ID: 1119849916

View in Genome Browser
Species Human (GRCh38)
Location 14:77859919-77859941
Sequence CAACACAGTGAGTTTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119849916_1119849917 4 Left 1119849916 14:77859919-77859941 CCTGTCTCAAACTCACTGTGTTG 0: 1
1: 0
2: 2
3: 11
4: 168
Right 1119849917 14:77859946-77859968 AGTCCTCAGTGCTTGTGCCGTGG 0: 1
1: 0
2: 2
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119849916 Original CRISPR CAACACAGTGAGTTTGAGAC AGG (reversed) Intronic
901861048 1:12074574-12074596 CCAGAAAGTGAGTTTGAGGCCGG - Intronic
903092767 1:20937213-20937235 CAACACAGTGATGATGAGAAAGG + Intronic
903181225 1:21605971-21605993 CAACAGAGAGAGTTGGAGTCAGG + Intronic
903281620 1:22253257-22253279 CAACAGTGTGAGTGTGAGACAGG + Intergenic
903535697 1:24064779-24064801 CCACACAGTGGGTTTGGGGCAGG + Intronic
904654722 1:32036004-32036026 CAACACCTAGATTTTGAGACAGG + Intronic
905637286 1:39563002-39563024 CAACTTAGAGAGTATGAGACAGG + Intronic
905693575 1:39959652-39959674 CAACTCTGTGAGTGTGAGATAGG - Intronic
908085974 1:60634420-60634442 CAAGACAGTGTGTTTGAAGCAGG + Intergenic
909653041 1:77997229-77997251 CAACACTGGGAGGTTGAGACGGG + Intronic
909766776 1:79366203-79366225 AAAAACACTGAGTTTGAGAGAGG - Intergenic
911297087 1:96131157-96131179 CAACACTGTGATCTTGAGAAAGG - Intergenic
911327352 1:96483694-96483716 CAACACAGTAAATTAGAGGCAGG - Intergenic
917661716 1:177182993-177183015 CTGCACTGAGAGTTTGAGACAGG - Intronic
917674766 1:177308383-177308405 TAATTCAGTGAGTTTGAGATGGG - Intergenic
918977281 1:191506136-191506158 GAACACATTAAATTTGAGACAGG + Intergenic
1063376993 10:5560367-5560389 CCAGACAGTGTGTGTGAGACAGG + Intergenic
1065970280 10:30800537-30800559 CACCAAAGTGGGTTAGAGACAGG + Intergenic
1066081485 10:31934899-31934921 CAGCACTTTGAGTTTGAGGCAGG - Intergenic
1067151440 10:43738206-43738228 GAACACGGTGTGTTTGAGAGGGG + Intergenic
1072450535 10:95536186-95536208 CAACAAAGTGAGATTGATTCAGG + Intronic
1072634258 10:97167246-97167268 CAACACAGTGAGGCTCAGAGTGG - Intronic
1073458193 10:103650322-103650344 CATCATAGTGAGTTTGAGGCAGG - Intronic
1074165050 10:110867677-110867699 CAACACAGCTAGTTAGGGACAGG + Intergenic
1074471387 10:113730121-113730143 CAACAGAGGGAGTTTAATACAGG + Exonic
1075124768 10:119690922-119690944 AAACACAGTGAGTTTAAGACTGG + Intergenic
1075398484 10:122144293-122144315 CTCCACAGTGAAATTGAGACAGG + Intronic
1075959814 10:126558686-126558708 CAACAGTGTGAGTTTGACATGGG - Intronic
1076830193 10:132990699-132990721 CAAGACCCTGAGTGTGAGACGGG + Intergenic
1076887807 10:133270596-133270618 CAACACGGTGCGCTTGAGCCTGG + Intronic
1078972830 11:16434474-16434496 CAAAGCAGTGACTTTGAGTCAGG - Intronic
1079219404 11:18546743-18546765 CAACACTGGGAGTCTGAGGCGGG - Intronic
1079315614 11:19405624-19405646 TGACACAGTGAGATTCAGACAGG + Intronic
1080136789 11:28864009-28864031 TAACACAGCTAGTTTGAGATTGG + Intergenic
1081400818 11:42640724-42640746 CAAGGCAGGCAGTTTGAGACTGG + Intergenic
1081711476 11:45219370-45219392 CAACACGGTGACGTTGGGACAGG + Intronic
1081778821 11:45695721-45695743 CATCACAGTGACTCTGAGGCAGG + Intergenic
1083038896 11:59668225-59668247 TCACACAGTGAGTTGGTGACAGG + Intronic
1083286847 11:61665454-61665476 CAATAAAGTGTTTTTGAGACAGG + Intergenic
1085706207 11:78788698-78788720 CAGCACAGTGAACTTCAGACAGG + Intronic
1092233584 12:6791872-6791894 CATCAAAGTTATTTTGAGACAGG - Intronic
1092384896 12:8028538-8028560 CAACACTGGGAGTCTGAGGCGGG - Intergenic
1092462093 12:8696175-8696197 AAACACAGTGAAATTGACACAGG - Intronic
1092636656 12:10458152-10458174 CACCAGAGTGAGGTTAAGACAGG - Intergenic
1093525428 12:20099571-20099593 CAGCAGAGTGAGGGTGAGACTGG + Intergenic
1094688820 12:32748648-32748670 ACACACAGTGAATTTGAGGCTGG - Intronic
1095146515 12:38735222-38735244 GAAAACAGTGAGTTTGAAAATGG + Intronic
1096266534 12:50127385-50127407 CAACACTGTTTTTTTGAGACAGG + Intergenic
1097320714 12:58222955-58222977 AAACACAGTGAATTTAACACAGG - Intergenic
1100147499 12:91696308-91696330 GAACACAGTGCCTTAGAGACAGG + Intergenic
1100426439 12:94491425-94491447 CAAAACACTGAGTTTGAGATGGG + Intergenic
1101544465 12:105698290-105698312 GAACACAGGGAGAGTGAGACTGG - Intergenic
1101846811 12:108369474-108369496 AAACACAGAGAGTTTGGGGCGGG + Intergenic
1102587235 12:113931939-113931961 CTACACAGGGAGCTCGAGACAGG + Intronic
1105908222 13:24834984-24835006 GAACACAGTGGGAATGAGACTGG + Intronic
1106051040 13:26189669-26189691 CTTCAGACTGAGTTTGAGACAGG + Intronic
1110334177 13:74307521-74307543 CAAAACAGAGAGATTGTGACTGG - Intergenic
1112209274 13:97359021-97359043 CAAGTCTGTGAGTTTAAGACAGG - Intronic
1114484008 14:23052486-23052508 CAGCACAGTGAGGTTGTGCCAGG + Exonic
1115216784 14:31021405-31021427 CAACTCAGTGAGGTTGATACAGG - Intronic
1116083703 14:40207271-40207293 CAACATAGTGAGTGTGAAAGTGG + Intergenic
1118643710 14:67817558-67817580 CTACACAGTGAGGCTGAGGCAGG - Intergenic
1119648557 14:76366867-76366889 CAAAACAGTGAGTCTGTAACTGG + Intronic
1119849916 14:77859919-77859941 CAACACAGTGAGTTTGAGACAGG - Intronic
1121891600 14:97597866-97597888 TAACACAAAGAGTTTGAAACAGG - Intergenic
1123921841 15:25075696-25075718 CAAAACAGTGTGCTTGAGAAAGG - Intergenic
1127574104 15:60273315-60273337 GAACACAGTGGGAGTGAGACTGG - Intergenic
1128088048 15:64899177-64899199 CAAGGCTGTGACTTTGAGACTGG + Intronic
1129493959 15:75958900-75958922 CAACCCATTGAGTTTGTGAAGGG - Intronic
1130831449 15:87605263-87605285 CACCACAGAGAGTGTAAGACAGG - Intergenic
1133718881 16:8475502-8475524 GAAAATAGTGAGTTTCAGACTGG - Intergenic
1134322796 16:13178961-13178983 CAACTCAATGATTTTGAGATAGG - Intronic
1137773679 16:51038781-51038803 CAAGGCAGTGAGTATGAGGCTGG + Intergenic
1138292365 16:55858610-55858632 CAACTCAATGAACTTGAGACTGG + Intronic
1138313404 16:56047512-56047534 AGACACAGGGAGTTTGAGACAGG + Intergenic
1138935068 16:61709494-61709516 CAACACGGGAAGTTTGAGATAGG + Intronic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1140715826 16:77724517-77724539 CAACACTGGGAGGTTGAGGCGGG - Intronic
1144693153 17:17282135-17282157 CAACACAGAGACCTTAAGACTGG + Intergenic
1144950142 17:18989511-18989533 TCACACAGTGAGTTTGAGGCAGG - Intronic
1147056529 17:37839304-37839326 AAACACACTGAGCCTGAGACTGG - Intergenic
1148931085 17:51127915-51127937 CAAAACAGTAGGTTTGATACAGG + Intergenic
1153094046 18:1381308-1381330 CAACAGAGTGGGTATGAGGCAGG + Intergenic
1156164722 18:34404297-34404319 CCTGACAGTGAGTTTGAGAGAGG + Intergenic
1157691952 18:49690940-49690962 CACCACAGTGAGGCTGAGATGGG - Intergenic
1161800472 19:6414645-6414667 CAACACAGTCACTTGGACACAGG + Intronic
1162451465 19:10757641-10757663 CAACACAGAGAATTTCAAACAGG - Intronic
1202704492 1_KI270713v1_random:13069-13091 AAAGACAGTGTGTCTGAGACAGG - Intergenic
932384929 2:71323508-71323530 GAACACAGTGGGAGTGAGACTGG - Intronic
933118475 2:78504021-78504043 CACCAGAGTGAGGTTGAGAGTGG + Intergenic
934947648 2:98553611-98553633 CAGCACAGTGAGTGTGAGTGTGG - Intronic
938923759 2:136019845-136019867 CTACACTGTGAGTTTGAGGCAGG - Intergenic
939359844 2:141156378-141156400 CAACACAGGGAGGCTGAGACAGG + Intronic
939702144 2:145406101-145406123 CAACACAGAGAGTTTGAGTCAGG - Intergenic
940165504 2:150766154-150766176 GAACACAGAGAGTTTAAGCCAGG + Intergenic
945957178 2:216097339-216097361 CAACAACAGGAGTTTGAGACTGG + Intronic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
948655805 2:239476089-239476111 CAAGAGAGAGAGCTTGAGACAGG + Intergenic
1169458930 20:5777679-5777701 CAACACTGAGAGGTTGAGGCGGG - Intronic
1169473312 20:5907569-5907591 CAACAGAGGGAATTTGATACAGG - Intergenic
1171347501 20:24477313-24477335 CAAAACAGTGTGTTTGAGGACGG - Intronic
1171558261 20:26097332-26097354 CCACACAGGAAGTTTGGGACAGG + Intergenic
1173502434 20:43564020-43564042 CCACACAGAAAGTTTGAGAAGGG + Intronic
1173560981 20:44005461-44005483 CAACAAAGACAGTATGAGACAGG + Intronic
1173852533 20:46228046-46228068 CATCACAGTCAGTTGGAGCCAGG + Intronic
1177717847 21:24863314-24863336 CAACTCAGTGTGTCTGAGAATGG - Intergenic
