ID: 1119844469

View in Genome Browser
Species Human (GRCh38)
Location 14:77818146-77818168
Sequence ACTTTTGACCTGAGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119844462_1119844469 11 Left 1119844462 14:77818112-77818134 CCTGAGTAGCCGCCATTTTGGCT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1119844469 14:77818146-77818168 ACTTTTGACCTGAGTGTAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 120
1119844460_1119844469 21 Left 1119844460 14:77818102-77818124 CCTGGCTGCTCCTGAGTAGCCGC 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1119844469 14:77818146-77818168 ACTTTTGACCTGAGTGTAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 120
1119844464_1119844469 2 Left 1119844464 14:77818121-77818143 CCGCCATTTTGGCTGTGGCCTGA 0: 1
1: 0
2: 0
3: 28
4: 218
Right 1119844469 14:77818146-77818168 ACTTTTGACCTGAGTGTAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 120
1119844465_1119844469 -1 Left 1119844465 14:77818124-77818146 CCATTTTGGCTGTGGCCTGACCA 0: 1
1: 0
2: 1
3: 12
4: 206
Right 1119844469 14:77818146-77818168 ACTTTTGACCTGAGTGTAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119844469 Original CRISPR ACTTTTGACCTGAGTGTAGT GGG Intronic
905129887 1:35746363-35746385 ACTTTTCACCTGAGGGTAAGGGG + Intronic
906529938 1:46518005-46518027 ACTTTTGACCTGAGTCTCATGGG + Intergenic
910870801 1:91830963-91830985 AGTTTTTACCTGTGTGTACTGGG - Intronic
911711239 1:101076055-101076077 ACTTTTTACCTGAGGGCAGGAGG + Intergenic
914895310 1:151666145-151666167 GCTTATGACCTGAGTTTAATGGG - Intronic
916979549 1:170118474-170118496 GCTTTTGACTTGACTGTTGTTGG - Intergenic
917118024 1:171622005-171622027 ACTTTTGATCTGAGTGATCTCGG - Intergenic
917127817 1:171706019-171706041 ATTTTAGACCTTAGTGTAATAGG + Intronic
919011928 1:191975811-191975833 CCTAGTGACCTGAGAGTAGTTGG + Intergenic
920739615 1:208568083-208568105 AATTTTGTCCTTAGTGTAGCAGG - Intergenic
921789935 1:219278510-219278532 ACTTATGAGCTGTGTGTACTTGG - Intergenic
1071140269 10:82501412-82501434 ACTTTTGACCTGAGTGTAACAGG - Intronic
1074301284 10:112235274-112235296 ACTTTTTAGCTGACTGTAGTGGG - Intergenic
1075552301 10:123401338-123401360 ACCTTTGAGCTGAGAGTAGAAGG - Intergenic
1077002804 11:333048-333070 ACTTTTGACCTTCATGTAGCTGG + Intergenic
1077715802 11:4579189-4579211 ACTTTTTACATCAGTGTTGTAGG - Intergenic
1080924355 11:36740456-36740478 ACTGTTGAACAGACTGTAGTGGG + Intergenic
1085321834 11:75579310-75579332 AGTTTTGACCCAAGTGCAGTGGG + Intergenic
1090888738 11:130903508-130903530 TCTTTTGATTTGAGTGTAGAGGG - Intronic
1091129987 11:133137990-133138012 AATTTTAACCTGAGTGTTGATGG - Intronic
1091139317 11:133221771-133221793 AGTTTTGACCTGTGTGAATTTGG + Intronic
1095499255 12:42818615-42818637 ACTTTATACCTGACTGCAGTGGG - Intergenic
1098739942 12:74160814-74160836 GGTTTTGACCTGAGTCAAGTTGG - Intergenic
1099215179 12:79844702-79844724 GCTTTTAACCTGAGTGAAATAGG - Intronic
1103299461 12:119916929-119916951 GCTTCTGACCTGAGGGTACTTGG + Intergenic
1104298739 12:127543125-127543147 ACCTTTGACCTGTGTGTCCTTGG - Intergenic
1104494949 12:129228187-129228209 ACTTTTGAATTGAGTTTAGCGGG + Intronic
1105216832 13:18292347-18292369 ACTGTGCACCTGTGTGTAGTAGG + Intergenic
1106008011 13:25789441-25789463 ACTCTTGACTTGACTGTTGTTGG - Intronic
1106059040 13:26268099-26268121 AGTTTTGATGTGAGTGTAATTGG - Intronic
1108412849 13:50167685-50167707 AATTTTGATCTGAGGGTAGTAGG + Intronic
1109305443 13:60635327-60635349 ACTTTTGACCTGTGTATAAATGG + Intergenic
