ID: 1119831538

View in Genome Browser
Species Human (GRCh38)
Location 14:77707438-77707460
Sequence GAGGAATCCCAGAACTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119831538 Original CRISPR GAGGAATCCCAGAACTGACA GGG (reversed) Intronic
901456980 1:9368654-9368676 GAGGACCCCCAGAACTAAGAAGG + Exonic
901755287 1:11437782-11437804 GAGGTATCCCAAAAATGAGAAGG - Intergenic
901946852 1:12711221-12711243 AAAGAATCCCAGAACTAAGAGGG - Intergenic
901971463 1:12912227-12912249 AAGGAATCTCAGAACTTACATGG - Intronic
902013705 1:13289513-13289535 AAGGAATCTCAGAACTTACATGG + Intergenic
904836119 1:33338058-33338080 GAGGGATCCCACAAAAGACAAGG - Intronic
906837988 1:49104593-49104615 GTAGAATCCCAGATCTGCCAAGG - Intronic
916945112 1:169718525-169718547 CAGGAATCCCAGAGATGGCAAGG - Intronic
917112582 1:171564978-171565000 TAGGAATGCCAAAAATGACATGG + Intronic
917312102 1:173689212-173689234 AAAGAATCCCAGAACTAAGAGGG - Intergenic
918216292 1:182394287-182394309 GATGAGTCCAAGAACTGACCAGG + Intergenic
918638168 1:186804839-186804861 GAGGAAGCACAGATCAGACATGG + Intergenic
920231804 1:204475639-204475661 AAGGAATCCCAGAGCTGGAAGGG - Intronic
920962307 1:210674303-210674325 CAGGAATCCCAGGACAGAGAGGG - Exonic
921893715 1:220378031-220378053 GAGGAATCCAAGAATTAATAAGG - Intergenic
922700408 1:227756363-227756385 TAGGAATCTCAAAACTGAAAGGG - Intronic
1063088079 10:2837274-2837296 GAGCACTCCAAGAACTGCCAAGG - Intergenic
1064122320 10:12630625-12630647 CAGGAATCCAAGAACAGCCAGGG - Intronic
1064130753 10:12707633-12707655 GGGGAATTCCAGAACTTAGAGGG + Intronic
1065116577 10:22488929-22488951 GAGGAATCACAGAGGTGAAAAGG + Intergenic
1068264510 10:54628852-54628874 GAGAAATCAAAGAACTGAAATGG - Intronic
1070526956 10:77303587-77303609 GAGGAAGCCCAGGGGTGACATGG - Intronic
1071220158 10:83456227-83456249 GAGGAATCCCATAAGAGAAAGGG + Intergenic
1071447737 10:85764438-85764460 GAGTAAGCCCAGAATGGACAAGG + Intronic
1071837018 10:89428252-89428274 TCAGAATCGCAGAACTGACAGGG - Intergenic
1074619205 10:115100838-115100860 TAGGAAACTCAAAACTGACAAGG - Intronic
1075967628 10:126626281-126626303 GAAGCATCCTAGAACAGACAGGG + Intronic
1076348681 10:129799575-129799597 AAGGAATCTCTGAACTGAGATGG + Intergenic
1077168408 11:1153898-1153920 GAGGAAGCCCAGCACAGCCAGGG + Intergenic
1077298057 11:1835196-1835218 TGGGAATCCCACAACTCACAGGG - Exonic
1077549409 11:3193418-3193440 TAGGAATCCCAGACCTGGGAGGG - Intergenic
1079437279 11:20470250-20470272 CATGAACCCCAGAACTGAAAAGG - Intronic
1081447255 11:43142591-43142613 GAGGATTCCCAGTGCTCACAGGG + Intergenic
1081621045 11:44619312-44619334 GAGGAACCACAGAACAGCCAGGG - Exonic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1087976930 11:104562070-104562092 GAGGAATACAAGGACTGACAGGG + Intergenic
1088107672 11:106224523-106224545 AAAGAATTCTAGAACTGACAGGG + Intergenic
1088384074 11:109232998-109233020 GAGGAAACACAGAGCAGACAGGG - Intergenic
1088622128 11:111696226-111696248 GTGGAATCCCTGAACTGAAAAGG + Intronic
1090324023 11:125869565-125869587 AAAGAATCCCAGAACTGAGAGGG - Intergenic
1092766880 12:11861158-11861180 CAAGAATCCCAGAACAGAAAGGG - Intronic
1092837493 12:12504555-12504577 GAGAAACACCAGAACTGGCAGGG - Intronic
1092909542 12:13134468-13134490 CAGGAATCCCAGTCCAGACAAGG - Intronic
