTGG - Intergenic
977697812 4:99986153-99986175 CAACAGAGTGAGACTCTGTCTGG + Intergenic
977854814 4:101876352-101876374 GAACAGAGGGAGGCTTTGTTTGG + Intronic
977938709 4:102834727-102834749 TGACAGAGTGAGACCCTGTCTGG + Intronic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
978991087 4:115083438-115083460 TGACAGAGGGATACCCTGTCTGG + Intronic
979081128 4:116343909-116343931 TAACAGAGTAAGATTCTGTCTGG - Intergenic
979177105 4:117679107-117679129 CAACAGAGGGATCCTGGGTCCGG - Intergenic
979319079 4:119301405-119301427 CAACAGAGCGAGACTCCATCTGG + Intronic
980677613 4:136109554-136109576 TGACAGAGGGAGTCTCTGTCTGG - Intergenic
980773088 4:137404316-137404338 CAACAGAGCGAAACTCCGTCTGG - Intergenic
980773509 4:137409539-137409561 TGACAGAGCGAGACTCTGTCTGG - Intergenic
981087695 4:140700798-140700820 TGACAGAGTGAGACTCCGTCTGG + Intronic
981094510 4:140764412-140764434 TGACAGAGGGAGGCCCTGTCTGG + Intergenic
981686344 4:147458915-147458937 CAGGAGAGTGAGTCTCTGTCTGG + Intergenic
981759516 4:148178309-148178331 CAACAGAGTGAGACTCTGTCTGG + Intronic
981806762 4:148724994-148725016 CAACATAGGGAGACCCCGTCTGG - Intergenic
981923473 4:150112828-150112850 CAACAGAAAAAGACTCTGTCCGG - Intronic
982178301 4:152727260-152727282 TAACAGAGTGAGACACTGTTTGG - Intronic
982328662 4:154157199-154157221 CAACAGAGTGAGACCATCTCCGG - Intergenic
982453410 4:155578777-155578799 CTACAGAGTGAGACTCTGTCTGG + Intergenic
982769987 4:159388966-159388988 CAACACAGTGAGACTCCATCTGG + Intergenic
983467423 4:168112276-168112298 CAGCAGAGCAAGACTCTGTCTGG + Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983780667 4:171666402-171666424 CAACAGAGTGACACCCTGTCTGG + Intergenic
984191337 4:176609567-176609589 GAACAGAGGGAAAGTCTGTGTGG + Intergenic
984712168 4:182895094-182895116 CAACAGAACGAGACCCAGTCTGG - Intronic
984765909 4:183400309-183400331 CAAAAGAGTGAGAATCCGTCTGG - Intergenic
984941109 4:184933070-184933092 CGACAAAGCCAGACTCTGTCGGG - Intergenic
984950999 4:185007735-185007757 CAACAGAGCAAGACTCCGTCTGG - Intergenic
985226608 4:187768140-187768162 CAGCAGAGTGAGACTTCGTCTGG - Intergenic
986013623 5:3738958-3738980 AACAAGAGTGAGACTCTGTCTGG + Intergenic
986231194 5:5866187-5866209 CAACAGAGCAAGACCCTGTTTGG - Intergenic
986631052 5:9774780-9774802 GCACAGAGAGAGACTTTGTCTGG - Intergenic
986692171 5:10322104-10322126 GGACAGAGCGAGACTCGGTCTGG - Intergenic
986874668 5:12093730-12093752 CAACAGAGTGAAACTCTGTTGGG + Intergenic
987071424 5:14340375-14340397 CAACAGAGCAAGACTCCGTCTGG + Intronic
987328634 5:16835155-16835177 CGACAGAGTGAGACTGTCTCGGG + Intronic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
987675720 5:21070418-21070440 CAAAAGGGAGAGACTGTGTCAGG - Intergenic
987710674 5:21498149-21498171 CAACAGAACAAGACCCTGTCAGG - Intergenic
987724783 5:21683986-21684008 TGACAGAGCGAGATTCTGTCTGG + Intergenic
987916601 5:24223293-24223315 CACTAGAGCGAGACTCTGTCTGG - Intergenic
988502761 5:31797431-31797453 CAACAGAGTGAAACCCTGTCTGG + Intronic
989017502 5:36956208-36956230 CAACAGAGTAAGACTCCGTCTGG + Intronic
989036089 5:37173488-37173510 CAACATAGTGAGACTCTGCTAGG - Intronic
989042318 5:37241644-37241666 TGACAGAGTGAGACCCTGTCTGG - Intronic
989360408 5:40595373-40595395 TGACAGAGCAAGACTCTGTCTGG - Intergenic
989391883 5:40909215-40909237 CAACCAAAGGAGACTCTGTAAGG - Intergenic
989751121 5:44895291-44895313 ACAGAGAGGGAGACTCGGTCTGG - Intergenic
990173900 5:53085926-53085948 CAACAGAGCAAGGCTCTGTCTGG - Intronic
990225011 5:53640566-53640588 CAAGAGAGAGAGAATGTGTCAGG + Intronic
991058623 5:62346718-62346740 TAACAGAGCGAGACTGTCTCAGG + Intronic
991193341 5:63902082-63902104 TGACAGAGGGAGACTCTGTCTGG - Intergenic
991761012 5:69917212-69917234 CAACAGAACAAGACCCTGTCAGG - Intergenic
