ID: 1119840549

View in Genome Browser
Species Human (GRCh38)
Location 14:77789605-77789627
Sequence CACCTCCTGCAGTTTTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119840549_1119840554 -6 Left 1119840549 14:77789605-77789627 CCACTGGAAAACTGCAGGAGGTG No data
Right 1119840554 14:77789622-77789644 GAGGTGGTATGGTATTTCTGGGG No data
1119840549_1119840552 -8 Left 1119840549 14:77789605-77789627 CCACTGGAAAACTGCAGGAGGTG No data
Right 1119840552 14:77789620-77789642 AGGAGGTGGTATGGTATTTCTGG No data
1119840549_1119840556 27 Left 1119840549 14:77789605-77789627 CCACTGGAAAACTGCAGGAGGTG No data
Right 1119840556 14:77789655-77789677 ACCTCATCCAATTGCTTTCATGG No data
1119840549_1119840553 -7 Left 1119840549 14:77789605-77789627 CCACTGGAAAACTGCAGGAGGTG No data
Right 1119840553 14:77789621-77789643 GGAGGTGGTATGGTATTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119840549 Original CRISPR CACCTCCTGCAGTTTTCCAG TGG (reversed) Intergenic
No off target data available for this crispr