1181171393 22:21012188-21012210 CAACACAGAGAGTTGGGGGCGGG - Intronic
1181486075 22:23232507-23232529 CACCAGAGTGGGTTGGAGACAGG + Intronic
1182062070 22:27405512-27405534 CAACACAGTGAGGCTCAGAGAGG - Intergenic
1183729879 22:39612194-39612216 CAAGAAAGTGTGTGTGAGACAGG - Intronic
950515729 3:13463847-13463869 CACCACAGAGAGTCAGAGACAGG - Intergenic
951596237 3:24321165-24321187 CTACACATTGAGATGGAGACTGG - Intronic
953495076 3:43378832-43378854 CAACACAGTAAGTGTTAGGCAGG + Intronic
955678394 3:61473764-61473786 CACCACTGTGTTTTTGAGACAGG - Intergenic
956995718 3:74824675-74824697 GTACACAGTGGGATTGAGACCGG - Intergenic
959798784 3:110464848-110464870 GAAAAAAGTGAGTTTGAGATGGG - Intergenic
961622987 3:128239401-128239423 CAACACAGTAAGTTGGAGGAGGG - Intronic
963674543 3:148292873-148292895 CAACACAGTGTATGTGAGGCAGG - Intergenic
964038306 3:152225974-152225996 CATCACAGTGAATATTAGACTGG - Intergenic
966618884 3:181942691-181942713 CAACACAGAGATTTAAAGACAGG + Intergenic
967254513 3:187576102-187576124 CAAGACAGTGACTTTGTTACTGG - Intergenic
969268427 4:6081422-6081444 CAGCACAGTGAATGTGAGACAGG + Intronic
969524831 4:7699130-7699152 CCACACACTGAGTTTCAGCCAGG - Intronic
969697796 4:8744948-8744970 CAATACCGTGAGTTGGAGGCAGG - Intergenic
977801819 4:101243370-101243392 CAGCACAGGGAGTTACAGACTGG + Intronic
983550498 4:169012288-169012310 GAACACTGTTATTTTGAGACAGG - Intergenic
984476642 4:180243792-180243814 TAACACAGTGATTTTTACACTGG - Intergenic
984605216 4:181777921-181777943 AAATACAGCTAGTTTGAGACAGG + Intergenic
986506917 5:8461650-8461672 CTACACAGAAAGTTGGAGACAGG - Intergenic
986784882 5:11105094-11105116 CATCACAGTGACTTTGGGAAGGG - Intronic
987772136 5:22319167-22319189 CAGCACTGTGAGTTAGAGAAAGG + Intronic
989627959 5:43450238-43450260 CAACACTGTGAGGCTGAGATGGG - Intronic
989747798 5:44851999-44852021 CAAGACACTGATTTTGAGATTGG - Intergenic
991354256 5:65751206-65751228 CAACACAGTGACATGGTGACAGG + Intronic
996772638 5:127101236-127101258 TAACCCTGAGAGTTTGAGACTGG - Intergenic
996884793 5:128342090-128342112 GAACAGAGAGAGTTAGAGACAGG + Intronic
996886462 5:128360947-128360969 CCACACAGTGAGATTTAAACAGG + Intronic
1006708172 6:36040232-36040254 GTATACAGTGAGTTGGAGACAGG - Intronic
1010621722 6:78085275-78085297 CAATAATGTGATTTTGAGACCGG + Intergenic
1011883556 6:92061750-92061772 CAGCTAAGTGATTTTGAGACTGG - Intergenic
1011965901 6:93156942-93156964 GAGCACAGTGAGGGTGAGACTGG - Intergenic
1014889022 6:126819271-126819293 CAACACTTTGAGTTTGAGGTGGG + Intergenic
1016558535 6:145368320-145368342 CAACACAGTGTGATAAAGACAGG + Intergenic
1020438395 7:8190114-8190136 AAACACAGTGAATGTCAGACAGG - Intronic
