ID: 1119851930

View in Genome Browser
Species Human (GRCh38)
Location 14:77872486-77872508
Sequence TTCTTGAAGAAGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 471}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119851921_1119851930 10 Left 1119851921 14:77872453-77872475 CCCTAAAAGCCAATCATAAGGTG 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 55
4: 471
1119851919_1119851930 18 Left 1119851919 14:77872445-77872467 CCTGTGTTCCCTAAAAGCCAATC 0: 1
1: 0
2: 1
3: 13
4: 116
Right 1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 55
4: 471
1119851922_1119851930 9 Left 1119851922 14:77872454-77872476 CCTAAAAGCCAATCATAAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 55
4: 471
1119851918_1119851930 25 Left 1119851918 14:77872438-77872460 CCTCTGACCTGTGTTCCCTAAAA 0: 1
1: 0
2: 1
3: 21
4: 339
Right 1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 55
4: 471
1119851925_1119851930 1 Left 1119851925 14:77872462-77872484 CCAATCATAAGGTGGCTGAGGAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 55
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119851930 Original CRISPR TTCTTGAAGAAGAGGGAAGT GGG Intronic
901189632 1:7401434-7401456 TTTTTGAAAAAGAATGAAGTTGG - Intronic
902764970 1:18607991-18608013 TTCTGGAAGAGGAGGGAAGGTGG - Intergenic
902943799 1:19819285-19819307 TTCTTGAAGAGGAGTGAATATGG + Intergenic
903157679 1:21459260-21459282 GTCTTGAAGAAGCAGTAAGTTGG + Intronic
903163318 1:21504327-21504349 GGATTGAAGATGAGGGAAGTAGG - Intergenic
903980290 1:27181695-27181717 TTGTTTAAAAAGAGGGATGTCGG + Intergenic
904864090 1:33562809-33562831 CCCTGGAAGAAGAGGGAATTCGG + Intronic
906301415 1:44684763-44684785 TGCATGAAGAGGAAGGAAGTTGG + Intronic
906617697 1:47245631-47245653 TTCCTGAAGAAAAGGAAAGTGGG + Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908094177 1:60719791-60719813 TTCTAGAAGAAGAGTGTAGCTGG - Intergenic
908110696 1:60894582-60894604 TGCTGGGAGAAGAAGGAAGTAGG + Intronic
908339652 1:63163546-63163568 TCCTAGAAGATGAGGGAAGGAGG - Intergenic
908666350 1:66495591-66495613 CTTTTGAAGAAGAGGAAAGCAGG - Intergenic
910458342 1:87422125-87422147 TCCTTAAAGAAGAGGAAATTTGG - Intergenic
912405084 1:109430906-109430928 TTTTATAAGAAGAGGGAATTTGG + Intergenic
912501451 1:110125215-110125237 ATCTTGGAGAAGGGGGCAGTGGG + Intergenic
912623089 1:111185387-111185409 TGCTTGAAGAAGAGGGACACAGG + Intergenic
912996596 1:114537436-114537458 TTCTTTAAGAAGGGAGACGTGGG + Intergenic
913575118 1:120164427-120164449 TACTAGAAGAGGAGGGAAGGAGG - Intronic
914557423 1:148780068-148780090 TACTAGAAGAGGAGGGAAGGAGG - Intergenic
914615411 1:149350162-149350184 TACTAGAAGAGGAGGGAAGGAGG + Intergenic
915064997 1:153217606-153217628 TTGTTGAAGATCAGGTAAGTGGG + Exonic
919848904 1:201659266-201659288 TTCCTGAAGGAGCCGGAAGTTGG + Intronic
919943081 1:202301702-202301724 TTTTTGAAGAAGTGGGACTTGGG - Intronic
920938416 1:210457528-210457550 TTCCTGAAGCTGAGGGAATTGGG + Intronic
921780788 1:219160856-219160878 ATTTAGAAGAAGAGTGAAGTAGG - Intergenic
922277756 1:224095001-224095023 TTCTTTAATAAGAGGGAATAAGG - Intergenic
922346307 1:224699585-224699607 TCCTTAAAGAAGAGGAAATTAGG - Intronic
922374624 1:224949469-224949491 GTCTGGAAGAAGAGAGAAATGGG - Intronic
922793949 1:228329091-228329113 ATCTTGAAAAAGAAGGAAGTTGG - Intronic
922794652 1:228334080-228334102 TTTTTGAACAATAAGGAAGTAGG - Intronic
924861195 1:247924312-247924334 TTCTGAAAGAATATGGAAGTTGG - Intergenic
1063676640 10:8146295-8146317 ATCTCAAAGAAGAGGGAGGTAGG - Intergenic
1064237457 10:13588647-13588669 GTGTTGAAGAAGAGAGAAGGAGG - Intronic
1064559077 10:16578009-16578031 TTTTTGAAGTAGATGGAAATTGG - Intergenic
1064694941 10:17955637-17955659 GTCTGAAAAAAGAGGGAAGTAGG + Intronic
1066248705 10:33611959-33611981 TTCTTGAAGTGGAGGCAAGTTGG + Intergenic
1067139478 10:43644706-43644728 TTCTTTCAGAAGAGAGAAGCTGG - Exonic
1067540495 10:47147653-47147675 TACTTCAAGAAAAGGGCAGTTGG - Intergenic
1067796059 10:49323066-49323088 TTCTGGAAGAGGAGCGAATTTGG - Exonic
1068065939 10:52131417-52131439 TCCCTGAAGAAGAGGTACGTAGG + Intronic
1068080858 10:52315272-52315294 ATCGGGAAGAAGAGAGAAGTTGG + Intronic
1069033196 10:63619292-63619314 TTCATGAAGAGGAGGAAAGGTGG + Intronic
1069200802 10:65613425-65613447 TTAATGAAAAAGAGGGAAGCAGG - Intergenic
1069843465 10:71354669-71354691 TTCCTGAAGAGGTGGGAAGAAGG - Intronic
1069991746 10:72320511-72320533 TTCTTAAAGAGAAGGGAACTGGG + Intergenic
1070515371 10:77200498-77200520 TTCTTTAGGAAGAGGGGATTAGG + Intronic
1070852499 10:79577763-79577785 ATATTGAAGAAGAGTAAAGTTGG + Intergenic
1073208327 10:101780250-101780272 AACTTGAGGAAGAGGGAGGTTGG + Intronic
1073910886 10:108343250-108343272 TTCTTGAATCTGAGGGAAATAGG - Intergenic
