ID: 1119840711

View in Genome Browser
Species Human (GRCh38)
Location 14:77790775-77790797
Sequence GCTGCTGCTGCCCTTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119840711_1119840713 12 Left 1119840711 14:77790775-77790797 CCAGCAGGAAGGGCAGCAGCAGC No data
Right 1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119840711 Original CRISPR GCTGCTGCTGCCCTTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr