ID: 1119849837

View in Genome Browser
Species Human (GRCh38)
Location 14:77859276-77859298
Sequence GGAGGTACCCACCTTTGCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119849829_1119849837 4 Left 1119849829 14:77859249-77859271 CCAGGTCATCCGAGAAGATCTGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1119849837 14:77859276-77859298 GGAGGTACCCACCTTTGCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 106
1119849833_1119849837 -5 Left 1119849833 14:77859258-77859280 CCGAGAAGATCTGGGCAAGGAGG 0: 1
1: 0
2: 3
3: 23
4: 246
Right 1119849837 14:77859276-77859298 GGAGGTACCCACCTTTGCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 106
1119849828_1119849837 7 Left 1119849828 14:77859246-77859268 CCGCCAGGTCATCCGAGAAGATC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1119849837 14:77859276-77859298 GGAGGTACCCACCTTTGCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 106
1119849826_1119849837 30 Left 1119849826 14:77859223-77859245 CCACAGAGCAGCATGCAAGAGAT 0: 1
1: 0
2: 3
3: 24
4: 184
Right 1119849837 14:77859276-77859298 GGAGGTACCCACCTTTGCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119849837 Original CRISPR GGAGGTACCCACCTTTGCAG GGG Exonic
904299764 1:29546707-29546729 GGAGGGAACCACCTTGGCTGTGG + Intergenic
908405522 1:63810686-63810708 GGAGGTATCCACGTATGCAAAGG + Intronic
911491577 1:98575630-98575652 GAAGGTACCCACTTAGGCAGAGG - Intergenic
913532157 1:119741105-119741127 GGCTGTGGCCACCTTTGCAGTGG + Intronic
915603228 1:156935571-156935593 GGAGGCACCCACCTCTGCCTGGG + Exonic
919757190 1:201073537-201073559 TGAGGTGCTCACCTTGGCAGTGG + Exonic
1066367221 10:34788845-34788867 GGAGGTCCCCTCCTTGGCAGAGG + Intronic
1067736057 10:48851774-48851796 GGTGGTACCCACCTTTGCCTGGG - Intronic
1068171921 10:53404862-53404884 GGAGGTGTCCACCTTGTCAGAGG - Intergenic
1069881430 10:71596107-71596129 GGAGGCACACACCTCAGCAGTGG + Intronic
1073871387 10:107868727-107868749 GGAGACACTCATCTTTGCAGTGG + Intergenic
1074003884 10:109399478-109399500 GGAGCTGCCCAGCTTTGGAGAGG - Intergenic
1074901755 10:117822806-117822828 GGAGGTACCCACTAATGCAATGG + Intergenic
1075344447 10:121671860-121671882 ACAAGCACCCACCTTTGCAGTGG + Intergenic
1076497645 10:130907428-130907450 GGAGGCCCCCAGCTCTGCAGAGG - Intergenic
1084411450 11:69008488-69008510 GGAGGTCCCTCCCTTTGCAACGG - Intronic
1085296330 11:75433760-75433782 GGAGCTTCCAACATTTGCAGAGG + Intergenic
1085446474 11:76604205-76604227 GGTGGTCCCCACCATAGCAGTGG - Intergenic
1089307985 11:117538728-117538750 CCAGGGCCCCACCTTTGCAGAGG - Intronic
1095172089 12:39047996-39048018 GGATCAACCCATCTTTGCAGAGG - Intergenic
1099148894 12:79083314-79083336 GAAGATACTCTCCTTTGCAGTGG - Intronic
1099512646 12:83556251-83556273 AGAGGCACCCACCATTGCTGAGG - Intergenic
1102404118 12:112657946-112657968 GGAGGCACCCACCTTTGCACTGG - Intronic
1102681682 12:114694870-114694892 GGAGGTGCCCCAATTTGCAGGGG + Intergenic
1105875997 13:24554104-24554126 AGAGGCACCCACCATTGCCGAGG - Intergenic
1118900757 14:69983522-69983544 GGAAGTTGCCACCTCTGCAGGGG + Intronic
1119849837 14:77859276-77859298 GGAGGTACCCACCTTTGCAGGGG + Exonic