1074156403 10:110804061-110804083 TTGTTGAAGGAAAGGGAAGGGGG - Intronic
1074276672 10:112009098-112009120 TTTTTAAAGATGAGGGAACTGGG - Intergenic
1074486155 10:113883105-113883127 ATCTTGAAAAAGAAGAAAGTGGG - Intronic
1076758707 10:132589344-132589366 TTCTTGAGGCAAAGGGAAGGTGG + Intronic
1076863495 10:133155122-133155144 TTCTTGAAGAAGAAGGAGGTGGG + Intergenic
1077452491 11:2657163-2657185 TTCTTGAAGAAGAACAAGGTGGG - Intronic
1077549588 11:3194168-3194190 TCCCTGGAGAAGAGAGAAGTGGG - Intergenic
1078669537 11:13352807-13352829 GTTTTGCAGATGAGGGAAGTTGG + Intronic
1079545817 11:21630506-21630528 TTCTGATAGAAGAGCGAAGTGGG - Intergenic
1082639629 11:55642139-55642161 TTTTTCAAGAAAAGTGAAGTGGG + Intergenic
1082664311 11:55955531-55955553 CTCTTGAAGAAGAGTAAAGAGGG - Intergenic
1082976502 11:59077421-59077443 TTGAAGAAGAAAAGGGAAGTGGG - Intergenic
1084327627 11:68410972-68410994 TGCTAAAAGAAGAGGGAAGGAGG + Intronic
1084349017 11:68580593-68580615 TAGTTGAAGAAGAGTGAAGGTGG + Intronic
1085039644 11:73319360-73319382 TTCTTAAAGAAGGAGGAAGGAGG - Intronic
1087007423 11:93483418-93483440 TTCTTGAAGTAGAGGCCAGTTGG - Intronic
1087413714 11:97825349-97825371 TTCATGAAGAAGATTGAAATTGG - Intergenic
1087647311 11:100823204-100823226 TTTTTGAAGAAGAAAGAACTGGG + Intronic
1088175173 11:107045360-107045382 TTCCAGAAGTAGAGGGAACTGGG + Intergenic
1089026004 11:115270461-115270483 TTCTGGAAGAAAAGGGGAGGGGG - Intronic
1089201627 11:116728008-116728030 TTCTTTGAGAAGAGGGATCTAGG - Intergenic
1090195728 11:124815371-124815393 GTCTTGAAAAAGAGCAAAGTTGG - Intergenic
1090226942 11:125077354-125077376 TTCTCGAGGAAGAGGGAATGGGG - Intronic
1090246028 11:125216540-125216562 CTTTTGAAGAAGAGGGAAAGGGG - Intronic
1090281335 11:125458588-125458610 TTCTGAAAGAAAAGGGAGGTGGG - Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091431650 12:440705-440727 TTCGTGAGGAAGAGGGAATGAGG + Exonic
1091546981 12:1507775-1507797 TTTTTCAATCAGAGGGAAGTTGG - Intergenic
1091590461 12:1839733-1839755 GTCTCGTATAAGAGGGAAGTGGG - Intronic
1091684833 12:2554368-2554390 TTCTTGAAGAAGAGCGAGGAGGG - Intronic
1092838653 12:12516944-12516966 TTACTGAAGGAGAAGGAAGTGGG - Intronic
1092948457 12:13478042-13478064 TTCTTGAAGAAGAACGAAGCTGG + Intergenic
1093199937 12:16174506-16174528 TGCTTAAAGAAGAGGAAACTTGG - Intergenic
1094016451 12:25870019-25870041 TACTTGCAAAAGAAGGAAGTTGG + Intergenic
1094063627 12:26340833-26340855 CACTTGAGGAAGAGGGAAGTGGG + Intronic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1094554543 12:31485290-31485312 TGCTTGAAGAAGTGGTCAGTTGG - Intronic
1094678201 12:32642794-32642816 TTCTTTAATAAGAGAGAAGCGGG - Exonic
1095143339 12:38693802-38693824 TTCATGTAGTGGAGGGAAGTGGG + Exonic
1095929106 12:47607925-47607947 TTCTTCAAGACAAGGGAAGAAGG - Intergenic
1096011198 12:48216917-48216939 TTGCTGAAGAAAAGGGAAATGGG + Intergenic
1096066086 12:48741937-48741959 TTGATGAAGAATAGGGTAGTTGG - Intergenic
1096393280 12:51246381-51246403 TTCTTAAAGAAACGGGAAGGAGG + Intronic
1097349342 12:58531242-58531264 GTCTTGGAGGAGAGGGAAATGGG - Intergenic
1098568812 12:71966078-71966100 TTCTTGAATAAGAAGGAAAGGGG + Intronic
1098658295 12:73060537-73060559 TGCTTGAAGAAAAAGGAGGTTGG - Intergenic
1098796951 12:74901092-74901114 TTCTTTAACAACGGGGAAGTGGG - Intergenic
1100206640 12:92356930-92356952 TACTTGAAGATGAGACAAGTTGG - Intergenic
1100586922 12:95989049-95989071 TGCTTGAGGATGTGGGAAGTGGG + Intronic
1100835460 12:98562961-98562983 ATCTTGAAGAAGAGCAAAGTTGG + Intergenic
1102591193 12:113958049-113958071 TTCTGGAAAAACAGGGAAGCTGG + Exonic
1102653089 12:114457149-114457171 TTCTAGAAGAATATGGAAATGGG + Intergenic
1102910351 12:116708884-116708906 CCCTTGCAGAAGAGGGAACTGGG - Intergenic
1102936434 12:116901092-116901114 TGTTTTAGGAAGAGGGAAGTGGG + Intergenic
1104599746 12:130144632-130144654 GTCTTAAAGGAGAGGGATGTTGG + Intergenic
1105238354 13:18583666-18583688 ATCTTGAAAAAGATTGAAGTTGG - Intergenic
1105280964 13:18962390-18962412 TTCTTGATGTGGAGGGAAGGAGG - Intergenic
1106300011 13:28455198-28455220 ATATTGAAGAAGAGCAAAGTTGG + Intronic
1107574074 13:41697886-41697908 AGATTGAATAAGAGGGAAGTAGG - Intronic
1107985317 13:45770914-45770936 TTCCTAGGGAAGAGGGAAGTGGG + Intergenic
1107996481 13:45865849-45865871 CCCTTGAAGAAGCGGGAATTCGG - Intergenic
1108558352 13:51619128-51619150 TTTTTGAAGATGGAGGAAGTAGG - Intronic
1108960286 13:56218287-56218309 TTCTTCTAGAAGTGTGAAGTGGG + Intergenic
1109262008 13:60156430-60156452 TTCATAGGGAAGAGGGAAGTGGG + Intronic
1109704915 13:66077730-66077752 TCCTTGAATAAGGGGAAAGTTGG + Intergenic
1111325286 13:86686348-86686370 TGATTGAAGAAGAGGGCAGGAGG + Intergenic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112360004 13:98708744-98708766 TCCTTGAAGAAGATGGCAGTTGG - Exonic