1023656765 7:42430867-42430889 CAATATATTGAGTTTGAAACGGG - Intergenic
1026922360 7:74165541-74165563 CACAACAGGGAGGTTGAGACAGG + Intergenic
1028261651 7:88674016-88674038 GGACACAGTGAGAGTGAGACTGG + Intergenic
1028947772 7:96600547-96600569 CAACTCAGTGAGTGTGAGTAAGG + Intronic
1029819526 7:103132496-103132518 TGACCCAGTGAGTTTGAGAAGGG + Intronic
1029946070 7:104534300-104534322 TAGCTCAGTGTGTTTGAGACAGG + Intronic
1033946859 7:146729295-146729317 GATCACAGTGAGTTTTAAACAGG + Intronic
1036385270 8:8273864-8273886 CAAGAAACTGAGCTTGAGACTGG - Intergenic
1039248539 8:35635876-35635898 CACCTCAGTGAGTCTGAGAGAGG - Intronic
1039403274 8:37291376-37291398 CAGCACAGAGAGTCTGAGGCTGG - Intergenic
1040008587 8:42641966-42641988 CAAGAAAGGGAGTTTGACACAGG - Intergenic
1040110524 8:43565141-43565163 CAACACAGGGACATTGAGGCAGG - Intergenic
1040844097 8:51817863-51817885 ACATACAGTGAGTTAGAGACAGG - Exonic
1043629439 8:82310466-82310488 CAACAAAGTGAATATGAGAAAGG + Intergenic
1045746076 8:105423823-105423845 AAAGACAGTGAGTTTCAGAGTGG + Intronic
1047651515 8:126927796-126927818 CAAAACAGTGAGGTTCAGAGTGG + Intergenic
1048423317 8:134298459-134298481 CAACACAGTCAGGCTGAGGCTGG + Intergenic
1050039541 9:1474807-1474829 CTACTCAGTGAGCTTGAGATGGG + Intergenic
1050554382 9:6776583-6776605 AAAAAAAGTGGGTTTGAGACAGG - Intronic
1054830968 9:69624197-69624219 CAATACAGTGAGTTTTAAATAGG + Intronic
1055499988 9:76893798-76893820 CACCACAGTGAGTTTATGTCTGG + Intronic
1055586880 9:77764137-77764159 CAAGAAAGTGAGATTGAGTCAGG + Intronic
1056320215 9:85428769-85428791 CAACCCATGCAGTTTGAGACTGG + Intergenic
1057632394 9:96730809-96730831 CAACACTGGGAGGCTGAGACAGG - Intergenic
1059101644 9:111477694-111477716 CAACCCTGTGAGTTTGGTACTGG - Intronic
1059630129 9:116112979-116113001 CAACACAGAAAGTTTGTAACAGG - Intergenic
1059826856 9:118040005-118040027 CAACAAAGAGAATATGAGACAGG - Intergenic
1203486628 Un_GL000224v1:61923-61945 GATCACAGTGAGTTTGTTACTGG - Intergenic
1203499250 Un_KI270741v1:3823-3845 GATCACAGTGAGTTTGTTACTGG - Intergenic
1203653937 Un_KI270752v1:5553-5575 CTACATAGTGAGTTCCAGACAGG + Intergenic
1186824730 X:13328287-13328309 CATCACAATGAGTATGATACAGG + Intergenic
1187677535 X:21732666-21732688 CAATTCAGTAAGTTTGTGACAGG + Intronic
1190076075 X:47318087-47318109 CAACACAGGGAGGCTGAGACGGG + Intergenic
1192168235 X:68839282-68839304 TCACACAGTGAGTTAGAGATAGG + Intronic
1195524166 X:105866953-105866975 TAACACAGTGTGTTGCAGACAGG + Intronic
1196686727 X:118516459-118516481 CAACAGAGCGAGTGTGAGAGAGG - Intronic
1198050734 X:132951106-132951128 CAAAACAGAGAGGTTGAGAAGGG - Intronic
1199829565 X:151535814-151535836 CATCCCAGTGAGTTTCAGGCAGG - Intergenic