1121918459 14:97857807-97857829 GGAGATGCCCAGCTCTGCAGGGG + Intergenic
1122961968 14:105098038-105098060 GGAGGTGCCCACCATTGCCCTGG - Intergenic
1128609536 15:69062939-69062961 GGATGTTCTCACCCTTGCAGGGG - Intergenic
1128934709 15:71735318-71735340 GGAGGAAGCCACCCCTGCAGCGG - Intronic
1130232543 15:82108041-82108063 GCAGGTACTCATGTTTGCAGAGG - Intergenic
1130865977 15:87933700-87933722 GAAGGTATCTACATTTGCAGAGG + Intronic
1132674803 16:1117156-1117178 GGGGGGACCCACCTCGGCAGGGG - Intergenic
1140775347 16:78244118-78244140 GGACCTACCCACCATTGCACAGG - Intronic
1140790228 16:78384497-78384519 GGAGGTACACACCTTTCACGGGG + Intronic
1140909374 16:79437910-79437932 GGAGGTTTCCGCCTCTGCAGGGG + Intergenic
1142150953 16:88512349-88512371 GCTGGTGCCCACCTTTCCAGGGG - Intronic
1143612272 17:8025620-8025642 GGGGGTCCTCACATTTGCAGAGG + Intergenic
1145795455 17:27652983-27653005 GGAGGCACCCCATTTTGCAGAGG - Intergenic
1145809890 17:27758314-27758336 GGAGGCACCCCCTTTTACAGAGG - Intronic
1151666913 17:75550288-75550310 GGAAGTACCCACCTGAGCACAGG - Intronic
1155578082 18:27270454-27270476 GATGGTAGCCACCTTTGCTGTGG - Intergenic
1161324946 19:3659066-3659088 GGAGCTACCCCCCTTACCAGGGG + Intronic
1162575655 19:11497407-11497429 GGAGCTACCCAGCTTGGAAGGGG - Intronic
932268993 2:70392470-70392492 TCAGGAACCCACCTGTGCAGTGG + Intergenic
937459056 2:122069841-122069863 GGATCCACCCACCTTTGCAGAGG - Intergenic
937574817 2:123407165-123407187 GAAGTTAGCCTCCTTTGCAGGGG + Intergenic
941550831 2:166913293-166913315 GGGGGTGCCCACCATTGCTGAGG - Intronic
942444103 2:176067000-176067022 GGAGGGACACACCTTTTCAAAGG - Intergenic
943083271 2:183282185-183282207 GGAGGTGCTGACCTTTACAGAGG + Intergenic
944317717 2:198301088-198301110 AGAGTAACCCGCCTTTGCAGAGG + Intronic
945276230 2:207990113-207990135 GCAGGGACCCTCCTTTTCAGTGG - Intronic
947815593 2:233034370-233034392 GGAGTGGTCCACCTTTGCAGTGG + Exonic
1168911271 20:1449089-1449111 GGAGGGACCCAGCTCTGCACTGG + Intronic
1172138992 20:32708521-32708543 GGAAGTAGCCACCTTCTCAGAGG - Intronic
1176137550 20:63530766-63530788 CGAAGTCCCCAACTTTGCAGAGG + Exonic
1176408783 21:6436548-6436570 GCAGGTACACACCTGTGCATGGG - Intergenic
1176859085 21:13995157-13995179 AGGGGTGCCCACCTTTGCTGAGG - Intergenic
1178357323 21:31919846-31919868 GGAGAGACCCTCCTTGGCAGTGG - Intronic
1179299156 21:40090856-40090878 GGAGGTACAGACATTTGGAGGGG - Intronic
1179684276 21:43044870-43044892 GCAGGTACACACCTGTGCATGGG - Intergenic
1181554902 22:23663428-23663450 AGAGGCACCCACCATTGCTGAGG + Intergenic
1182828605 22:33286319-33286341 TAAGGTACCCACCTCTCCAGGGG - Intronic
1183405617 22:37629319-37629341 GGAGAAACCCACATTTTCAGAGG - Intronic
1183931046 22:41236472-41236494 GGGGGTGCCCACCTGTGCAGCGG + Exonic
1184968209 22:47996674-47996696 GCTGGTACCCAGCTTGGCAGGGG - Intergenic
1185085393 22:48738064-48738086 CCAGGAACCCACCTTTGGAGTGG + Intronic
949725110 3:7035062-7035084 GGAGGTATACATCTTTGCACTGG + Intronic
955281538 3:57598827-57598849 AGAAGTACCCTCCTTTGCATTGG + Intergenic
962921725 3:139956343-139956365 TGAGGTACTCACATCTGCAGAGG - Intronic
964308855 3:155370852-155370874 GGACATACCAACCCTTGCAGGGG + Intergenic
969633532 4:8352348-8352370 GGATGTCCCCAGCTCTGCAGTGG - Intergenic
970111094 4:12639076-12639098 CAAGGTCCCTACCTTTGCAGAGG - Intergenic
971461330 4:26901116-26901138 GGAGGGGCCCAAGTTTGCAGAGG + Intronic
976154216 4:82125398-82125420 GGAGGTGCCACCCTTTGCAGAGG - Intergenic
981296664 4:143140679-143140701 GGAGGGGCCCACCATTACAGAGG + Intergenic
981797000 4:148606586-148606608 GGAGGAACCCACATTTGGTGAGG - Intergenic
983186222 4:164704229-164704251 AGAGGTACACACCTCTGCAGAGG + Intergenic
985082175 4:186277447-186277469 GGAGGTCTCCACCTTGGCAAAGG + Intronic
987557683 5:19476097-19476119 GGAGGTACCCAGTTTTGCAGAGG + Intronic
1001169846 5:169408827-169408849 GCATGTTCCCAGCTTTGCAGGGG - Intergenic
1006809840 6:36812798-36812820 GGAGGGACCTCTCTTTGCAGAGG + Intronic
1007705569 6:43788704-43788726 GGAGGTACCCAAGTGTGGAGTGG - Intergenic
1010263262 6:73840685-73840707 GGAGGCACCCCCCCTAGCAGGGG - Intergenic
1010892255 6:81327520-81327542 GGAGGTACCTACCGTAGAAGGGG - Intergenic
1011921019 6:92577385-92577407 GGAGGTCCCCCCCATTGAAGAGG - Intergenic
1013184180 6:107743723-107743745 TTAGGTACCTTCCTTTGCAGAGG + Intronic
1014586505 6:123203845-123203867 GGAGGTACCCATCTTTCCTGAGG - Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016779221 6:147939743-147939765 AGTGGTTCCCACCTTTCCAGAGG + Intergenic
1019371916 7:666502-666524 GGAGCTACTCAACTCTGCAGAGG + Intronic
1029479762 7:100805378-100805400 GGTGGAACCCAGCCTTGCAGAGG + Intronic
1030284283 7:107809586-107809608 GGAGGTACCTAACTTAGCTGAGG - Intergenic
1030510052 7:110472658-110472680 AGGGGTACCCACCATTGCTGAGG + Intergenic
1032680456 7:134177230-134177252 GTTGATACTCACCTTTGCAGAGG - Intronic
1035303740 7:157916722-157916744 GAAGGTCCCCACCATGGCAGGGG + Intronic
1035303767 7:157916803-157916825 GAAGGTCCCCACCATGGCAGGGG + Intronic
1035303791 7:157916884-157916906 GAAGGTCCCCACCATGGCAGGGG + Intronic
1035303818 7:157916965-157916987 GAAGGTCCCCACCATGGCAGGGG + Intronic
1035303845 7:157917046-157917068 GAAGGTCCCCACCATGGCAGGGG + Intronic
1035768504 8:2127512-2127534 GGTGGTTTCCTCCTTTGCAGTGG + Intronic
1038220877 8:25606412-25606434 GCAGGTACACAGCATTGCAGAGG - Intergenic
1041279514 8:56196738-56196760 GGAGGCCCACACCCTTGCAGAGG - Intronic
1049074401 8:140382612-140382634 GGAGGCACCCACCATTGCTGAGG + Intronic
1049757598 8:144317710-144317732 CGTGGTGCCCTCCTTTGCAGTGG - Exonic
1049789093 8:144464939-144464961 GGAGATACTCAACTTTGGAGAGG + Exonic
1052696816 9:31888838-31888860 AGGGGCACCCACCATTGCAGAGG - Intergenic
1060792440 9:126495652-126495674 GGAGGTGACCTCCTTTCCAGAGG - Intronic
1061945369 9:133905696-133905718 GGGGGTAGCCACCTCTGTAGTGG + Intronic
1187168933 X:16832080-16832102 GGAGGTATCCCCCTGTACAGAGG + Intronic
1189828998 X:44951174-44951196 GGAGGCACCCCTCTGTGCAGAGG + Intronic
1191641316 X:63431724-63431746 GGAGGTACCAACCTATCCAGTGG - Intergenic
1192181733 X:68920483-68920505 GGAGGGAGCCTTCTTTGCAGCGG - Intergenic
1193254413 X:79330158-79330180 GCAGGGACTCTCCTTTGCAGAGG - Intergenic
1196489873 X:116253145-116253167 AGAGGCACCCACCATTGCTGAGG + Intergenic
1197726860 X:129782186-129782208 GGAGTTATCCTCCTTTTCAGAGG - Intronic
1201938712 Y:19435332-19435354 GGGGGTGCCCACCATTGCTGAGG + Intergenic