991786318 5:70200889-70200911 CAACAGAACAAGACCCTGTCAGG + Intergenic
991840241 5:70792263-70792285 CAACAGAACAAGACCCTGTCAGG - Intergenic
991878762 5:71201274-71201296 CAACAGAACAAGACCCTGTCAGG + Intergenic
992199380 5:74368766-74368788 TGACAGAGTGAGACTCTGTCTGG - Intergenic
992436593 5:76760705-76760727 CAACAGAGCAAGATTCTGTCTGG + Intergenic
992554507 5:77890242-77890264 TGACAGAGCAAGACTCTGTCTGG - Intergenic
992560080 5:77942817-77942839 CAATAGAGCAAGACCCTGTCTGG + Intergenic
992739112 5:79755304-79755326 CGACAGAGTGAGACTCTGTGTGG - Intronic
992810024 5:80377374-80377396 CAACACAGCAAGACTCTGTCTGG + Intergenic
993330623 5:86595343-86595365 AAACAGAGCAAGACCCTGTCTGG + Intergenic
993960320 5:94289513-94289535 CAACAGAGCAAGACTCCATCTGG + Intronic
994061549 5:95484364-95484386 CAACAGAATGAGATCCTGTCTGG - Intronic
994196822 5:96931174-96931196 CAACAGAGTGAGATCCTGTCTGG - Intronic
994301593 5:98154517-98154539 CAACAGAGCAAGACTCTGACTGG + Intergenic
995146722 5:108795295-108795317 AGCCAGAGGGAGACCCTGTCTGG + Intronic
995522320 5:113021346-113021368 GAACAGAGCAAGACTCTGTCTGG + Intergenic
995793079 5:115914884-115914906 CGACAGAGCGAGACTCCTTCTGG - Intergenic
995864710 5:116678770-116678792 CAACAGAGAGAGACTCTGTCTGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
996371035 5:122752605-122752627 GAAGAGAATGAGACTCTGTCAGG + Intergenic
997066263 5:130563541-130563563 CGACAGAGCGAGACTCCATCTGG - Intergenic
997222098 5:132177950-132177972 CGACAGAGTGAGACTCTCTTGGG - Intergenic
997330989 5:133061637-133061659 CAAGAGAGCAAGACTCAGTCGGG - Intronic
997958463 5:138299171-138299193 TTACAGAGGGAGACTCTGTCTGG + Intronic
998508356 5:142690317-142690339 TGACAGAGTGAGACTCCGTCTGG + Intronic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
998725338 5:145006521-145006543 CAACAGAGCGAGATGCTGTCTGG - Intergenic
998827249 5:146115021-146115043 CAACAGAGCAAGATTCTGTCGGG + Intronic
998835399 5:146198200-146198222 CAACAGAGCAAGACTCTTTCGGG - Intergenic
999978578 5:156936910-156936932 TAAGAGAGCGAGACTCCGTCTGG + Intronic
1000029718 5:157391090-157391112 CAGGAGAGGGAGGCTGTGTCTGG + Intronic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1000158052 5:158571155-158571177 CGACAGAGCAAGACTCGGTCTGG + Intergenic
1000625156 5:163529918-163529940 CAACAGACCAAGACCCTGTCTGG + Intergenic
1001089251 5:168725170-168725192 CAACAGATGGGGACTCCTTCTGG + Intronic
1001472820 5:172026951-172026973 TGACAGAGCGAGACCCTGTCAGG - Intergenic
1002302187 5:178263375-178263397 CATCTGAGGGAGCCTCTCTCTGG - Intronic
1002308991 5:178303018-178303040 CAACAGAGCTAGACTCTGTCAGG - Intronic
1002320487 5:178372590-178372612 CAATAGAGAGAGACTTTGTCTGG - Intronic
1002490333 5:179571482-179571504 CAACAGAGCCAGACTCTGTCTGG + Intronic
1002807367 6:590093-590115 CGACAAAGCGAGACTCTGTCTGG + Intronic
1003076494 6:2987857-2987879 CAACACAGCAAGACTCTGACTGG + Intergenic
1003577051 6:7306895-7306917 CGACAGAGCGAGACTCTGTCTGG + Intronic
1003595710 6:7472442-7472464 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1003652379 6:7973332-7973354 CGACAGAGCAAGACTCTGTCTGG - Intronic
1003885988 6:10521917-10521939 TGACAGAGTGAGACTATGTCTGG - Intronic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004149936 6:13107135-13107157 CAACAGAGCAAGAGTCTGTCTGG - Intronic
1004476078 6:15973510-15973532 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1004736085 6:18408002-18408024 CAACAAAATGAGATTCTGTCTGG - Intronic
1005082823 6:21973990-21974012 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1005400685 6:25430447-25430469 CAACAGTGCGAGACCCTGTCTGG - Intronic
1005515103 6:26547254-26547276 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1005547013 6:26882361-26882383 CAACAGAACAAGACTCTGTCAGG + Intergenic
