ID: 1119816223

View in Genome Browser
Species Human (GRCh38)
Location 14:77570815-77570837
Sequence GTGTAAAAGCAGATTTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119816223_1119816224 14 Left 1119816223 14:77570815-77570837 CCTAGCAAAATCTGCTTTTACAC 0: 1
1: 0
2: 0
3: 18
4: 205
Right 1119816224 14:77570852-77570874 GCTATGTAAAACAATCTAACTGG 0: 1
1: 0
2: 0
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119816223 Original CRISPR GTGTAAAAGCAGATTTTGCT AGG (reversed) Intronic
903640553 1:24857011-24857033 GTGGAAAACCAGCATTTGCTGGG - Intergenic
905606541 1:39305413-39305435 CTGTTTTAGCAGATTTTGCTGGG + Intronic
905610090 1:39342988-39343010 GTGACAGACCAGATTTTGCTTGG + Intronic
905827333 1:41035816-41035838 GGGTGAAGGCAGATTGTGCTGGG - Intronic
906161877 1:43656051-43656073 GTGCACAAGGAGCTTTTGCTGGG + Intronic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
907754358 1:57296138-57296160 GAGTAAATGCAGATATTGTTGGG + Intronic
908186659 1:61658885-61658907 TTGTAGATGCAGATTTTCCTGGG - Intergenic
909753663 1:79195719-79195741 TTGAAAAGGCAGATTTTCCTTGG + Intergenic
910023173 1:82617857-82617879 ATTTAAAAGCAGATATTTCTGGG - Intergenic
916171887 1:162007627-162007649 GTGTAAAAGCTGACATTGCCAGG + Intronic
919282304 1:195506942-195506964 ATGTAAATGCACATTTTGCCTGG - Intergenic
919312625 1:195930455-195930477 GTGTCAAAGCAGAGTTTCGTGGG + Intergenic
921578207 1:216863111-216863133 GTGTAAAAGCATAGATTGTTGGG + Intronic
922483063 1:225952508-225952530 ATGTAAAAGAAGAGTTTGCAGGG - Intergenic
923391871 1:233520412-233520434 GGGTAAAAGCAGATTCTTCCCGG + Intergenic
924730143 1:246703682-246703704 GTTTTAAAGCAGATTTTGCCCGG - Intergenic
1064314383 10:14241295-14241317 AGGTCAAAGCTGATTTTGCTTGG - Intronic
1064778180 10:18803726-18803748 GTGAAAAAGTAAATTTGGCTTGG + Intergenic
1065019631 10:21494057-21494079 GGGAAAAAGCAGAAGTTGCTGGG - Exonic
1065456653 10:25913179-25913201 TTGTAAAAGCAAATCTTCCTGGG + Intergenic
1065770725 10:29075650-29075672 GTGTAATATTAGATTTTCCTGGG - Intergenic
1066506421 10:36049393-36049415 GAGAAAAAGCAGAGTTTGCTCGG + Intergenic
1067410273 10:46058394-46058416 GTGTAAAAGCAGTGTTGGCCCGG - Intergenic
1068792619 10:61043801-61043823 GTGTACATGTAGATTTTTCTGGG + Intergenic
1070458048 10:76637314-76637336 GTGTATAAGGAAATTGTGCTAGG - Intergenic
1071799033 10:89037423-89037445 GGATAAAAGCAGTTTTAGCTGGG + Intergenic
1072000350 10:91189186-91189208 TTGTAAAAGAAGATTTTGCCAGG - Intronic
1078146733 11:8726817-8726839 TTGGAAAAGCAGTTGTTGCTGGG + Intronic
1078238571 11:9509100-9509122 GTGAAGAAGCAGAGGTTGCTGGG + Intronic
1079143421 11:17829843-17829865 GTATAAAAGCAGATTTGGGTAGG + Intronic