1110002282 13:70218486-70218508 ATTTTTGACAACAGTGTAGTAGG - Intergenic
1110893389 13:80717865-80717887 ACTTTTGACCTGAACAGAGTCGG + Intergenic
1111898491 13:94171072-94171094 TCTTTTCACCTGAGTATGGTTGG + Intronic
1117222934 14:53624639-53624661 ACTTTTGACCTGAGTCCTGAAGG + Intergenic
1119844469 14:77818146-77818168 ACTTTTGACCTGAGTGTAGTGGG + Intronic
1121716130 14:96077367-96077389 ACCTTAGACATGAGTGTATTTGG + Intronic
1123950253 15:25265049-25265071 ACTTTTTACCTGAATTTGGTGGG + Intergenic
1124848504 15:33313499-33313521 AATTTTGACTTTAGGGTAGTTGG + Intronic
1125664391 15:41418096-41418118 ACTTTTGGCCTCAGTGTCTTGGG + Intronic
1127751661 15:62051294-62051316 ATTTATGACCTTATTGTAGTTGG - Intronic
1128392953 15:67195419-67195441 ACTTTTGACCTTTGTGCAGATGG - Intergenic
1129541918 15:76356951-76356973 TCTTTTGATCTGAATGTTGTTGG - Intronic
1135152494 16:20021194-20021216 ACTTTTCACCTGAGTGATGTTGG - Intergenic
1140112995 16:72019438-72019460 ACTTTTGATCTGAGAGTTGGGGG - Intronic
1140906228 16:79411565-79411587 ACTTTTGCCCTGAGTGATGGAGG + Intergenic
1141941308 16:87277961-87277983 ACTTTTGAGCTGAGTGTTAAGGG - Intronic
1143405630 17:6675461-6675483 ACTTATGACCTGAGTGGCCTCGG - Intergenic
1155910577 18:31499966-31499988 ATTTTTGTCCAGAGAGTAGTGGG + Intronic
1155994085 18:32311802-32311824 ACTCTTCACCTGAGTGGAATGGG + Intronic
1157233390 18:45940339-45940361 GCTTTTTCCCTGAGTGCAGTGGG + Intronic
1158279928 18:55813430-55813452 ACTTCTGACCTGAGGGTTGCAGG - Intergenic
1158888468 18:61851108-61851130 ACTTATGATCTGACTGTGGTTGG + Intronic
1163568071 19:18063595-18063617 ACTTTTGAGCTGAGTTTTGAAGG + Intronic
925754378 2:7119682-7119704 ACTCATGACCTGAGTGTCCTTGG - Intergenic
929618297 2:43329718-43329740 ACTTTTCACCTGATTGTGTTTGG - Intronic
934098546 2:88629225-88629247 ACTTTTATCCTGAGTGAACTGGG - Intergenic
934297492 2:91754338-91754360 ACTGTGCACCTGTGTGTAGTAGG - Intergenic
936465016 2:112740176-112740198 TCTTATGAGCTGACTGTAGTGGG + Intronic
942567739 2:177283228-177283250 ACTTAGGACCTGATTGTATTGGG - Intronic
942808082 2:179958716-179958738 AATTTTGACTTGAATATAGTAGG - Intronic
943381654 2:187157249-187157271 ATTTTTGACCTATGAGTAGTAGG - Intergenic
945594602 2:211776092-211776114 ACTTTAGGGCTAAGTGTAGTGGG + Intronic
1169633190 20:7656966-7656988 ACTTTTGACTAAAGTGTAGAAGG + Intergenic
1170198677 20:13717817-13717839 ACTTTTTATTTGAGGGTAGTTGG - Intronic
1170326601 20:15161414-15161436 ACTTTTAACCAGTGTGTAGGAGG - Intronic
1172897463 20:38310504-38310526 AATTTTGACCTGAGCATAGAAGG + Exonic
1173068112 20:39734146-39734168 ACTTTAGAAATGAGTGGAGTTGG + Intergenic
1173535855 20:43812796-43812818 ACGTTTCATCTGAGAGTAGTAGG - Intergenic
1180670855 22:17551824-17551846 ACTTTTGTCAGGAGTGCAGTAGG + Intronic
1180751733 22:18129446-18129468 TCTCTTGACCTGAGTCAAGTGGG - Intronic
949341777 3:3038367-3038389 AGTTTTGATCTGAGTGTTGAAGG - Intronic
954731127 3:52663172-52663194 ACATTTGACTTAAGTGTTGTGGG - Intronic
955628410 3:60945966-60945988 ACTTTGGGCCTGAGTGTGGATGG - Intronic
956207935 3:66773191-66773213 GCTTTTACCCTGAGTGGAGTAGG - Intergenic
957946895 3:87075614-87075636 ACATTGGAGCTGAGGGTAGTGGG - Intergenic
960031224 3:113056801-113056823 ACATTTGAGCTGAGTGTTGAAGG - Intergenic
962683827 3:137827118-137827140 ACTTTTGCCCTGAGGGTTGCTGG - Intergenic
965188768 3:165502138-165502160 AATTTTCACCTGGGTGCAGTTGG + Intergenic
967656679 3:192058567-192058589 ACATTTGAGCTGAAGGTAGTTGG - Intergenic
968339007 3:197938993-197939015 ACTTTTGAGCAGAGTGTACCAGG - Intronic