1113196758 13:107817543-107817565 TTCTTTAAGAGGAGGGAATTGGG - Intronic
1113934004 13:113983836-113983858 TTCTTCAAGACGAGGGAAGAAGG + Intronic
1113934357 13:113985834-113985856 TTCTTCAAGACGAGGGAAGAAGG + Intronic
1113934701 13:113987824-113987846 TTCTTCAAGACGAGGGAAGAAGG + Intronic
1114260492 14:21033041-21033063 TTCTGGAAGAGAAGGGAAGCAGG + Exonic
1114298773 14:21355056-21355078 TAAGTGAAGAAGAGGGAAATTGG - Intronic
1114306168 14:21425098-21425120 GTTTTGAAGATGAGGGACGTTGG - Intronic
1114412191 14:22511714-22511736 TCCTTGAAAAGGAGGGAAATAGG + Intergenic
1115036888 14:28868756-28868778 TTCTTGGAGAAGAGTGTTGTAGG + Intergenic
1115070035 14:29310484-29310506 TTATTGAAGAAGATTAAAGTGGG + Intergenic
1116495696 14:45557372-45557394 GCCTTGAAGTGGAGGGAAGTGGG + Intergenic
1116721443 14:48501451-48501473 TTCTTGAAAAAATGGGAATTTGG + Intergenic
1116909981 14:50451282-50451304 TACATGAAGAAGAGTGTAGTGGG + Intronic
1116944017 14:50818990-50819012 TTCTTGAAAAAGAAGTAAGATGG - Intronic
1117556039 14:56884924-56884946 TTCTGGAAGGAGAGGGATGGGGG - Intergenic
1118778414 14:68989156-68989178 GTCTTGAAGAAAAGGCATGTGGG - Intergenic
1119584880 14:75823872-75823894 TTGTTGAATAAGAGGGCAGAAGG - Intronic
1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG + Intronic
1120415789 14:84216704-84216726 TTCTTCAAGATAAGGGAAGAAGG + Intergenic
1120434680 14:84466342-84466364 TTCTTTAAGATGAGGAAAGAGGG + Intergenic
1124088634 15:26577111-26577133 TTCTAGAAGAAGAGAGAATGGGG + Intronic
1124146442 15:27130485-27130507 GTCTTGAAGAAGAACAAAGTTGG - Intronic
1124146977 15:27136939-27136961 CTCTTGGAGAAGAGGCAAGTGGG - Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1126534757 15:49749482-49749504 TTATTGAAGAAGATTGGAGTAGG - Intergenic
1126808932 15:52381275-52381297 TTCTGGAAGAAGTGGGAAGCAGG - Intronic
1128214752 15:65926582-65926604 TTCTTGAGGCAGAGGTGAGTGGG + Intronic
1128230446 15:66031057-66031079 TTGTCCAAGCAGAGGGAAGTGGG + Intronic
1128341409 15:66825039-66825061 ATCTTGAACAAGAAGGAAGAAGG + Intergenic
1128744821 15:70106112-70106134 TTCTGGAAGTAGAGAGAAATGGG + Intergenic
1129096135 15:73210352-73210374 TTCTTGAACAAAAGGAAAATTGG - Intronic
1129105016 15:73301163-73301185 TACTGGAATAAGAGGGAAGGAGG - Intronic
1129450106 15:75646944-75646966 ATCTTCGAGAAGAGGCAAGTGGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130294669 15:82637070-82637092 TTGATGCAGAAGAGGGAACTTGG + Intronic
1130677541 15:85966824-85966846 TTCTCTAAGAAGAGGCAAGATGG - Intergenic
1130893699 15:88154159-88154181 CTCTTGGAGAAGTGGGCAGTAGG - Intronic
1131031862 15:89193124-89193146 TTTTTGAAGCAAAGGGAAGAGGG - Intronic
1131149462 15:90037767-90037789 TGCTTAAAGATGAGGGATGTCGG + Intronic
1131384255 15:91990114-91990136 TGCTTTAAGATGAGGGAAATGGG + Intronic
1131596927 15:93807497-93807519 ATCTTGAAGAAGAGGGACCCAGG - Intergenic
1134662577 16:15995464-15995486 GGCTTGAAGAAGAAGAAAGTGGG - Intronic
1135388479 16:22067266-22067288 TTCCTGAAGAAGAGAGAAAAAGG + Intronic
1135472691 16:22745660-22745682 TTCTTTAAGCAGAAGGAAGCAGG - Intergenic
1137475342 16:48803370-48803392 CTATGGAGGAAGAGGGAAGTGGG + Intergenic
1137488290 16:48909665-48909687 TTCTGGAAAGAGAGGGAAGGAGG + Intergenic
1137749676 16:50850303-50850325 TACATAAAAAAGAGGGAAGTCGG - Intergenic
1138353159 16:56357498-56357520 TTCTGGCAGGAGAGGGAAGGAGG + Intergenic
1138908384 16:61366328-61366350 TTTTGGAATAAGAGGTAAGTAGG - Intergenic
1138908456 16:61367245-61367267 TTCTGGAATAAGAGGTAAGTAGG - Intergenic
1139011037 16:62634314-62634336 TACTTGAAGAGGAGGGAATGAGG - Intergenic
1139285400 16:65809005-65809027 TTCTATAAGAAGAGGAAATTTGG + Intergenic
1139341042 16:66267990-66268012 TGCATGAGGAAGAGGGAAGCGGG + Intergenic
1139748014 16:69089953-69089975 ATCTTGAAGAACAGGGAGGCAGG + Intergenic
1139914111 16:70417724-70417746 TTCTGGAGGAAGTGGGAAGTGGG + Intronic
1140405977 16:74711838-74711860 TTCTTTAAGAAGAGTGAAACAGG - Intergenic
1141201794 16:81903880-81903902 TTCTTGAAATAGAAAGAAGTGGG - Intronic
1141760449 16:86025663-86025685 TTCTTGAAGAAAGGAGAAGCAGG + Intergenic
1144561782 17:16326529-16326551 TTTTTGGAGAAGTAGGAAGTAGG + Intronic
1146105217 17:30028861-30028883 TTCTTAAAGAAGAGGAAATTTGG - Intronic
1147140074 17:38455723-38455745 TTCTGGTAGGAGAGGGCAGTTGG + Intronic
1148541176 17:48481887-48481909 TTCTTGAATGAGAGTGGAGTGGG + Intergenic
1148544341 17:48505612-48505634 TTCTTATAGGAGAGGGAATTCGG + Intergenic
1148946852 17:51270166-51270188 TTCTTAAAGAAAAGGGAAGAAGG - Intronic
1149590621 17:57827269-57827291 TTCATGAGCAAGAGGGAAGCAGG + Intergenic
1150518064 17:65835609-65835631 TTTTTGAAGAATAGTGAAGTTGG - Intronic
1151458857 17:74242858-74242880 TTCTAGAAGCAAAGGGAAGCAGG + Intronic
1152506269 17:80750774-80750796 TTTTTAAACAAGAGGGAAGAGGG - Intronic
1152987820 18:335541-335563 TACTTAAAGAAGAGGGGATTAGG + Intronic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1153351091 18:4081891-4081913 TTCTTAAGGAAAAGGGAAATGGG - Intronic
1153759756 18:8319278-8319300 TTCCTGAAGGAGGGTGAAGTGGG - Intronic
1153922223 18:9802118-9802140 ATCTTGAAAAAGAACGAAGTTGG - Intronic
1154511745 18:15111507-15111529 ATCTTGAAAAAGATTGAAGTTGG - Intergenic
1155318410 18:24594831-24594853 TCCTATAAGAAGAGGGAATTTGG + Intergenic
1155684183 18:28527428-28527450 TTCTGAAAGAAGAGCAAAGTTGG - Intergenic
1157215103 18:45775890-45775912 TTCTTGAAGGGGAGGGAGGGAGG + Intergenic
1157403852 18:47407644-47407666 ATCCTGAAGAAGAGGGAGGCAGG - Intergenic
1157434538 18:47657428-47657450 TTCTGGAAAGAGAGGGAATTTGG + Intergenic
1157603699 18:48912193-48912215 TTCTTGGGGAAAAGGGAATTTGG + Intergenic
1157804048 18:50644911-50644933 TTCTAGAAGAGGATGGAGGTGGG - Intronic
1157993824 18:52530612-52530634 TTCTTGAAGTACAGTGGAGTAGG - Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158425929 18:57339572-57339594 TTCAGGAGGAAGATGGAAGTGGG + Intergenic
1159434573 18:68399119-68399141 TTCCTGAAGAAGAAGTAACTGGG + Intergenic
1159719939 18:71876213-71876235 TTCTTAAAAAATAGAGAAGTTGG + Intergenic
1160006233 18:75071061-75071083 TTTTTGAAAAAGGTGGAAGTAGG - Intergenic
1161899764 19:7109737-7109759 TTCTTGGAGAACAGGGAACTTGG + Intergenic
1162476478 19:10903305-10903327 GTCTTGAAAAAGAATGAAGTTGG - Intronic
1162933766 19:13970305-13970327 TTCTTGGAGAGGATGGCAGTAGG - Intronic
1164436575 19:28235791-28235813 TGATTGAAGAAGAAGTAAGTGGG + Intergenic
1164846282 19:31435541-31435563 GTCTTGAAGGAGAGGTAATTAGG + Intergenic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166566509 19:43768917-43768939 GTCTTGAAGAAGGGGGAGGTTGG - Intronic
1166687882 19:44807039-44807061 TTCTTGAGGGAGGTGGAAGTGGG + Intergenic
1167280044 19:48561803-48561825 ATTTTGGAGAAGAGGGGAGTGGG - Intronic
1167400380 19:49263632-49263654 ATCTTGAAGAAGACCAAAGTTGG + Intergenic
925095850 2:1201350-1201372 TTCATGAAGTAGAGGGTAGAAGG + Intronic
925631727 2:5900942-5900964 TTCCAAAAGAAGAGGGAATTGGG + Intergenic
925988310 2:9233808-9233830 TGTTTAAAGAAGAGGGGAGTGGG + Intronic
926373082 2:12199937-12199959 TTCTGGAAGAAGACAGAAGACGG + Intergenic
927991130 2:27447921-27447943 TTCTAGAGGTAGAGGGAAGAAGG + Exonic
928165132 2:28965717-28965739 CTCTTAGAGAAGAGGGAGGTAGG - Intronic
928408462 2:31033402-31033424 GGCTTGAAGAAGAGAGAATTGGG - Intronic
928431223 2:31219914-31219936 TTCTAGAAGAAGTGGGAAGTAGG - Intronic
928974127 2:37065765-37065787 TTCTTGAATAAGAGGGGATGCGG + Exonic
929891701 2:45923793-45923815 TTCTAGGAGCAGAGGGAAGGAGG + Intronic
929913078 2:46109137-46109159 TTACTGAAGAAGAAGAAAGTTGG - Intronic
930197217 2:48521920-48521942 TTCCTGAAGAAGATGGAAGTTGG - Intergenic
931013367 2:57944815-57944837 TTCTTGAAAAAAAGGGAACAAGG - Intronic
931025793 2:58112679-58112701 TTCATATGGAAGAGGGAAGTGGG + Intronic
931791403 2:65667098-65667120 TTCATGAAGAAGAACGAAGAAGG + Intergenic
932918539 2:75883438-75883460 TCCTCCAAGAAAAGGGAAGTAGG + Intergenic
933332474 2:80911710-80911732 TTGTTGAAGTAGAGGGACATGGG + Intergenic
933845287 2:86321176-86321198 TGCTAGAAGAAGAGGGGAGAAGG + Intronic
935732971 2:106079934-106079956 ATCTTAAAGAGGAGTGAAGTGGG + Intergenic
935995824 2:108771814-108771836 TTCTTGTAGCAGAAGAAAGTTGG - Exonic
936093747 2:109516619-109516641 TTACTGAAGAAGTGGGAAGGAGG + Intergenic
937077963 2:119120821-119120843 CTCTGGGAGAAGAGGGAAATTGG + Intergenic
937292663 2:120790899-120790921 TTCTTGGAGAAGAAGAAAATGGG + Intronic
938256599 2:129864153-129864175 TTCTTGAGGAAGAAGGGAGATGG + Intergenic
938511317 2:131948264-131948286 ATCTTGAAAAAGATTGAAGTTGG - Intergenic
938836544 2:135109116-135109138 ATATTGAAGAAGAAGAAAGTTGG - Intronic
939126394 2:138182778-138182800 CTCTTGGAGACGAGGGAAATAGG - Intergenic
939854806 2:147345341-147345363 TTCTTGGAGCAGAGAGAACTGGG - Intergenic
939983089 2:148804140-148804162 ATCTTGAAAAAGATGAAAGTTGG - Intergenic
940847478 2:158657181-158657203 TTCCTGAGTAAGAGGAAAGTAGG - Intronic
942705904 2:178771763-178771785 CTTTTGAAGAAGAAGGAATTGGG - Intronic
943094172 2:183408798-183408820 TTCTCTAAGAAAAGGGAGGTTGG + Intergenic
943448087 2:188015002-188015024 TCCTTTAAGAAGAGGAAATTTGG - Intergenic
944316050 2:198286839-198286861 TCCCTGAGGAAGAGGGAATTTGG + Intronic
944611884 2:201418475-201418497 TTTTTGAAAAAGAGTAAAGTTGG + Intronic
946335654 2:219034309-219034331 ATCTTGAAGAAGAATTAAGTAGG + Intronic
946496703 2:220202684-220202706 CTCTTCAAGAAGAAGGAAGCTGG - Intergenic
946861720 2:224006328-224006350 TTCTTGAAAAAGAGAAGAGTTGG - Intronic
948056229 2:235010959-235010981 TTCTCCTAGAAGAGGGAAGAAGG - Intronic
948139762 2:235663765-235663787 TTCTCAAAGCACAGGGAAGTCGG - Intronic