1079686484 11:23365234-23365256 ATTAAAAAGCAGTTTTTGCTTGG - Intergenic
1083028031 11:59566879-59566901 GTGCAAAGGCAGATTTTGCAAGG + Intergenic
1083598516 11:63931936-63931958 GTGTAAATTCAGATTCTTCTGGG + Intergenic
1085634281 11:78146215-78146237 GTGTATCAGCAGGTTTTGCCTGG - Intergenic
1086053108 11:82617250-82617272 GTGCAAAAGCAGACTGGGCTTGG - Intergenic
1088676862 11:112202748-112202770 GTTTAAAAGCATATGTGGCTGGG + Intronic
1088992039 11:114962037-114962059 GTTAAAATGCAGATTTTCCTAGG - Intergenic
1090068928 11:123526951-123526973 GAGAAACTGCAGATTTTGCTTGG + Intronic
1090689481 11:129163439-129163461 CTGGAAAAGCAGTTTTTGTTGGG - Intronic
1091634654 12:2187768-2187790 GAGCAAAAGCCGACTTTGCTCGG + Intronic
1091911847 12:4238817-4238839 GTATAAAAGATAATTTTGCTGGG + Intergenic
1093134131 12:15429773-15429795 GTGTAAGAGGAGACTATGCTAGG + Intronic
1093816591 12:23556532-23556554 GTGGTAAAGCAGATTTTACTAGG - Intronic
1094465167 12:30745757-30745779 GTCTAAAAGCTGATTTTGGGTGG + Intronic
1098718723 12:73867022-73867044 ATGTAAAAGCATATTTTGAGAGG - Intergenic
1099445134 12:82743145-82743167 ATGAAAAAGCAGATGTAGCTGGG + Intronic
1101580145 12:106035631-106035653 GTGAAACAGCAGAGTTTTCTTGG - Intergenic
1102094922 12:110230726-110230748 TTATAAAAACAGATTTTGCATGG + Intergenic
1102922095 12:116799296-116799318 CTTTAAAAGCAGAGTTTTCTTGG - Intronic
1103752628 12:123175878-123175900 TTGTAAGAGAAGATTTTTCTAGG - Intronic
1104334388 12:127879814-127879836 GTGAAAGAACAGACTTTGCTGGG + Intergenic
1106004139 13:25752940-25752962 GTGTGATAGCAGGTTTTACTGGG + Intronic
1106872872 13:34040609-34040631 GCATAAAAGCAGAATTTACTTGG - Intergenic
1107370360 13:39739244-39739266 TTGTAAAAACTGATTTAGCTTGG - Intronic
1108803162 13:54124617-54124639 GTGTAAAATCAAATTTTCCCAGG + Intergenic
1109346078 13:61116081-61116103 GTGCAAAAGAAAAGTTTGCTTGG - Intergenic
1111088743 13:83413758-83413780 GAGTAAAATCAGATTTAGTTGGG + Intergenic
1111694594 13:91607384-91607406 GTGTAAAAGCATATGTAGCAAGG - Intronic
1111898539 13:94171624-94171646 TTGTAAAAAGGGATTTTGCTAGG + Intronic
1113750622 13:112774193-112774215 TTATGAAAGCAGATTTTACTTGG + Intronic
1115477844 14:33833388-33833410 CTGTCAAAGTAGATTTTGGTAGG - Intergenic
1117041977 14:51776099-51776121 ATTAAAAAGCAGATTTGGCTGGG - Intergenic
1118820976 14:69345746-69345768 GTGTATAAGCATATTTTCCTGGG + Intronic
1119601713 14:75981134-75981156 GTGTCTAAACAGGTTTTGCTGGG + Exonic
1119816223 14:77570815-77570837 GTGTAAAAGCAGATTTTGCTAGG - Intronic
1120939246 14:89930957-89930979 GCTTAAAAGCAGTTTTTGTTAGG - Intronic
1121187670 14:91990498-91990520 TTTTAAAAGAAGATTTGGCTGGG + Intronic
1124008523 15:25814411-25814433 GTGTACACGCAGATTTTGTCTGG - Intronic