1005570862 6:27144440-27144462 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1005919321 6:30385182-30385204 CAACAGAGTGAGACTTCATCTGG + Intergenic
1006176427 6:32124865-32124887 CAAAAGAGCAAGACTCCGTCTGG - Intronic
1006259912 6:32859030-32859052 TGACAGAGAGAGACCCTGTCTGG + Intronic
1006506942 6:34495470-34495492 TGACAGAGTGAGACTCCGTCTGG - Intronic
1006535122 6:34693372-34693394 CGACAGAATAAGACTCTGTCTGG - Intronic
1006548425 6:34799468-34799490 TGACAGAGTGAGACCCTGTCTGG + Intronic
1006584099 6:35094418-35094440 CAAAAGAGTGAGACTTCGTCTGG + Intergenic
1006674932 6:35755907-35755929 CATCAGAGGGAAACTCTGATTGG - Intergenic
1006768455 6:36530265-36530287 CGACAGATCGAGATTCTGTCAGG + Intronic
1006885621 6:37379931-37379953 CGACAGAGTGAGACACTGTCTGG - Intronic
1007471004 6:42090346-42090368 CAACAGAGTGAGACTTCATCTGG + Intergenic
1007542500 6:42660945-42660967 CAACGGAGCGAGACCCTGTGTGG + Intronic
1007611554 6:43152505-43152527 CGACAGAGTGAGACTCCGTCTGG + Intronic
1007792582 6:44320127-44320149 CAACAGAGCGAGACTCTGTCTGG + Intronic
1008132766 6:47737747-47737769 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1008540067 6:52538510-52538532 CAACTGAAGGAGGCTCTGTGGGG - Intronic
1008826530 6:55701454-55701476 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1009017772 6:57923438-57923460 CAACAGAACAAGACCCTGTCAGG + Intergenic
1009283431 6:61780469-61780491 CGACAGAGCCAGACTCTTTCTGG + Intronic
1009907217 6:69884874-69884896 CAACAGAGCGAGACTCAGTCTGG - Intronic
1010181167 6:73088039-73088061 CAACAGAGTGAAACTCCATCTGG - Intronic
1010245051 6:73654508-73654530 CAACAGAGCAAGACCCTGCCTGG - Intergenic
1011056226 6:83206102-83206124 CGACAAAGCGAGACTCCGTCTGG + Intergenic
1011075508 6:83434323-83434345 CAACAGCGTGAGACTCTGTTGGG - Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1012106339 6:95164914-95164936 TGACAGAGTGAGACTCTGTTAGG - Intergenic
1012234801 6:96801227-96801249 AACAAGAGTGAGACTCTGTCTGG - Intronic
1012261350 6:97091187-97091209 CAATAGAGCGAGACCCTGTCTGG + Intronic
1012265529 6:97137552-97137574 CGACAGAGTGATACTCCGTCTGG - Intronic
1012429576 6:99150540-99150562 CAAAAGAGTGACACTCTGTTGGG + Intergenic
1012555161 6:100502523-100502545 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1013019520 6:106198754-106198776 TGACAGAGCGAGACCCTGTCTGG + Intronic
1013052921 6:106554590-106554612 CAACAGAGCAAGACTGTCTCAGG + Intronic
1013209023 6:107970338-107970360 CCAGAGAGTGAGACCCTGTCTGG - Intergenic
1013266247 6:108502044-108502066 CAACAGAGTGAGACTCTGTCTGG - Intronic
1013295736 6:108756850-108756872 TGACAGAGAAAGACTCTGTCTGG - Intergenic
1013931124 6:115534392-115534414 CAACAGAGTGAGACCCCGTCTGG - Intergenic
1014319710 6:119911771-119911793 TGACAGAGCGAGACTCTGTCTGG + Intergenic
1015116353 6:129654021-129654043 TGACAGAGCGAGACCCTGTCTGG + Intronic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1015338889 6:132074789-132074811 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1015610805 6:135015902-135015924 CAACAGAACAAGACTCCGTCTGG - Intronic
1015764361 6:136700052-136700074 TGACAGAGCGAGACTCTGTCAGG + Intronic
1015950417 6:138547398-138547420 CAACAGAGTGAGACCCTCTCAGG - Intronic
1016368070 6:143340478-143340500 CGACAGAGTGAGACTCCATCTGG - Intergenic
1016381874 6:143492386-143492408 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1016678427 6:146799511-146799533 CAACAGAGCAAGACTCTGGGGGG + Intronic
1016827364 6:148400729-148400751 CGACAGAGTGAGACTTTGTCTGG + Intronic
1016910866 6:149197692-149197714 CAAAAGAGGGAGACTCTAAATGG - Intergenic
1017047217 6:150357954-150357976 CAACTGAGAGAGACACTGGCTGG - Intergenic
1017096560 6:150810287-150810309 TGACAGAGTGAGACCCTGTCTGG - Intronic
1017290336 6:152728142-152728164 CAACAGAGTGAGCCTCTGTCTGG + Intergenic
1017334371 6:153237941-153237963 GAAGAGAGGGAGATTCTTTCAGG - Intergenic
1017471713 6:154744270-154744292 CAACAGAGCAAGACTCTGGCTGG + Intronic
1017566995 6:155697989-155698011 TGACAGAGTGAGACACTGTCTGG + Intergenic
1017798192 6:157866552-157866574 TGACAGAGTGAAACTCTGTCTGG + Intronic
1017936527 6:159010345-159010367 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1018086513 6:160305544-160305566 CAACTGAGCAAGACCCTGTCTGG + Intergenic
1018188468 6:161288205-161288227 TGACAGAGTGAGACTCTATCTGG - Intergenic
1018359959 6:163057433-163057455 TGACAGAGTGAGACTCTGTCTGG - Intronic
1018693601 6:166370809-166370831 CAACAGAGCAAGACCCTGTCTGG + Intronic
1019424919 7:970152-970174 CAATAGAGCGAGACTGTTTCTGG - Intronic
1019569288 7:1702401-1702423 CGACAGAACGAGACTCCGTCGGG + Intronic
1019695360 7:2442939-2442961 CGAAAGAGCAAGACTCTGTCTGG - Intergenic
1019720638 7:2568509-2568531 GAGCAAAGGGAGACCCTGTCTGG - Intronic
1019822621 7:3256861-3256883 CAACAGAGTGAAGCCCTGTCTGG + Intergenic
1019885514 7:3901205-3901227 TGACAGAGCAAGACTCTGTCGGG - Intronic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020185065 7:5952757-5952779 CAACAGAGAAAGACTCCGTCTGG - Intronic
1020213923 7:6174565-6174587 CAGCAGAGCGAGACTCTGTCTGG - Intronic
1020297851 7:6771987-6772009 CCACAGAGAAAGACTCCGTCTGG + Intronic
1020628348 7:10610560-10610582 CAACAGAGCGAGACTGCGTCTGG - Intergenic
1020995398 7:15257256-15257278 CAACATAGGAAGACTATCTCAGG + Intronic
1021703209 7:23340867-23340889 CGACAGAGCGAAACTCTGTCTGG - Intronic
1021712900 7:23434056-23434078 AGACAGAGTGAGACTCTGTCTGG + Intronic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023476729 7:40587920-40587942 CGGCAGAGTGAGACTCTGTCTGG - Intronic
1023975983 7:45030454-45030476 AAACAGAGTGAGACCCTGTCTGG - Intronic
1024011452 7:45270552-45270574 CAACATAGTGAGACTCCATCTGG - Intergenic
1024036750 7:45513126-45513148 CAATAGAACGAGACTCTTTCTGG + Intergenic
1024257188 7:47547918-47547940 CGACAGAGTGAGACTCCGTCAGG - Intronic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1024486014 7:49920573-49920595 GAACAGAGAGAGACTCTGCTTGG + Exonic
1024625289 7:51203019-51203041 TGACAGAGCGAGACTCTGTCTGG + Intronic
1024705776 7:51958544-51958566 GAACAGAGAGATACTCTGTTTGG - Intergenic
1025241354 7:57278827-57278849 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1025722332 7:64027894-64027916 CAACAGAGCAAGACTCCATCTGG + Intergenic
1026004024 7:66586734-66586756 CGACAGAGTGAGACTCAGTCTGG - Intergenic
1026460466 7:70610453-70610475 CAACAGAATGAGACTCTGTCAGG - Intronic
1026472946 7:70709690-70709712 CAACAGAGCAAGATTCTGTCTGG + Intronic
1026503051 7:70959298-70959320 TGACAGAGTGAGACACTGTCTGG - Intergenic
1026618080 7:71925219-71925241 CAACACAGTGAGACTCTGAGGGG + Intronic
1026629562 7:72026563-72026585 CGACAGAGCAAGACTCTGTCTGG + Intronic
1026708666 7:72717279-72717301 CAACAGGGCAAGACCCTGTCTGG + Intronic
1026771976 7:73208003-73208025 CAACAGAGCAAGACTGTCTCAGG - Intergenic
1026835656 7:73637453-73637475 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1026954097 7:74365964-74365986 CAACATAGCGAGACCCTGCCTGG - Intronic
1026956466 7:74379307-74379329 CAACAGAGGGAGACTCCGTCTGG + Intronic
1026981230 7:74527819-74527841 CAACAGAGCAAGACTCCATCAGG + Intronic
1027012844 7:74761395-74761417 CAACAGAGCAAGACTGTCTCAGG - Intergenic
1027075196 7:75184653-75184675 CAACAGAGCAAGACTGTCTCAGG + Intergenic
1027120031 7:75510526-75510548 AGACAGAGTAAGACTCTGTCTGG - Intergenic
1027160346 7:75797845-75797867 CAACAAAGCAAGACTCTGGCTGG - Intergenic
1027198895 7:76050049-76050071 CAACAGAGTGGGACTCTGTCAGG - Intronic
