ID: 1119840706

View in Genome Browser
Species Human (GRCh38)
Location 14:77790761-77790783
Sequence TCCTGCTGGTGTTCGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119840706_1119840713 26 Left 1119840706 14:77790761-77790783 CCACTGCCCGAACACCAGCAGGA No data
Right 1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG No data
1119840706_1119840712 -6 Left 1119840706 14:77790761-77790783 CCACTGCCCGAACACCAGCAGGA No data
Right 1119840712 14:77790778-77790800 GCAGGAAGGGCAGCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119840706 Original CRISPR TCCTGCTGGTGTTCGGGCAG TGG (reversed) Intergenic
No off target data available for this crispr