ID: 1119840713

View in Genome Browser
Species Human (GRCh38)
Location 14:77790810-77790832
Sequence GTGTATATATACAGACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119840709_1119840713 20 Left 1119840709 14:77790767-77790789 CCCGAACACCAGCAGGAAGGGCA No data
Right 1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG No data
1119840711_1119840713 12 Left 1119840711 14:77790775-77790797 CCAGCAGGAAGGGCAGCAGCAGC No data
Right 1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG No data
1119840710_1119840713 19 Left 1119840710 14:77790768-77790790 CCGAACACCAGCAGGAAGGGCAG No data
Right 1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG No data
1119840706_1119840713 26 Left 1119840706 14:77790761-77790783 CCACTGCCCGAACACCAGCAGGA No data
Right 1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG No data
1119840704_1119840713 30 Left 1119840704 14:77790757-77790779 CCAGCCACTGCCCGAACACCAGC No data
Right 1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119840713 Original CRISPR GTGTATATATACAGACATCC AGG Intergenic
No off target data available for this crispr