1027222192 7:76221075-76221097 CAACAAAGTGAGACCTTGTCTGG - Intronic
1027478409 7:78663224-78663246 CGAGAGAGTGAGACTGTGTCTGG - Intronic
1027800456 7:82743730-82743752 CAACAGAACAAGACTCTGTCTGG + Intergenic
1028038705 7:86019616-86019638 AGACAGAGTGAGACTCTGTCTGG + Intergenic
1028397619 7:90389405-90389427 CAAGAGAGCGAGACTCCGTCTGG - Exonic
1028443860 7:90895578-90895600 AGACAGAGCAAGACTCTGTCAGG - Intronic
1028545363 7:91993206-91993228 CAACAGAGCAAGACCCTGTATGG - Intronic
1028592334 7:92511157-92511179 CAGCAGAGTGAGACCCTGTTGGG - Intronic
1028716575 7:93978089-93978111 CAACAGAGTGACACCCTGTCTGG - Intronic
1029008059 7:97230737-97230759 TGACAGAGCGAGACTCCGTCCGG - Intergenic
1029030498 7:97461530-97461552 CAACGGAGTGAGACTCTGTCTGG + Intergenic
1029134752 7:98361335-98361357 CGACAGAGCAAGACTCTGTCTGG + Intronic
1029161594 7:98556223-98556245 CAACAGAGACAGACTGTTTCAGG + Intergenic
1029233750 7:99094901-99094923 AAACTGAGGGAGCCTCTGGCTGG - Intronic
1029561433 7:101305547-101305569 TGACAAAGAGAGACTCTGTCTGG - Intergenic
1029625829 7:101719591-101719613 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1029646767 7:101861852-101861874 CCACAGAGGGAGACTCCGGGAGG - Intronic
1029733648 7:102453746-102453768 CGACAGAGTGAGACTCTATCTGG - Exonic
1029802541 7:102964420-102964442 CAACAGAGAGAGACTCAGTCTGG - Intronic
1029811585 7:103054368-103054390 CAGCAGAGCAAGACTCCGTCTGG + Intronic
1030048806 7:105520850-105520872 CAACACAGCGAGACCCTGTGTGG + Intronic
1030348480 7:108457685-108457707 GAACCGAGGGAGGCTCTGTGAGG - Intergenic
1030652169 7:112128007-112128029 CAACAGAGCGAGACTCTGTCGGG + Intronic
1030832234 7:114238750-114238772 CGACAGAGCTAGACTCTATCTGG + Intronic
1032164433 7:129534279-129534301 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1032248509 7:130233024-130233046 CAACAGAGTGAGACTCCATCTGG - Intergenic
1033114804 7:138615773-138615795 CGACAGAGTGAGACTCCGTCTGG + Intronic
1033138622 7:138805373-138805395 CAACAAAGTGAGACCCTGTCTGG + Exonic
1033507942 7:142024392-142024414 CGACAGAGTGAGACCCTGTCTGG + Intronic
1033541146 7:142357247-142357269 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1033989199 7:147263339-147263361 TGACAGAGGGAGACCCTGCCTGG + Intronic
1034079714 7:148265291-148265313 TGACAGAGTGAGACCCTGTCTGG - Intronic
1034086748 7:148328954-148328976 CGACAGAGCAAGACTCTGTCTGG + Intronic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034179888 7:149128819-149128841 CAACAGAGCAAGACTACGTCTGG - Intronic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034578450 7:152021909-152021931 CGACGGAGTGAGACTCCGTCAGG + Intergenic
1035005983 7:155661425-155661447 CCACAGAGCAAGACTCTGTCTGG - Intronic
1035772412 8:2158389-2158411 CAACAGAGCGAGAATCTGTCAGG - Intronic
1035795853 8:2355778-2355800 GCACAGAGGGAGACTCCGTGTGG + Intergenic
1035795875 8:2355857-2355879 GCACAGAGGGGGACTCTGTGTGG + Intergenic
1036157478 8:6355982-6356004 CAACAGAGCAAGACTCCATCTGG + Intergenic
1036381614 8:8239619-8239641 TGACAGAGCGAGAGTCTGTCAGG - Intergenic
1036404884 8:8445906-8445928 CGACAGAGTGAGACCCTGTCTGG + Intergenic
1036605885 8:10305431-10305453 CAACAGAGCAAGACTCCATCCGG - Intronic
1037174645 8:15932598-15932620 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1037317119 8:17609453-17609475 CGACAGAGCGAGACTCTGTCTGG + Intronic
1037634246 8:20686520-20686542 TGACAGAGCGCGACTCTGTCTGG + Intergenic
1037847322 8:22295057-22295079 CAACAGAGCGAGACTTCGTCTGG + Intronic
1037856750 8:22376856-22376878 CAACAGAGTGAGACAATGTCTGG + Intronic
1037942236 8:22960336-22960358 CAACAGAGCAAGACTCTGTCAGG - Intronic
1038095105 8:24300434-24300456 CGACAGAGCGAGACTCTGTCTGG - Intronic
1038136288 8:24789928-24789950 CAACAGAGTGAGACTCTGACTGG - Intergenic