1124433632 15:29629819-29629841 CTTTAAAAGTAGATTTGGCTGGG + Intergenic
1127480842 15:59375860-59375882 ATATAAAAGCAGTTTTTGCCGGG + Intronic
1128348430 15:66871631-66871653 GTGTAAAAGAACCTTTGGCTAGG + Intergenic
1128734680 15:70046565-70046587 GTTAAAATGCAGATTCTGCTTGG + Intergenic
1128922474 15:71624437-71624459 CTGTAAAAGTAGTTTTTGGTGGG + Intronic
1129640690 15:77374258-77374280 GTCTAATTACAGATTTTGCTAGG + Intronic
1130358411 15:83156852-83156874 ATGTAAAAGCAAAATTAGCTGGG - Intronic
1131824125 15:96303756-96303778 GTGTAATAGCATATCTGGCTTGG + Intergenic
1132902418 16:2264606-2264628 GTGAAAAAGAAGAGCTTGCTAGG - Exonic
1133517826 16:6527005-6527027 GTTTAAAAGCAGATTTAAGTTGG - Intronic
1133539305 16:6733478-6733500 GGGCAATAGCAGAATTTGCTAGG + Intronic
1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG + Intergenic
1138823851 16:60294522-60294544 TTGTAAAAACACATGTTGCTGGG + Intergenic
1138962599 16:62045411-62045433 ATGTAACAGCATATTTTCCTGGG + Intergenic
1140210076 16:72962680-72962702 GTGAAAATGCAGATTCTGATGGG - Intronic
1140533536 16:75688105-75688127 TTGGAAAAGCAGAGTTTTCTTGG + Intronic
1141057378 16:80831113-80831135 GTTCAAAAACAGATTTGGCTGGG + Intergenic
1141313504 16:82938215-82938237 GTGTAAAAACAGCCTTTGCCTGG + Intronic
1141319638 16:82995253-82995275 TTGCAACAGCAGATTTTGCTGGG + Intronic
1142505075 17:358018-358040 GAGAAAAACCAGATTTTACTTGG - Intronic
1144939572 17:18928696-18928718 GTGGAAGAGCAGATTTTTCACGG + Intronic
1146366503 17:32233057-32233079 TTGTTAACACAGATTTTGCTGGG - Intronic
1147680893 17:42244687-42244709 TTGTCAAAGAAAATTTTGCTAGG - Intronic
1149712899 17:58758782-58758804 GTTTAAAAACAGTTTTTGCCGGG + Intronic
1151770001 17:76154482-76154504 GAGTAGAGGCAGATCTTGCTTGG + Intronic
1154309541 18:13256437-13256459 GTTAAAAGGCAGATTTTGATGGG - Intronic
1155763937 18:29604206-29604228 GTTTAACAGAGGATTTTGCTAGG + Intergenic
1157090066 18:44626621-44626643 CTGCAAAAGCTCATTTTGCTTGG + Intergenic
1157098157 18:44706033-44706055 GTGTGAAAGCAGCATTTGGTAGG + Intronic
1158366481 18:56743173-56743195 ATGTAAAAGCAGGTTTTGTCCGG + Intronic
1158930314 18:62318400-62318422 GTGGAAATGCATGTTTTGCTAGG - Intergenic
1159208982 18:65291517-65291539 ATTTAAAAGCATATTTTGTTTGG + Intergenic
1159536419 18:69720291-69720313 GTCTAAAAGGAAAATTTGCTAGG + Intronic
1159637662 18:70825190-70825212 TTGTAAAAGCACATTGTGCCTGG - Intergenic
1163946491 19:20540463-20540485 GTTTAAAATCATCTTTTGCTGGG + Intronic
1165679526 19:37761928-37761950 GTGAAAAAGAAGTTTTTCCTTGG + Intronic
925775293 2:7329405-7329427 GTGGAAAACCACATTTTGATGGG + Intergenic
926923986 2:17968292-17968314 GTGCAAGAGGAGATTTTTCTAGG + Intronic