1096532188 12:52249126-52249148 GAGGAAGCCCAGAAGAGCCACGG + Intronic
1097924589 12:65113208-65113230 GAAGAAGCCCTGAACTGATAAGG + Intronic
1098304592 12:69089947-69089969 CAGGAACCCCGGAACTGAGAGGG + Intergenic
1099104177 12:78479464-78479486 AAAGAATCCCAGAACAGAGACGG + Intergenic
1110812451 13:79825916-79825938 CAGAAATTCCAGAACTGCCATGG + Intergenic
1111179555 13:84645348-84645370 GAGAAGTCCTAGAACTGAAATGG - Intergenic
1111583296 13:90252749-90252771 GAGGAATCCAAGAATTCAAAGGG + Intergenic
1113071785 13:106428951-106428973 GAGGAATGTCAGAACTGAAATGG - Intergenic
1113659104 13:112092577-112092599 TAGAAATTCCAGAACTGGCATGG - Intergenic
1113779358 13:112967210-112967232 GAAGGTTCCCTGAACTGACAGGG + Intronic
1114815779 14:25956081-25956103 GAAGAAACTCAGAACTGTCATGG - Intergenic
1116326340 14:43536596-43536618 GACGAGTCCCAGAACTAACCAGG + Intergenic
1117954156 14:61109887-61109909 GAGAAATCCCACATCTGGCAGGG - Intergenic
1119831538 14:77707438-77707460 GAGGAATCCCAGAACTGACAGGG - Intronic
1120453682 14:84703725-84703747 GAGGAAGCCCAGTTCTGAGACGG + Intergenic
1122783223 14:104152499-104152521 AAGGAAGCCCAGTTCTGACAAGG - Intronic
1124607344 15:31179562-31179584 ATGGAATCTCAGACCTGACAGGG - Intergenic
1125733759 15:41909385-41909407 TTGGAATCCCAGAACTGTGAGGG - Intronic
1131358931 15:91772137-91772159 CTAGAATTCCAGAACTGACAAGG + Intergenic
1131637084 15:94247423-94247445 GAAGGATCCTAGAACTGGCATGG - Intronic
1132199391 15:99938924-99938946 AAAGAATCCCAAAACTCACATGG - Intergenic
1132220663 15:100102743-100102765 GAGGAAACCCAGAGCAGGCAGGG - Intronic
1133597944 16:7310994-7311016 GAGTAATTCCAGACCGGACACGG - Intronic
1136361231 16:29781016-29781038 GAGGAATCCCAGATCTGAGAGGG - Exonic
1138539836 16:57681115-57681137 GATGAATCCCAGGATTGAGAAGG + Intronic
1143248361 17:5504110-5504132 GAGGAATCCTAGGACACACATGG + Intronic
1146239500 17:31205034-31205056 GAGGAATCCCAAAACTGGGAGGG - Intronic
1146425752 17:32736513-32736535 AAGGCATCCCAGGACTGGCATGG - Intronic
1146696418 17:34911906-34911928 GAGGCATCCCAGAAATGGGATGG + Intergenic
1147328376 17:39681334-39681356 GAGGAAACCAAGGACTGAAAAGG - Intronic
1153232325 18:2950717-2950739 GGGAAATCCCAGAGATGACATGG + Intronic
1156539961 18:37899828-37899850 GAGGAATCCCAGCCTTGACTTGG + Intergenic
1157882450 18:51333426-51333448 GATGAATCCCAAAACAGAAAAGG - Intergenic
1160523661 18:79523002-79523024 CAGGGACCCCAGAGCTGACAGGG - Intronic
1160708867 19:541689-541711 GTGAAAACCCAGAACAGACATGG - Exonic
1161567643 19:5012496-5012518 GAGGGATCCCAGGACTGCCACGG - Intronic
1162268326 19:9594363-9594385 AAAGAATCCCAGAACTAAGAGGG - Intergenic
1162301494 19:9847545-9847567 GAGAAAGCCCAGCACTGCCACGG - Intronic
1162966878 19:14160321-14160343 GGGGAATCCCAGGACTGTCAGGG + Intronic
1164414626 19:28036334-28036356 GTGGAACCACAGAACTGATAAGG + Intergenic
1166827218 19:45616942-45616964 GAGGGACCCCAGAAGTGACCTGG + Intronic
1167506744 19:49874927-49874949 GTGGAATCCCAGCACTGAATAGG - Intronic
926962337 2:18372129-18372151 GATGGATCACAGAAATGACATGG - Intergenic
932746441 2:74337436-74337458 AAGGAAACTCAGAACTGACTGGG + Intronic
933223955 2:79724050-79724072 GAGGCAGTCCAGAACTGAGATGG - Intronic
933726314 2:85429609-85429631 GAGGAGTCCCAGTACTCACCGGG - Intronic
935048066 2:99499386-99499408 AAAGAATCCCAGAACTAAGAGGG + Intergenic
940122104 2:150278327-150278349 AAGGGACCCCAGACCTGACATGG + Intergenic
940352332 2:152703854-152703876 AAAGAATCCCAGAACTGAGAGGG + Intronic
941045467 2:160670637-160670659 GAGGAAGCCAAGAACTTACATGG - Intergenic
944918917 2:204390176-204390198 GAGAATTCCCAGAAGTGAGAGGG + Intergenic
944937176 2:204581565-204581587 GAGGAATGGCAGAAGTGCCAGGG + Intronic
945472055 2:210238612-210238634 TAGAAATACTAGAACTGACATGG - Intergenic
946539696 2:220670752-220670774 CTGGAATCCCATAACTGACAAGG - Intergenic
947664414 2:231894683-231894705 GAGGGTGCCCAGAGCTGACATGG - Intergenic
1170164021 20:13343867-13343889 GAGGATTCCCAAACCTGACTGGG + Intergenic
1170754312 20:19185474-19185496 GAGGAAGCCATGAAATGACATGG - Intergenic
1171024550 20:21617025-21617047 GAGGAAGCCTAGTATTGACAAGG - Intergenic
1171253041 20:23664178-23664200 GAGGAATCACAGCACTAGCATGG + Intergenic
1173048714 20:39538163-39538185 AAGGCACCCCAGAACTGAAAAGG + Intergenic
1174211273 20:48880401-48880423 GAGGAAACCCAGAGCTGATGTGG + Intergenic
1175453255 20:59089019-59089041 GAGGTATCCCAGGACTGGAAGGG - Intergenic
1178627916 21:34233675-34233697 GAGGAGGGCCAGAACTGATAAGG - Intergenic
1180786416 22:18550154-18550176 GGGGGACCCCAGAACTGCCACGG + Intergenic
1181131696 22:20735873-20735895 GGGGGACCCCAGAACTGCCATGG + Intronic
1181243337 22:21489707-21489729 GGGGGACCCCAGAACTGCCACGG + Intergenic
1181267614 22:21640009-21640031 CAGGAATTCCAGACCAGACATGG - Intergenic
950487379 3:13281638-13281660 CAGGAGTCCCAGTACTGTCATGG - Intergenic
950846612 3:16021656-16021678 AAAGAATCCCAGAACTAAGAAGG - Intergenic
958714689 3:97765022-97765044 GAGGAATTCTAAAACTGACGGGG - Intronic
960839552 3:121942900-121942922 GAGGAAGCTCAGCACTTACAAGG - Exonic
962357758 3:134709468-134709490 GAGGACTCCCAGAAATAACTGGG + Intronic
962819937 3:139038719-139038741 TAGGAATGCCATAACTGCCAAGG - Intronic
963073339 3:141323227-141323249 GAGCAAACCCAAAACTGAGATGG - Intergenic
963857053 3:150265662-150265684 GAGGAATTAAAGAGCTGACATGG + Intergenic
965284386 3:166799455-166799477 GAGGAATCTCAGCAGTGAAATGG - Intergenic
965757001 3:172037981-172038003 GAGCAATGTGAGAACTGACAAGG + Intergenic
968233278 3:197016549-197016571 GAGTAGACCCAGAACTGACAGGG - Intronic
969583564 4:8079311-8079333 GAGCTGTCCCAGAATTGACAAGG - Intronic
974341303 4:60617623-60617645 TAGAAATACCAGAACTGCCATGG + Intergenic
983909285 4:173218843-173218865 GAGGAAACCCAGAACCAGCAGGG - Intronic
987552063 5:19396067-19396089 ACTGAATCTCAGAACTGACATGG - Intergenic
989038672 5:37203323-37203345 GATGAATCACAGAACCGTCATGG - Intronic
990522533 5:56593800-56593822 GAGGAATTCCTGAGCTGATAAGG - Intronic
993224821 5:85155046-85155068 TAGGAATAACAGAACTGGCATGG + Intergenic
995130286 5:108622934-108622956 GAGTGTTCCCAGAACTGTCATGG + Intergenic
1001043980 5:168356936-168356958 GAGACTTCCCACAACTGACAGGG - Intronic
1001241511 5:170075068-170075090 GAGGTCTCCCAGAAATGACAAGG - Intronic
1004163790 6:13237437-13237459 CAGGAGGCCCAGAACTGAGATGG - Intronic
1004721251 6:18269317-18269339 GAGAATTGCCTGAACTGACAGGG - Intergenic
1006096594 6:31660221-31660243 CAAGAATCTCAGATCTGACAAGG + Exonic
1008472888 6:51903555-51903577 CAGGAAGACCAGAACTGAGAGGG - Intronic
1010657629 6:78530453-78530475 GAGGACACCCAGCACTGACAGGG + Intergenic