948723739 2:239919394-239919416 TTCTAGAAGGAGACAGAAGTAGG - Intronic
1168853886 20:995382-995404 AGCTTACAGAAGAGGGAAGTTGG - Intronic
1169595014 20:7188559-7188581 TTCTTGAAGCTGAAAGAAGTAGG + Intergenic
1169875630 20:10294175-10294197 TTCTTTTAGAAGGGGGAAGTGGG - Intronic
1169990071 20:11492671-11492693 TTCTTAAGGGAAAGGGAAGTGGG - Intergenic
1170207189 20:13811145-13811167 AGCTGGAAGAAAAGGGAAGTGGG + Intronic
1170777868 20:19393908-19393930 ATCTTGAAAAAGAATGAAGTTGG + Intronic
1171003626 20:21440664-21440686 ATCTTGAAGAAGAACAAAGTAGG - Intergenic
1171021817 20:21591389-21591411 TTCTCTAAGAACAGGTAAGTAGG - Intergenic
1172678055 20:36689254-36689276 TTCTGGAAGAATTGGAAAGTAGG - Intronic
1174465228 20:50712138-50712160 TTCTTGATGAAGAGGGAGGTGGG + Intergenic
1174882425 20:54294825-54294847 GACTTGGAGAAGAGGGAAGTGGG - Intergenic
1175476980 20:59283205-59283227 TTCTTTAAAAAAAGGGTAGTGGG - Intergenic
1175614667 20:60386782-60386804 ATCTTGAAAAAGAAGGAAGTAGG + Intergenic
1175740554 20:61417145-61417167 TTTCTGAAGAAGAAGGAAATAGG - Intronic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1176677848 21:9797306-9797328 CTTTTGAAGAAAATGGAAGTAGG - Intergenic
1176782343 21:13211955-13211977 ATCTTGAAAAAGATTGAAGTTGG - Intergenic
1177492830 21:21849658-21849680 TTTTTGAAGAATAGAGAAGATGG - Intergenic
1177819741 21:26017772-26017794 TTCTTGAAGAACAGAAAATTAGG + Intronic
1177844366 21:26271665-26271687 TTCTGGAAGAAGCTGGGAGTTGG - Intergenic
1177980157 21:27903665-27903687 ATCTTGAAAAAGATTGAAGTTGG + Intergenic
1178503962 21:33148318-33148340 TTCTAGAAGTTGAGGCAAGTGGG - Intergenic
1179806563 21:43841879-43841901 GTCTTGAAAAAGAAGAAAGTTGG - Intergenic
1179954546 21:44730956-44730978 TTCTTCAAGACAAGGGAAGAAGG - Intergenic
1180910498 22:19446986-19447008 TTCCTGAAGCAGAGGGTAGGTGG - Intronic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1181163081 22:20968970-20968992 TTCTTGGAGCAGAGGCAAGTGGG - Intronic
1181670389 22:24423238-24423260 TTCTTAAAAAAGAGGGAGGCTGG + Intronic
1181905790 22:26194923-26194945 TTCTGGAAGCTGAGGGAACTTGG - Intronic
1181907529 22:26211143-26211165 TTCTTGAAGAAGAGAGCTCTGGG + Intronic
1182686746 22:32126652-32126674 TATTTAGAGAAGAGGGAAGTAGG + Intergenic
1182954403 22:34407789-34407811 ATGATGAAGAAAAGGGAAGTAGG + Intergenic
1183514828 22:38259045-38259067 TCCTGGAAGAGGAGGGAGGTGGG - Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
949675126 3:6444789-6444811 TTCAAGAAGTAGAGGGACGTGGG - Intergenic
949781683 3:7696370-7696392 TTCTTGAAAAGGAGGCAAGATGG + Intronic
950208755 3:11101353-11101375 GTCTTGAAGAAGAACAAAGTTGG - Intergenic
950945363 3:16940208-16940230 TTTTTGAAGAAGAGGCAGGAAGG - Intronic
951221063 3:20069426-20069448 TTCTTGTTAGAGAGGGAAGTGGG + Intronic
952807099 3:37366097-37366119 ATCTTGAAGAAGAGTGACATTGG + Exonic
953038251 3:39232108-39232130 TCCTTGAGGAAGAGGCAAGAGGG + Intergenic
954543637 3:51414366-51414388 TTCTTGGAGAACTGGGAGGTAGG + Intronic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
954863112 3:53706467-53706489 TTCTTGCAGACAAGGAAAGTGGG - Intronic
955044404 3:55346445-55346467 TTCTAAAAGATGAGGGAAGCAGG + Intergenic
955847381 3:63180126-63180148 TTCTTCAAGGATAGAGAAGTTGG - Intergenic
955871536 3:63443404-63443426 TTCTTTCAGGAGAGGGAAGTTGG + Intronic
956861263 3:73326362-73326384 TTCTTGCAGAAGAAGTAAGTTGG + Intergenic
957770654 3:84687712-84687734 GTTTTTAAGAAGAGGGAAATTGG - Intergenic
958205866 3:90390733-90390755 TTCTTGTAGAATCGGCAAGTGGG - Intergenic
959166597 3:102787518-102787540 TTCCTGAAGAAGAGTGAAGCAGG - Intergenic
959248267 3:103903812-103903834 TTCTTGAAGAAGGCAAAAGTAGG - Intergenic
959416474 3:106081356-106081378 TTCTTCAGAAAGAGGGAAGTGGG - Intergenic
960112670 3:113860577-113860599 ATCTTGAAAAAGAATGAAGTTGG + Intronic
960615193 3:119590162-119590184 ATCTTGAAGAAGAGTGAATGAGG - Intergenic
960661488 3:120064706-120064728 ATCTTGAAAAAGAACGAAGTTGG + Intronic
960744337 3:120870056-120870078 ATCTGAAAGAAGAGAGAAGTAGG - Intergenic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
961526018 3:127498015-127498037 AGCTTCAAGAAGAGGGAAGTTGG + Intergenic
961972449 3:130984490-130984512 TGCTAGAGGATGAGGGAAGTGGG - Intronic
962538230 3:136350608-136350630 TTCTGGGAGAAGAGGGATGCTGG + Intronic
963036889 3:141038234-141038256 TTCTTTACAAAGAGGGAAGCAGG - Intergenic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
964216015 3:154283647-154283669 TTTTTTAAGAGGAGGGAAATGGG + Intronic
964282929 3:155086632-155086654 TTCTTCAAGAAAAAGGAAGGTGG + Intronic
964529679 3:157653932-157653954 TTCCTGAGGAAAAGGGAAGGAGG + Intronic
966211974 3:177462975-177462997 TTCCTTAAGAAGAGGGAAAAGGG + Intergenic
966434751 3:179870654-179870676 TTCATAGAGGAGAGGGAAGTAGG - Intronic
967018898 3:185505326-185505348 TTCCTGGAAAAGAGAGAAGTTGG - Intergenic
968024872 3:195432628-195432650 ATCTTGAAAAAGAACGAAGTTGG - Intronic
968309557 3:197672416-197672438 TTATTCAAGAGGGGGGAAGTGGG - Intronic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969270963 4:6101503-6101525 ATCTTGAAGAAGAGAAAAATTGG - Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
970013066 4:11481833-11481855 ATGTTGAAGAATAGGGAAATGGG - Intergenic
970300707 4:14678903-14678925 TTCTTTAAAGAGAGGGAACTGGG - Intergenic
970409939 4:15795127-15795149 TTCTTGAATAAGGGGGTGGTGGG + Intronic
971982165 4:33765879-33765901 TTTTTGCAGAAGAGGAAAATAGG + Intergenic
973075112 4:45915225-45915247 TTCTTGCAGAAGATGAAAATGGG + Intergenic
974008204 4:56581724-56581746 TTCTTGAATAAGAACAAAGTTGG + Intronic
974013872 4:56631537-56631559 TTTGTGAAGAAGATGGAAATGGG + Intergenic
975634157 4:76429830-76429852 TTCTTGAGAAAGGAGGAAGTGGG - Intergenic
975717978 4:77224040-77224062 TTCATGGAGAAAAGGGAATTAGG - Intronic
976134321 4:81919692-81919714 GTCATGGAGAAGAGGTAAGTAGG + Intronic
976359470 4:84160641-84160663 TTCTTAAAGGAGAGTGAATTAGG + Intergenic
976552945 4:86416983-86417005 GTATTGAAGAGGAGGGGAGTGGG - Intronic
976806671 4:89054950-89054972 TTTTTGGGGAAGAGAGAAGTAGG - Intronic
978510129 4:109507943-109507965 TGCTTTAAGAAAAGGGAAATAGG - Intronic
980201466 4:129660525-129660547 ATCTTGAAGAAGAAGAAAGTTGG - Intergenic
981167459 4:141578347-141578369 TGCTAGAAAATGAGGGAAGTTGG - Intergenic
981236927 4:142428753-142428775 TTCTTGAATACGAGAGAAATGGG + Intronic
982089341 4:151866954-151866976 TCCTTTAAGAAGAGGGAGTTTGG - Intergenic
982154100 4:152498385-152498407 TCCTTGAGGAAGATGGAAATTGG + Intronic
982173765 4:152685956-152685978 TTCTAGAAAAAAACGGAAGTGGG - Intergenic
982349387 4:154398443-154398465 TTCTTTAAAGACAGGGAAGTTGG - Intronic
983020863 4:162674628-162674650 TGTCTGAAGAGGAGGGAAGTTGG + Intergenic
983641650 4:169948995-169949017 TGCTGGAAGAAGAGGGGAGAGGG - Intergenic
983855636 4:172640657-172640679 TCTTTGAAGAAGAGGAAATTTGG - Intronic
984505534 4:180613914-180613936 TACTTGAAGAAGAGACAAATGGG - Intergenic
984581178 4:181511745-181511767 TGCTAGGAGAAGAGGGTAGTCGG + Intergenic
985255173 4:188062990-188063012 TGTTTGAAGAACAGGGGAGTTGG + Intergenic
985397678 4:189561483-189561505 CTTTTGAAGAAAATGGAAGTAGG + Intergenic
986317623 5:6601147-6601169 TTTTTTAAGAAGATGGGAGTTGG - Intronic
987485095 5:18516310-18516332 TTCTTAAAGATGAGGGAGATAGG - Intergenic
988931000 5:36035563-36035585 TTCTTGAAGAACAGGAAAAATGG - Exonic
991282172 5:64927582-64927604 TTCCTGAAGATGTGGAAAGTGGG - Intronic
991653917 5:68883710-68883732 ATTCTGAAGACGAGGGAAGTGGG + Intergenic
992015833 5:72574375-72574397 GTTTTGAAGAAGCGGGAAGAAGG - Intergenic
992448062 5:76851360-76851382 ATTTTGAAGAAGAGCAAAGTAGG + Intronic
992983419 5:82201599-82201621 TTCTTGAAAAAGAACAAAGTTGG - Intronic
994049749 5:95349096-95349118 ATCTGGAGGCAGAGGGAAGTTGG - Intergenic
994641339 5:102413130-102413152 TTTTTACAGAACAGGGAAGTTGG - Exonic
994742063 5:103632238-103632260 TTCATGAAGAAGACGGCACTGGG + Intergenic
995773484 5:115699039-115699061 TTCTTGAACAAGAGAGATGGAGG + Intergenic
996042294 5:118828861-118828883 TACTTGAACAAGATGGAAGAAGG + Intergenic
996167894 5:120248017-120248039 TACTTCAAGAAGAAGGAAATTGG + Intergenic
996415538 5:123206455-123206477 ATCTTAAAGAGGAGGGAACTGGG + Intergenic
996529623 5:124514361-124514383 TTCATGAAGAAGAGGGAGAAAGG - Intergenic
996681969 5:126237695-126237717 TTCTGTAAGAAGGGGCAAGTTGG + Intergenic
997291709 5:132741165-132741187 ATCTTGAAAAAGAAGAAAGTTGG - Intergenic
998523899 5:142825301-142825323 TTGTGGAGGAAGAGGGTAGTTGG + Intronic
998992681 5:147835599-147835621 TCCTTGAATCAGAGGGGAGTAGG - Intergenic
999727349 5:154447173-154447195 TCCTAGAAGGAGAGAGAAGTTGG - Intronic
1000355822 5:160394195-160394217 TTCTTCAAGAAAAGGAAAATTGG + Exonic
1000370461 5:160530560-160530582 TTCTTGATGATGAGTGATGTTGG + Intergenic
1000458007 5:161476491-161476513 ATCTTGAAAAAGAGCAAAGTTGG + Intronic
1000770504 5:165347440-165347462 TTCTTGACAGAGAGGGAAGAGGG - Intergenic
1001320840 5:170680150-170680172 TTATTTAAGAAGAGGAAACTGGG + Intronic
1001976842 5:176007128-176007150 TTCTTGTAGGAGAGGGAATCCGG - Intronic
1002590689 5:180290157-180290179 TTCTAGAAGAAGGTGGAATTTGG - Intronic
1003279600 6:4679811-4679833 TTCTTGTACAAGAAAGAAGTTGG - Intergenic
1004595541 6:17095861-17095883 TTCTTAAAGAAGAGTAAACTAGG + Intergenic
1004871866 6:19913208-19913230 ATCTGGAAGAAGTGGGAAGAGGG + Intergenic
1006110927 6:31744697-31744719 TCCTTGAAGGAAAGGGAAGGGGG + Intronic
1006469925 6:34223044-34223066 TTCTTCAAGAATAGGGGTGTGGG - Intergenic
1007148390 6:39661532-39661554 TTCTTGGGGTAGAGGAAAGTTGG - Intronic