927548408 2:23975326-23975348 GTGTCAAAGAAGATTATCCTGGG + Intronic
928120474 2:28580417-28580439 GTCTAAAAGCAAAGTTGGCTGGG + Intronic
928623093 2:33110929-33110951 GAGGAAAAGCAGTTTTTCCTGGG + Intronic
930634327 2:53787491-53787513 GCATAAAAGCAGCTTTGGCTTGG - Intronic
931286389 2:60835466-60835488 ATATAAAAACAGATTTTTCTGGG + Intergenic
939760471 2:146171100-146171122 GTGCAAAAGGAGAGTTTACTTGG + Intergenic
942509711 2:176685096-176685118 GTCTGAAAGCAGATTTTCCAAGG + Intergenic
944120346 2:196234010-196234032 GTGTACAAGCAGTTTTAGTTTGG - Intronic
947104144 2:226650547-226650569 GTGTAAACGCTGACTTTGTTGGG - Intergenic
1174271900 20:49375689-49375711 GTTAAAAATCAGATTTGGCTGGG + Intronic
1174562600 20:51442134-51442156 ATTAAAAAGCAGATTTTGCTGGG + Intronic
1178940630 21:36902246-36902268 GGGTGAAAGCAGGTTTTGTTTGG + Intronic
1178982481 21:37276591-37276613 ATGTAAAAGCAGAAGTTGCCAGG - Intergenic
1181924581 22:26348198-26348220 GTGAAAAAGAACATTTGGCTGGG + Intronic
1182512859 22:30831542-30831564 GTCAAGAAGCAGGTTTTGCTAGG - Intronic
1182531967 22:30967730-30967752 GTGAAAAAGCAAAATTTTCTGGG + Exonic
1183862930 22:40682528-40682550 GAGTAAAAGCCCAGTTTGCTAGG + Exonic
951476741 3:23114575-23114597 GTATGAAAGCAGATTGTGGTTGG - Intergenic
951581809 3:24172579-24172601 TTGTAAAAGCATATTCTGCTTGG - Intronic
951601850 3:24385530-24385552 ATTTAAAGGCAGATTATGCTGGG - Intronic
953187104 3:40648267-40648289 GTGTAAAACCAGATGGTGCTTGG + Intergenic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
955453085 3:59091552-59091574 TTGTGAAAGCAAATATTGCTGGG + Intergenic
957449026 3:80351883-80351905 ATATAAAACCAGAATTTGCTTGG + Intergenic
959936317 3:112033038-112033060 GTGAAAAAGCAGCCTTTGGTTGG + Intergenic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
961939784 3:130625055-130625077 ATGTAAAAGCACATATTGTTGGG + Intronic
962524340 3:136223820-136223842 TTGTTAAAGCACAATTTGCTGGG - Intergenic
962934825 3:140070272-140070294 GTGAAAAAGTATATTTTTCTAGG - Intronic
963652851 3:148005975-148005997 GTAAGAAAGCAGATTTTCCTAGG - Intergenic
963937215 3:151067073-151067095 GGGTAAAAAAATATTTTGCTAGG - Intergenic
965370217 3:167852938-167852960 GTGTACAAGCAAATTTTATTAGG - Intergenic
965758401 3:172049250-172049272 GTGTAAATGGAGATTTCCCTAGG + Intronic
965760662 3:172072584-172072606 ATGTCAAAGCAGTTTTTGCTTGG - Intronic
966402189 3:179559381-179559403 TTCATAAAGCAGATTTTGCTGGG + Intergenic
966447573 3:180020347-180020369 GTGTAAAATTAGATTTTATTGGG - Intronic
970001753 4:11371990-11372012 GTGAAAAAGAAGAGCTTGCTGGG + Intergenic
972103617 4:35453617-35453639 GTGTAACAGCAGAAGTTGGTAGG + Intergenic
973088660 4:46102975-46102997 GTGTAAACCAAGATTTTCCTTGG - Intronic
