ID: 1119826803

View in Genome Browser
Species Human (GRCh38)
Location 14:77663539-77663561
Sequence CTGTGTTAGGTGAATGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119826803_1119826807 24 Left 1119826803 14:77663539-77663561 CCTGTTACATTCACCTAACACAG No data
Right 1119826807 14:77663586-77663608 AGTTGCTGGATGAATAACAAGGG No data
1119826803_1119826805 10 Left 1119826803 14:77663539-77663561 CCTGTTACATTCACCTAACACAG No data
Right 1119826805 14:77663572-77663594 CACAGATGCTCAGTAGTTGCTGG No data
1119826803_1119826806 23 Left 1119826803 14:77663539-77663561 CCTGTTACATTCACCTAACACAG No data
Right 1119826806 14:77663585-77663607 TAGTTGCTGGATGAATAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119826803 Original CRISPR CTGTGTTAGGTGAATGTAAC AGG (reversed) Intergenic
No off target data available for this crispr