1007651807 6:43427299-43427321 TTCTTGAAGAGGTGGGGAGCCGG - Intergenic
1008202766 6:48612518-48612540 TTATTGAAGAAAAGGAAATTTGG - Intergenic
1008500572 6:52177385-52177407 TTCTCAAAGAAGAGGGGTGTGGG - Intergenic
1008664890 6:53706461-53706483 TTAATGAAGAAGATGGAGGTAGG + Intergenic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1008960514 6:57261374-57261396 TACTTGAAGCTGAGAGAAGTGGG + Intergenic
1008968874 6:57343640-57343662 AGCCTGAAGAAGAGTGAAGTGGG + Intronic
1009157857 6:60245452-60245474 AGCCTGAAGAAGAGTGAAGTGGG + Intergenic
1009882549 6:69586391-69586413 AACTTGAAGAAGAGAGAACTTGG - Intergenic
1010114195 6:72282300-72282322 TTCCTGAAGCACAGGGAAGAAGG - Intronic
1010805495 6:80230794-80230816 TTCTTGAAAAAGGAGGAATTTGG - Intronic
1012029441 6:94038926-94038948 TTCTTCATAAAGAGGGAATTGGG + Intergenic
1012326415 6:97924800-97924822 TCATTGATGAAAAGGGAAGTAGG - Intergenic
1013010404 6:106115174-106115196 TTCCTGAAGGAGGAGGAAGTCGG - Intergenic
1013608308 6:111771495-111771517 TTTTTGAAGAGGGGGAAAGTTGG - Intronic
1014645728 6:123970191-123970213 TTGTGGAAGAAGAGGGTAATAGG + Intronic
1014955573 6:127611340-127611362 GTAGTGAAGAAGTGGGAAGTGGG - Intergenic
1015347520 6:132177408-132177430 TTCTTCCAGAAAATGGAAGTAGG + Intergenic
1015992474 6:138961005-138961027 TTCTTGAAAATGAAGGAAGTGGG - Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016134740 6:140525863-140525885 ATCTTAAAGAATAGAGAAGTTGG + Intergenic
1016535228 6:145102753-145102775 TCCTTGATGAAGAGGGGAGTGGG - Intergenic
1016873061 6:148837980-148838002 TTCCATAAGAAGAGGGAACTTGG - Intronic
1017208468 6:151829132-151829154 TTCTGGAATAAAAGAGAAGTTGG - Intronic
1022617963 7:31951873-31951895 TCCTTGTGGAAGAGGGAAGGGGG - Intronic
1023493732 7:40771919-40771941 TTCTTGAGGTAGAGGACAGTGGG - Intronic
1023627153 7:42127409-42127431 CTCATTGAGAAGAGGGAAGTGGG - Intronic
1023674881 7:42618587-42618609 TTCTCCAAGCAGAGGGAGGTGGG - Intergenic
1023708466 7:42966929-42966951 TTCTTCAAGAAGGGGGCAGGAGG + Intergenic
1024337765 7:48226551-48226573 TTATTGAAGAAATGGGAACTAGG + Intronic
1024568135 7:50701271-50701293 TTCTTGAGGAAGACGGAATGTGG - Intronic
1024861324 7:53845472-53845494 ATATTGAAGAAGAGCCAAGTTGG - Intergenic
1026634625 7:72070564-72070586 CCCTTGAAGAAGAACGAAGTGGG - Intronic
1026982797 7:74536424-74536446 TTCTCTAGGCAGAGGGAAGTAGG - Intronic
1027023088 7:74829942-74829964 ATCTTGAAGAAGAGCAAATTTGG + Intronic
1027064837 7:75115357-75115379 ATCTTGAAGAAGAGCAAATTTGG - Intronic
1027166962 7:75841537-75841559 TTCCTGAAGAAGAAGGAATTGGG - Intergenic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027348850 7:77289810-77289832 TTATGGAAGAGAAGGGAAGTTGG + Intronic
1030571812 7:111235779-111235801 TTGCTGAAGAGGAGGAAAGTGGG - Intronic
1030777797 7:113556885-113556907 TTTTTGAAGAAGAACAAAGTGGG + Intergenic
1033475874 7:141691734-141691756 TCCTTGAATGAAAGGGAAGTAGG + Intronic
1033646166 7:143306227-143306249 GTCTTAAAGAACAGGGAAGTTGG - Exonic
1033682676 7:143610879-143610901 TTCTTGGAAAAGAATGAAGTTGG - Intergenic
1033702219 7:143851042-143851064 TTCTTGGAAAAGAATGAAGTTGG + Intergenic
1034186614 7:149182850-149182872 TTATTAATGAAAAGGGAAGTAGG - Intergenic
1034989599 7:155539787-155539809 TTCATGGAGGAGAGGGAAGTGGG + Intergenic
1035679595 8:1478273-1478295 TTCCTGAAGGAAAGGGAAGGAGG - Intergenic
1036216725 8:6886146-6886168 ATCTTGAAAAAGAATGAAGTTGG + Intergenic
1036715008 8:11113901-11113923 ATCTTGAAGAGGAAGGAACTGGG + Intronic
1037126482 8:15357282-15357304 TTCTTGAAGAAATTTGAAGTTGG - Intergenic
1037126627 8:15359294-15359316 TTCTTGAAGAAATTTGAAGTTGG + Intergenic
1037724226 8:21469824-21469846 TTTTTGAAGAAGAGGAAACTGGG - Intergenic
1038208482 8:25492114-25492136 TTCTTGAAGCAGCGGGGGGTTGG + Intronic
1038587987 8:28808597-28808619 TTGTTGCAGAAGAGGGTAGTAGG - Intronic
1039155655 8:34554003-34554025 TTCTTTAAGATAAGGGAAGAAGG + Intergenic
1039459130 8:37728759-37728781 TTCTGGAAGAAGATAGAAGATGG - Intergenic
1039734138 8:40312258-40312280 TTCTTGAAGAAGAAGCATTTTGG - Intergenic
1039907075 8:41794483-41794505 TTATTGAGGGAGAGGGAAGCGGG - Intronic
1040585626 8:48738243-48738265 TGCTTGAATAAAAGGGAAATAGG + Intergenic
1040611124 8:48983216-48983238 TACTTGAAGAAGAAGAAAGCCGG - Intergenic
1040641976 8:49345718-49345740 TGCTTGAACCAGAGGGAAGGAGG + Intergenic
1041340322 8:56838974-56838996 TTGATAAAGAAGAGGGAAGTAGG - Intergenic
1041349040 8:56930225-56930247 TTTTAGAAAAAGAAGGAAGTTGG - Intergenic
1042097316 8:65231269-65231291 TACTTGAAGAAGATGGAATTAGG - Intergenic
1043166763 8:76912037-76912059 TTCATGAAGAAGAAGAAAGATGG - Intergenic
1043722277 8:83559697-83559719 CTACTGAAGAAGAGGGAAGGGGG + Intergenic
1043871821 8:85441463-85441485 GTCTTGAAGAAAAGTGTAGTTGG + Intronic
1043873665 8:85463188-85463210 TTTTTAAAGAGGAGGAAAGTAGG + Intergenic