1038265105 8:26033240-26033262 TGACAGAGCCAGACTCTGTCTGG - Intronic
1038281216 8:26166806-26166828 TAACAGAGTGAGACCCTGTCTGG + Intergenic
1038631693 8:29251129-29251151 CAACGAGGGGAGACCCTGTCTGG + Intronic
1038842148 8:31194882-31194904 CAGCTGAGGGCCACTCTGTCTGG - Intergenic
1039231533 8:35454104-35454126 CAAAAGAGGGAAAGTCTGTCAGG - Intronic
1039266904 8:35834906-35834928 CAACAAAGCGAGATTCCGTCTGG + Intergenic
1039449939 8:37664693-37664715 CAGCAGAGTGAAACCCTGTCTGG - Intergenic
1039991909 8:42495767-42495789 CAACAGAACAAGACTCTGTCTGG - Intronic
1040073672 8:43208224-43208246 CTACACAAGGACACTCTGTCAGG - Intergenic
1041075713 8:54167751-54167773 CAACAGAGCTAGACTCTCTCTGG + Intergenic
1041174181 8:55177054-55177076 TAACAGAGCAAGACTCTGTCTGG - Intronic
1041314446 8:56546696-56546718 CAACAGAGCAAAACTCCGTCTGG - Intergenic
1041646940 8:60262662-60262684 CAACATAGTGAGACCCTTTCAGG + Intronic
1042143566 8:65704024-65704046 CAACATAGGGAAACCCTATCTGG + Intronic
1042557393 8:70044803-70044825 CAACAGAGCCAGACTCCGTCTGG - Intergenic
1042562594 8:70084209-70084231 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1042727100 8:71890130-71890152 GACAAGAGCGAGACTCTGTCTGG - Intronic
1042945101 8:74146436-74146458 CAACACAGGGCGACTCTGATGGG - Intergenic
1043110567 8:76175087-76175109 CAACAGAGCGAGACTCTTTCTGG - Intergenic
1043352317 8:79376373-79376395 CAGGAGATGGAGACTGTGTCCGG + Intergenic
1043413453 8:80024207-80024229 CAACAGAGCAAGACCCTGTCTGG + Intronic
1043653832 8:82635671-82635693 TGACAGAGGGAGACTCTGTCTGG + Intergenic
1043673916 8:82925369-82925391 CGACAGAGAGAGACTCAGTCTGG - Intergenic
1044111428 8:88280055-88280077 CTACAGAGGGAGACTCCGCTTGG - Intronic
1044241062 8:89889041-89889063 CAACAAAGTGAGACCCTGTGTGG + Intergenic
1044434921 8:92150806-92150828 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1044777584 8:95707951-95707973 CAATAGAGGGAGTCTATTTCTGG + Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1044973152 8:97639317-97639339 CGACAGAGTGAGACCTTGTCTGG - Intergenic
1045015476 8:97997837-97997859 CAATAGAATGAGATTCTGTCTGG - Intronic
1045764027 8:105646029-105646051 CAACAGAGTGAGACTCCATCTGG + Intronic
1045804957 8:106148524-106148546 CAGCAGATGGTGACTCTTTCTGG - Intergenic
1046757878 8:117990200-117990222 GAAGAGAGGGAGACCCAGTCTGG - Intronic
1047281048 8:123446011-123446033 TGACAGAGTGAGACTCTGTCTGG - Intronic
1047338101 8:123955247-123955269 CAACAGAGCAAGACTCCATCTGG + Intronic
1047410042 8:124617063-124617085 CAACAGATGGAAATGCTGTCTGG + Intronic
1047523888 8:125616163-125616185 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1047744403 8:127833476-127833498 CGACAGAGCAAGACCCTGTCTGG - Intergenic
1048337487 8:133513877-133513899 TAACAGAGCAAGACTCTGTCTGG + Intronic
1049117096 8:140698471-140698493 TGACAGAGTCAGACTCTGTCTGG - Intronic
1049137554 8:140917320-140917342 CGACAGAGCAAGACTCTGCCAGG + Intronic
1049677328 8:143896909-143896931 CAACAGAACAAGACCCTGTCTGG - Intergenic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1049979523 9:891532-891554 CGACAGAGCAAGACTCCGTCTGG - Intronic
1050383953 9:5064134-5064156 CGACAGAGCAAGACTCTGACTGG + Intronic
1050562504 9:6848647-6848669 CGACAGAGTGAGACTGTCTCAGG + Intronic
1050573294 9:6964932-6964954 CTACAGAGTGAGACTTCGTCGGG + Intronic
1050601851 9:7260894-7260916 CAACAGAGGAAGACCCTCTTTGG - Intergenic
1051306836 9:15718617-15718639 CAGCACAGAGAGACTCTGTTTGG + Intronic
1051319560 9:15887126-15887148 CAAAAGAGGGTAACTCTGTGAGG + Intronic
1051650941 9:19323408-19323430 CGACAGAGCTAGACTCTGTCTGG + Intronic
1051748757 9:20319773-20319795 CCACAGAGGGAGTGCCTGTCTGG - Intergenic
1051755019 9:20389757-20389779 CAACACAGTGAGACCCCGTCCGG + Intronic