973681653 4:53326967-53326989 TTATAAAGACAGATTTTGCTTGG - Intronic
973803474 4:54500985-54501007 GTGAAAAAGAAGATTCTGTTTGG - Intergenic
973859868 4:55052519-55052541 CTGTAAAAACAGGTCTTGCTAGG + Intergenic
974791278 4:66693166-66693188 TTGTAATAGGAGATGTTGCTAGG - Intergenic
976125384 4:81828777-81828799 TTTCAAAAGCAGATTTTGATAGG + Intronic
976190256 4:82480232-82480254 GTGTAAAGGCAGACCTTGTTAGG + Intergenic
976777343 4:88720933-88720955 TTCTAAAAGCTGATTTTCCTGGG + Intergenic
976870191 4:89782904-89782926 GTGTAAAAGCAAAATTTGTTTGG - Intronic
977287760 4:95130313-95130335 GTGTAAAACCAGAATTTCTTAGG + Intronic
978396480 4:108285944-108285966 GTGTATGAGCACATTTTTCTAGG + Intergenic
978862008 4:113461483-113461505 GTGAAAATGCAGAGTATGCTTGG + Intronic
979403368 4:120279004-120279026 CTGTGAAAGCAGATTTTGTTGGG + Intergenic
980555403 4:134397061-134397083 TTGTAAAAGATAATTTTGCTGGG - Intergenic
981043538 4:140245202-140245224 GTGTAAATGTAGATTTTGGCAGG - Intergenic
982345549 4:154353792-154353814 TTGTAAAAACAGAATTTCCTGGG + Intronic
985012218 4:185594868-185594890 GGGTAAAATCAGAATTTGCATGG + Intronic
985245208 4:187973580-187973602 GTTGAAAAGCAAATTATGCTTGG - Intergenic
985266344 4:188154972-188154994 GTGGAGAAGCAGATTCCGCTTGG - Intergenic
985282244 4:188298967-188298989 GAGTAAAAGCTGATTGTGATAGG - Intergenic
986690049 5:10306838-10306860 GAGAAAAAGCAGATTCTGCAGGG - Intronic
990097674 5:52137238-52137260 GTGGCAAAGCAGATGTTCCTTGG + Intergenic
992408607 5:76483426-76483448 ATTTAAAAGCTGAATTTGCTGGG - Intronic
992422892 5:76624776-76624798 CTGAAAAAGCAGACTTGGCTGGG + Intronic
992697600 5:79305551-79305573 GGGTAAATGAAGATTTAGCTTGG + Intronic
993489577 5:88530561-88530583 GTTTGAAAGCTGTTTTTGCTGGG + Intergenic
994134031 5:96264069-96264091 GTATGAAAGCTAATTTTGCTAGG - Intergenic
994582310 5:101659495-101659517 GGGTAAAAGTAGACTTTTCTTGG + Intergenic
995369669 5:111405172-111405194 GTTTAAAAGAAAATTTGGCTGGG + Intronic
996757459 5:126949705-126949727 ATTCAAAAGCAGATGTTGCTAGG + Intronic
999486854 5:152005320-152005342 GGGTAAAGGCTGATTTTGCCGGG - Intergenic
1003042594 6:2701796-2701818 GTTAAAGAGCAGATTTTGATTGG - Intronic
1005499948 6:26421099-26421121 ATGTAGAGGGAGATTTTGCTGGG - Intergenic
1006684465 6:35821006-35821028 GTTAAAATGCAGATTCTGCTGGG + Intronic
1008368543 6:50709229-50709251 GTGGAAAAGAAGAGTATGCTGGG - Intergenic
1009541846 6:64969743-64969765 GTGTGAAGGAAGACTTTGCTTGG - Intronic
1012140330 6:95618922-95618944 GTGTAAAAGAAGGCCTTGCTGGG - Intergenic
1013605629 6:111745009-111745031 TAGCAAAAGCAGATTTTTCTGGG - Intronic
1014377906 6:120699830-120699852 ATGAAAAAGCTGATTTTGCATGG + Intergenic
1017273915 6:152543261-152543283 TTGCAAAAACAGATTTTACTAGG + Intronic
