ID: 1119827291

View in Genome Browser
Species Human (GRCh38)
Location 14:77668011-77668033
Sequence GCACCTTGGAAGTTCAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119827291_1119827294 8 Left 1119827291 14:77668011-77668033 CCTGCTTTGAACTTCCAAGGTGC No data
Right 1119827294 14:77668042-77668064 CAGGCATGAGCCACTGTGCCTGG 0: 7444
1: 30963
2: 79445
3: 137491
4: 151300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119827291 Original CRISPR GCACCTTGGAAGTTCAAAGC AGG (reversed) Intergenic
No off target data available for this crispr