1011651155 6:89507647-89507669 CAGGAATCCCATGAATGACAAGG - Intronic
1012898658 6:104981364-104981386 GATTAATCAGAGAACTGACAAGG - Intronic
1013654847 6:112235590-112235612 GAGGAATACCAGACATGATATGG + Intronic
1015378414 6:132536747-132536769 GAGGAATCCTAGGAGTAACAAGG + Intergenic
1016715118 6:147216885-147216907 GACGAGTCCTAGAACTCACATGG + Intronic
1018553513 6:165026209-165026231 GAGGAATCCCAAAAACGAGACGG + Intergenic
1019296561 7:279954-279976 TGGGAAGCTCAGAACTGACAAGG - Intergenic
1020739947 7:12002901-12002923 GAGGAATCTCAGAATAGATATGG - Intergenic
1020924614 7:14310053-14310075 TAGAAATTCCAGAACTGCCACGG + Intronic
1022552515 7:31254703-31254725 GAGAGTTCCCAGAACTGTCACGG - Intergenic
1023246717 7:38212837-38212859 GAGTAGTACCAGAACTGACTGGG + Intronic
1028828155 7:95298151-95298173 AATGAATCCCATAATTGACATGG - Exonic
1029822412 7:103158714-103158736 GAGAAATCCCACAACTTAGAAGG + Intergenic
1033097998 7:138447685-138447707 AAAGAATCCCAGAACTAAGAGGG - Intergenic
1033834149 7:145288499-145288521 GAAGAATCCCAGAACAGGCCGGG + Intergenic
1034069874 7:148174273-148174295 GAGGAATCCCACAGCTGTCCAGG + Intronic
1034542046 7:151764575-151764597 GAGGCATCCCAGGACTGCGATGG + Intronic
1035598177 8:878090-878112 GAGGACTCCCAGTACTCTCAAGG - Intergenic
1041694455 8:60720960-60720982 ACGGAATCCCAGAACTGATGAGG - Intronic
1044350548 8:91160411-91160433 TAGGAACTCCAGTACTGACATGG + Intronic
1044441887 8:92232525-92232547 GAGTACTCTCAGAACTGCCAAGG - Intergenic
1047238544 8:123064033-123064055 GAGAAATCCCAGAAGAAACAGGG + Intronic
1047372335 8:124266510-124266532 GTGGAATTCCAGAACTGATGTGG + Intergenic
1049320463 8:141993536-141993558 GCGGAATCCCAGAACAGCAAGGG - Intergenic
1049344555 8:142131598-142131620 GAGGAATCCCGGCAGTGACAGGG + Intergenic
1049938662 9:523736-523758 GAATAATCACAGCACTGACATGG - Intronic
1050503455 9:6322899-6322921 GAGGACTCCCAGAAGTAACTGGG - Intergenic
1050618610 9:7429348-7429370 CAGGAATCCCAGAACCTACTTGG + Intergenic
1051314540 9:15814055-15814077 AAGGAATCCCACAAGTGTCAAGG - Intronic
1052302921 9:26974020-26974042 AAAGAATCCCAGAATTGAAAGGG - Intronic
1055766707 9:79671483-79671505 GAGGAATGCCAGAATTGTTATGG - Intronic
1055961053 9:81820826-81820848 GAGAAATCGCAGAACTGCCATGG + Intergenic
1056446675 9:86673238-86673260 CAGGAAACCCAGAGCTGAGATGG + Intergenic
1058412342 9:104747738-104747760 GAGGAGTCTCAGAAAGGACACGG + Exonic
1059576464 9:115494120-115494142 GAGGAAGCCTAGAACTCATATGG + Intergenic
1059796255 9:117700430-117700452 GAGGAATCCCATATTTGCCAGGG - Intergenic
1061914595 9:133742864-133742886 CAGGACTCCCAGCACTGACCAGG + Intergenic
1062175619 9:135160552-135160574 GACAACTCCCAGAACTCACATGG + Intergenic
1188690514 X:33123346-33123368 GAGGAATCAGAAAACTGAAAAGG + Intronic
1191837151 X:65476633-65476655 GTGTAATCTCAGAACTGTCATGG + Intronic
1195215794 X:102700396-102700418 GATAATTCCCAGTACTGACAAGG + Intergenic
1195727532 X:107933885-107933907 GAGGTATCCCACAACTCACTTGG - Intergenic
1195913332 X:109911592-109911614 AAGGACTCTCAAAACTGACACGG + Intergenic
1197007417 X:121518604-121518626 TAGGCATCCCAGAAATGTCAAGG + Intergenic
1199666402 X:150099669-150099691 CAGGAACCCCAAAACTAACAAGG - Intergenic
1200783209 Y:7235613-7235635 GAGGAATTCAGGAACTGACATGG - Intergenic
1201499928 Y:14630692-14630714 GTAGAATCCCAGAACGGACTTGG - Intronic