1021790388 7:24198778-24198800 GTGTAAAATTATATTTTACTTGG - Intergenic
1022159113 7:27691347-27691369 GTGTAAAGGCAGATATTGGCAGG - Intergenic
1023418709 7:39955561-39955583 GTGAAAAATCAGCTTCTGCTTGG + Intronic
1029812935 7:103067507-103067529 TTATAAAAGGAGATTTTACTTGG + Intronic
1030066839 7:105666163-105666185 GTGTAAAAGTGTGTTTTGCTGGG - Intronic
1031337644 7:120555626-120555648 GTGTAAAAGCAGACTTTATGTGG + Intronic
1031350427 7:120723915-120723937 GTGTAGAACCAGGTTATGCTGGG + Intronic
1032211717 7:129921400-129921422 ATTTAAAAGCTGATTTTGCCGGG + Intronic
1032293688 7:130614905-130614927 GGGTAAATGAAGATTTTCCTAGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039159932 8:34606425-34606447 GTATAAAGGCAAATATTGCTAGG + Intergenic
1039260061 8:35761778-35761800 GTGTGAATGCATATTGTGCTTGG + Intronic
1039584625 8:38695713-38695735 GTGGGAAACCAGATTTTGGTGGG + Intergenic
1039642171 8:39235622-39235644 GTGTAAAAACAAATTTTACTGGG + Intronic
1040691180 8:49940363-49940385 GCGAAAAAGTAGATTTTCCTGGG + Intronic
1041010200 8:53534200-53534222 ATGTGAAAGGAGATTTTGCAAGG + Intergenic
1043047507 8:75345440-75345462 GTGCAAATGTAGATTTTTCTAGG + Intergenic
1043744943 8:83862631-83862653 GGGAAAAATCAGATTTTGCTGGG + Intergenic
1044435465 8:92157406-92157428 GATTAAAAACATATTTTGCTGGG - Intergenic
1045028168 8:98109594-98109616 CTCTAAAAGAAGAGTTTGCTGGG - Intronic
1045770514 8:105733211-105733233 GTGTGAAAGCAGAGTTTGCAGGG - Intronic
1046026953 8:108736036-108736058 GTTTAAAAGCAGAAAATGCTTGG - Intronic
1046041961 8:108916394-108916416 GTGTAAAAATTGAGTTTGCTGGG - Intergenic
1048284611 8:133132105-133132127 ATGCAAAAGCAGTTTTGGCTAGG - Intronic
1049046298 8:140154657-140154679 GTGTAAGACCAGGTTTTTCTGGG - Intronic
1051723474 9:20064384-20064406 TTCTAAAATCAGATTGTGCTTGG + Intergenic
1051824083 9:21199097-21199119 GTGTAAGAGCAGCTTTAGATGGG - Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056035648 9:82602049-82602071 GTGTAAAATAAGATTTTTGTAGG + Intergenic
1056484107 9:87036944-87036966 GTTCAAAAGCAGATTCTGATAGG + Intergenic
1059959789 9:119553781-119553803 GTGTAAAAGCATGTTATACTTGG + Intergenic
1188666765 X:32832676-32832698 GTGTAAAAGCACATGCTGCAGGG - Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189033563 X:37473630-37473652 GTGTACAAGCAGATTTTTAAAGG - Intronic
1194188413 X:90804496-90804518 GTGGAAAAGCAGATAAGGCTTGG + Intergenic
1196032245 X:111103350-111103372 GTGGAAAAGCAGCATTTGCCTGG - Intronic
1196432262 X:115639118-115639140 TAGTAAATACAGATTTTGCTGGG + Intronic
1199395538 X:147333616-147333638 ATGGAAAAGAACATTTTGCTAGG - Intergenic
1200535002 Y:4386401-4386423 GTGGAAAAGCAGATAAGGCTTGG + Intergenic