1046726726 8:117683106-117683128 GTCTTCAAGAAGAGGGAAATGGG + Intergenic
1046840550 8:118851503-118851525 GGCTTGAGGAAGAGGGAAATGGG + Intergenic
1046884443 8:119348680-119348702 ATATTGAAGAAGAGTGAAGTTGG - Intergenic
1046961208 8:120115174-120115196 TATTTGCAGAAGAGGGAACTAGG - Intronic
1047127377 8:121977215-121977237 GTTTTGATGAAGAGGGAAATGGG + Intergenic
1047274838 8:123397892-123397914 TTCTGGAAGAAGAGAGAGGCGGG + Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047659528 8:127018029-127018051 TTCTAGAAGAAGACTGAACTTGG - Intergenic
1047678616 8:127230476-127230498 TTCTTGTTGATGAAGGAAGTAGG + Intergenic
1047684514 8:127291168-127291190 TACTTAAAGAAGTGGGAAATGGG - Intergenic
1047963155 8:130025533-130025555 TTCTTGAAGAGAAGGGATGAAGG + Intergenic
1049144444 8:140988315-140988337 CTCTTGAAGAAGAGACAAGTAGG + Intronic
1049716941 8:144097431-144097453 ATCTGGAAGAAGAGGCAAGGGGG + Exonic
1050706223 9:8401372-8401394 TTCCTGAAGAAGAGGGCAATAGG - Intronic
1050739836 9:8807034-8807056 TACTGAAAGAAGTGGGAAGTAGG + Intronic
1050871406 9:10575277-10575299 ATCTTGAAGAATATGAAAGTTGG + Intronic
1051750053 9:20331707-20331729 TTCTTGAAGTAGTGGAAAGTTGG + Intergenic
1051804197 9:20973508-20973530 TGCTAAAAGAAGGGGGAAGTAGG - Intronic
1051804216 9:20973700-20973722 TGCTGAAAGAAGAGGGAAGTAGG - Intronic
1051804252 9:20974084-20974106 TGCTGAAAGAAGGGGGAAGTAGG - Intronic
1051804270 9:20974276-20974298 TGCTGAAAGAAGGGGGAAGTAGG - Intronic
1051804290 9:20974468-20974490 TGCTGAAAGAAGGGGGAAGTAGG - Intronic
1051804309 9:20974660-20974682 TGCTGAAAGAAGGGGGAAGTAGG - Intronic
1051808959 9:21029125-21029147 TTCTTGGGGAAGGGGGAAGGTGG - Intronic
1052046558 9:23800496-23800518 TCCTTGAATAAGAGGGAAGGGGG - Intronic
1052221322 9:26026767-26026789 TTCCTGAAGAATAGGGAGCTCGG + Intergenic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1054847357 9:69810967-69810989 TTCTTGAGGAAAAGGGAGGTGGG - Intergenic
1055223507 9:73966639-73966661 TTCTTAAAGAAGTGGGCATTTGG - Intergenic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1058006605 9:99922748-99922770 CTTTTGAAGAAGGGAGAAGTGGG + Intronic
1058358896 9:104118452-104118474 TTCCTGAAGAAGTGGGTAGTTGG - Intronic
1058755488 9:108079352-108079374 TTCTTGAAGAAGAGAGTTGGGGG + Intergenic
1058768710 9:108209273-108209295 CTTTTACAGAAGAGGGAAGTGGG - Intergenic
1059612690 9:115916392-115916414 TCCCTGAAGTAGAGGGCAGTTGG - Intergenic
1059843511 9:118244988-118245010 TTCTTGAAGATGGGTGAGGTAGG + Intergenic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1060808402 9:126593761-126593783 TTTTTGTAGAAGAGGAAACTGGG - Intergenic
1185808178 X:3079655-3079677 TTTTTAAAGGTGAGGGAAGTGGG + Intronic
1187561271 X:20405892-20405914 TCCTTGAAGTAGAGGGATGCAGG + Intergenic
1187616092 X:20994950-20994972 TTCATGAAGTAGAGAGGAGTGGG - Intergenic
1188487842 X:30702895-30702917 TTTTTGAGGAGGAGGGATGTGGG + Intronic
1189499763 X:41545598-41545620 CTCTTGAAGAACAAGGAAGGAGG - Intronic
1191601462 X:63013878-63013900 TTCTTGCTGAACATGGAAGTGGG - Intergenic
1192158862 X:68768046-68768068 GTCCTGAAGAAGGGGGAATTTGG - Intergenic
1192246556 X:69377933-69377955 TTCTTGAAAAAGAATAAAGTTGG + Intergenic
1192345981 X:70306294-70306316 ATCTTGAACAAGAACGAAGTTGG - Intronic
1192739130 X:73876181-73876203 TTCTTGTAGAGGAGTGAAGAGGG - Intergenic
1192782009 X:74304065-74304087 TTCTTGAGTAGGAGGAAAGTCGG + Intergenic
1193413456 X:81193875-81193897 TTCATGAAGAAGACCAAAGTAGG + Intronic
1193503672 X:82311498-82311520 ATCTTGAAGAAGATCAAAGTTGG - Intergenic
1193590172 X:83379770-83379792 TCCTTGTAGAAGAGGAAATTAGG + Intergenic
1193934019 X:87592926-87592948 TTCTTTAAGAATAGGCAAGTGGG - Intronic
1194116212 X:89901705-89901727 TGCTTTAAGAAGATGCAAGTAGG + Intergenic
1194307351 X:92264658-92264680 ATGTTGAAGAAGAGGAATGTTGG + Intronic
1195223575 X:102769324-102769346 TTCGTGAAGGAGAGAGAGGTGGG + Intergenic
1195806776 X:108781040-108781062 ATCTTGAAGAAGAACAAAGTTGG - Intergenic
1195907472 X:109859345-109859367 TTGTAGAAGAAGGTGGAAGTAGG + Intergenic
1196316580 X:114232879-114232901 ATCTTGAAAAAGAGCAAAGTTGG - Intergenic
1197852271 X:130875345-130875367 ATCTTAAAGAAGAGCAAAGTTGG + Intronic
1198217689 X:134570840-134570862 TTCTTGAAAAAAAGGGAAAGAGG - Intronic
1198515954 X:137406981-137407003 ATCTTGAAAAAGAAAGAAGTTGG - Intergenic
1198748641 X:139916808-139916830 ATCTTGAAAAAGAGCAAAGTTGG + Intronic
1199593528 X:149489119-149489141 TTCGTGGAGAAGAGGAAACTGGG + Intronic
1200469011 Y:3558830-3558852 TGCTTTAAGAAGATGCAAGTAGG + Intergenic
1201064798 Y:10087543-10087565 TTTTTGTAGAATATGGAAGTGGG - Intergenic
1201273295 Y:12276538-12276560 AACTTGAAGAAGAGGGATGAGGG + Intergenic
1201457030 Y:14179707-14179729 TTCTTGAATAAGAGGAAACCTGG - Intergenic