969431530 4:7157771-7157793 GCTTTTGGTCTGAGTGCAGTGGG - Intergenic
969783080 4:9426348-9426370 ATTTTCGACCTGAGTGTTCTGGG - Intergenic
969927172 4:10595592-10595614 ACTTTTGACCTTGGGGTGGTTGG + Intronic
970219408 4:13795361-13795383 TCAGCTGACCTGAGTGTAGTGGG + Intergenic
971403636 4:26300130-26300152 ACTTCTGACCAGAGTGTCCTTGG + Intronic
974099638 4:57402589-57402611 GCTTTTGGCCAGAGTATAGTTGG + Intergenic
981138920 4:141244921-141244943 AATTTTTATCTTAGTGTAGTAGG + Intergenic
982682191 4:158444757-158444779 TCTTCTGATCTAAGTGTAGTAGG + Intronic
982769529 4:159383546-159383568 AATTTTGACCTGGGTGCATTTGG - Intergenic
986837541 5:11656466-11656488 ATTTTTGCCCTCAGTGTATTAGG + Intronic
988997313 5:36726843-36726865 ACTTTTGAGCAGAGTGCAGGAGG + Intergenic
993758047 5:91756375-91756397 ACTTTTCACCTGTGTGTTGTGGG + Intergenic
996031792 5:118713384-118713406 ACTTTTGACCTTTATGTACTTGG - Intergenic
997555598 5:134795422-134795444 ACTTTTGTGCTGATTGTAGTTGG + Intronic
999382754 5:151132951-151132973 ACTTTAGTCCTGAGTTTATTAGG - Intronic
1001103087 5:168830080-168830102 TCTTAGGACCTGAGTGTCGTAGG - Intronic
1001218324 5:169876501-169876523 ACTTCTGTCCTGACTGTAGTGGG - Intronic
1002566557 5:180115475-180115497 ACTCCTGACCTCATTGTAGTGGG + Intronic
1008619995 6:53262575-53262597 ACTTTAGAACTGAGTATAGAAGG - Intergenic
1008809235 6:55473231-55473253 ACATTTGAAATGATTGTAGTTGG + Intronic
1012978051 6:105801167-105801189 TTTTTTGGCCTGAGAGTAGTTGG - Intergenic
1014392798 6:120884517-120884539 AAATTTGAAATGAGTGTAGTAGG - Intergenic
1014593303 6:123299465-123299487 ACTATTTATTTGAGTGTAGTGGG - Intronic
1014824201 6:126030155-126030177 ACTTTTGACCTGCTTGTCCTTGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1021032792 7:15760014-15760036 ACTTTTTACCACATTGTAGTAGG - Intergenic
1029004193 7:97190291-97190313 ACTCTTGGCTTGACTGTAGTTGG - Intergenic
1030569729 7:111208001-111208023 TCTTTTGAACTGAGAGCAGTAGG - Intronic
1031437640 7:121752364-121752386 ACTTTTGACGTGACTCTATTTGG - Intergenic
1031959398 7:127975269-127975291 AGTATTGAGTTGAGTGTAGTAGG + Intronic
1034561315 7:151881056-151881078 ATTTTTGTCCTGATTGTATTTGG + Intergenic
1044080328 8:87874715-87874737 ACTTTTGACAAGAGTGTAATTGG - Intergenic
1046676677 8:117116218-117116240 AATTTTGTTCTGAGTGTAATGGG + Intronic
1047433363 8:124812900-124812922 ACTGTTCAGCTGAGTGCAGTGGG - Intergenic
1050019785 9:1270950-1270972 CCTTTTTACCTGAGTTAAGTAGG + Intergenic
1051231404 9:14959068-14959090 GCTTTGGGCCTGAGTTTAGTAGG + Intergenic
1053434050 9:38063524-38063546 ACTCTTGAGCTGAGTGTAGAAGG - Intronic
1055817350 9:80222148-80222170 ACTTTCTACCTGGGTGAAGTTGG - Intergenic
1057870980 9:98717154-98717176 ACATTTGACCTGAGTTTTGAAGG - Intergenic
1059771727 9:117433065-117433087 AATTTTAACGTGAGTGTTGTAGG - Intergenic
1059937827 9:119329285-119329307 ACTTTTCACCTGATTTCAGTAGG - Intronic
1187267117 X:17745246-17745268 ACTGTTGTCTTAAGTGTAGTTGG + Intronic
1189560782 X:42189403-42189425 ACTTTTGGCCTGAGTGGCCTAGG - Intergenic
1192737903 X:73865980-73866002 ACTTTTGACCTTCCTGTATTTGG - Intergenic
1192744989 X:73929897-73929919 ACTTTTGACCTGCTTGTACTTGG + Intergenic
1194072630 X:89346308-89346330 ACTCTTGACCTGGATGTTGTTGG + Intergenic
1196037661 X:111164446-111164468 ACTTTTGAGCTGAGTATTGAAGG - Intronic
1197059812 X:122163993-122164015 ACCTTTGACCTCCCTGTAGTTGG - Intergenic
1200726869 Y:6682053-6682075 ACTCTTGACCTGGATGTTGTTGG + Intergenic
1200728021 Y:6697829-6697851 ACTCTTGACCTGGATGTTGTTGG + Intergenic