1051936529 9:22448126-22448148 CAACAGAGTGAGATCCTGTCTGG - Intronic
1052947619 9:34180828-34180850 CAACAGACCGAGACTCCCTCTGG - Intronic
1053028125 9:34748523-34748545 CAGCATAGAGAGACTCTGTTTGG + Intergenic
1053358609 9:37466906-37466928 CAACAGAGTGAGATTTCGTCTGG + Intergenic
1053432414 9:38051780-38051802 CATCAGAGGGCCACTCTGACCGG - Intronic
1053882202 9:42607364-42607386 TGACAGAGTGAGACTCTATCTGG - Intergenic
1054221227 9:62414833-62414855 TGACAGAGTGAGACTCTATCTGG - Intergenic
1054229487 9:62494340-62494362 TGACAGAGTGAGACTCTATCTGG + Intergenic
1054913916 9:70478770-70478792 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1055092263 9:72375062-72375084 TGACAAAGTGAGACTCTGTCTGG - Intergenic
1055092269 9:72375126-72375148 TGACAAAGTGAGACTCTGTCTGG - Intergenic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1055214398 9:73840820-73840842 CGACAGAACGAGACTCTGTCTGG + Intergenic
1055311852 9:74991161-74991183 CGACAGAGCGAGACTCCCTCTGG - Intronic
1055595597 9:77861983-77862005 GGACAGAGCAAGACTCTGTCTGG + Intronic
1056165018 9:83932604-83932626 CAACAGAAGGAGACTCTGTCTGG + Intergenic
1056256996 9:84809860-84809882 CAACAGAGCAATACTCTGTCTGG + Intronic
1056394607 9:86170094-86170116 CGACAGAGTGAGACTCTGCCTGG - Intergenic
1056527806 9:87459509-87459531 TGACAGAGTGAGACTCCGTCTGG + Intergenic
1056537393 9:87541527-87541549 CAACAGAGCAAGACTCTGTCTGG + Intronic
1056637224 9:88341343-88341365 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1056987991 9:91382341-91382363 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1057134006 9:92673831-92673853 CGATAGAGTGAGACTCCGTCTGG + Intergenic
1057308510 9:93926575-93926597 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1057365612 9:94417874-94417896 TGACAGAGCAAGACTCTGTCGGG - Intronic
1057620465 9:96630111-96630133 CCACAGAGTGAGACTCTATCGGG + Intergenic
1057657721 9:96970202-96970224 TGACAGAGCAAGACTCTGTCGGG + Intronic
1057804700 9:98211815-98211837 TGACAGAGCGAGACTCTCTCAGG - Intronic
1058458057 9:105156530-105156552 CAACAGAGTGAGACTCCATCTGG + Intergenic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1058891681 9:109366456-109366478 CAACAGAGCCAGACCCTGTCTGG - Intergenic
1059079612 9:111234183-111234205 CAACAGAGTGAGACCCTATCAGG + Intergenic
1059132987 9:111774316-111774338 TGACAGAGTGAGACCCTGTCTGG - Intronic
1059262112 9:112987733-112987755 TAACAGAGCAAGACTCTGTCTGG - Intergenic
1060089177 9:120728122-120728144 TGACAGAGTGAGACTCCGTCTGG - Intergenic
1060470503 9:123944107-123944129 CAACAGAGCAAGACTGTGTCAGG + Intergenic
1060648282 9:125301466-125301488 CAACAAAGCAAGACTCTGTCTGG - Intronic
1060775431 9:126370400-126370422 CAACAGAACGAGACTCTGTCTGG - Intronic
1060913298 9:127368348-127368370 CTACAGAGCTAGACTCTATCTGG - Intronic
1061334568 9:129923556-129923578 TGACAGAGCGAGACTCTGTCTGG + Intronic
1061556414 9:131372736-131372758 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1061568922 9:131463959-131463981 CAACAGAGCGAGACTCCATCTGG - Intronic
1061660082 9:132124265-132124287 TAACAGAGTGAGATCCTGTCTGG + Intergenic
1061705745 9:132451822-132451844 CGACAGAGTGAGACTCCTTCTGG - Intronic
1062002359 9:134222846-134222868 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1062043572 9:134415142-134415164 CCACACAGGGAGACTCAGGCGGG - Intronic
1062593490 9:137286419-137286441 CAACCGAGTGAAACTCTGTCTGG - Intergenic
1062719476 9:138029628-138029650 CGACAGAGCGAGACCCTGTCTGG - Intronic
1185602363 X:1349025-1349047 CAACAGAGCAAGACCGTGTCAGG - Intronic
1185713632 X:2324035-2324057 TAACAGATGGAGACCCTGTCTGG + Intronic
1185767703 X:2739066-2739088 CAACATAGTGAGACCCTGTCTGG - Intronic
1186291328 X:8103037-8103059 AAACAGAGGAAAAGTCTGTCTGG - Intergenic
1186512471 X:10140258-10140280 TGACAGAGTGAGACCCTGTCTGG - Intronic
1186829384 X:13375707-13375729 CAACAGAGCGGGACCCTGTCTGG - Intergenic
1187091503 X:16101755-16101777 CAGCAGGGTCAGACTCTGTCTGG + Intergenic
1187134528 X:16534322-16534344 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1187315246 X:18186945-18186967 CAACAGAGCAAGACCCTGTCTGG + Intronic
1187390219 X:18881388-18881410 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1187468493 X:19547133-19547155 CAAAAGAGTGGGACCCTGTCTGG + Intronic
1187717128 X:22113967-22113989 CAATAGAGTGAGACTCTGTCTGG - Intronic
1188721412 X:33527955-33527977 ACACAGAGAGAGACTCTGTCTGG - Intergenic
1188846179 X:35075780-35075802 GAACAGAGAGAGACTCGGTTTGG - Intergenic
1189307527 X:39998006-39998028 CGACAGAAGTAGACCCTGTCTGG + Intergenic
1189341345 X:40206864-40206886 CGACAGAGTGAGACGCCGTCTGG + Intergenic
1189365553 X:40385196-40385218 AAACAGTGGGAGACTCTTTCTGG + Intergenic
1189464782 X:41270088-41270110 CGACAGAGTGAGACCCTGTCCGG - Intergenic
1189493913 X:41492426-41492448 AACAAGAAGGAGACTCTGTCTGG + Intergenic
1189828394 X:44944330-44944352 CAACAGAGTGAAACTCTGTTAGG + Intronic
1190230794 X:48580414-48580436 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1190341651 X:49301609-49301631 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1190489718 X:50969541-50969563 CAACATAGCGAGACTGTGGCAGG - Intergenic
1190642521 X:52494667-52494689 CAACAGAGTGACACTCTGTCTGG + Intergenic
1190645152 X:52518200-52518222 CAACAGAGTGACACTCTGTCTGG - Intronic
1190890587 X:54563764-54563786 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1192302334 X:69918174-69918196 TGACAGAGGAAGACTCTGTCTGG - Intronic
1192331176 X:70176487-70176509 CGACACAGTGAGACTCTGTCTGG + Intergenic
1192467872 X:71370364-71370386 TGACAGAGAGAGACTCTGTCAGG - Intronic
1192595526 X:72403805-72403827 CGACAGAGCCAGATTCTGTCTGG + Intronic
1192790105 X:74373194-74373216 CCACAGAGCGAGACCCTGGCTGG + Intergenic
1193978852 X:88157270-88157292 TGACAGAGCAAGACTCTGTCTGG - Intergenic
1194323981 X:92487957-92487979 CAACAGAGTGAGACGCCATCTGG - Intronic
1194715989 X:97287283-97287305 CAACAGAGTGAAACTCCGTCGGG + Intronic
1195047714 X:101068887-101068909 CAACAGAGCAAGACTCCATCTGG + Intergenic
1195367647 X:104141615-104141637 TGACAGAGTGAGACTCTATCTGG - Intronic
1195511167 X:105716978-105717000 GAACATAGGGAGACCCTGTGTGG + Intronic
1195690455 X:107620033-107620055 TGACAGAGCAAGACTCTGTCTGG - Intergenic
1195865809 X:109431677-109431699 CGACAGAGCTAGACTCTGTCTGG + Intronic
1196369308 X:114957878-114957900 CAACAGAGAAAGACCCTGACTGG + Intergenic
1196421589 X:115527750-115527772 CAACAGAGCAAGACCATGTCTGG + Intergenic
1197191802 X:123655995-123656017 CGACAAAGCAAGACTCTGTCTGG + Intronic
1197555017 X:127942259-127942281 CAACACAGCAAGACCCTGTCTGG + Intergenic
1197731229 X:129812101-129812123 CAACAGAATGAGACTCTGTCTGG - Intronic
1197755265 X:129989484-129989506 CAACAGAGCTAGACTGTCTCCGG - Intronic
1197930282 X:131687698-131687720 CAACAGAGCGAGACTCCATCCGG - Intergenic
1198248155 X:134851514-134851536 CAACAGAGTAAGACTCTGTCTGG + Intronic
1198258160 X:134943219-134943241 CGACAGAGCGAGACTCCGTCTGG + Intergenic
1198375174 X:136031637-136031659 CAACAGAGCGAGACTCTGTCTGG + Intronic
1198869523 X:141161177-141161199 TAACAGGGCAAGACTCTGTCTGG + Intergenic
1198990997 X:142514857-142514879 CCCCAGTGGGAGACTCTGTGTGG + Intergenic
1199020154 X:142869307-142869329 TGACAGAGTGAGACTCCGTCTGG + Intergenic
1199295928 X:146158497-146158519 CAACAGAGCGAGACTCCATCTGG + Intergenic
1201290649 Y:12419019-12419041 CAACAAAGTGAGACTCTCTAGGG + Intergenic
1201342207 Y:12946923-12946945 CAACAGAGTGAGACTCCATCTGG - Intergenic
1201564818 Y:15354866-15354888 CAATAGAGCGAGACTCTGCCCGG + Intergenic