ID: 1119856885

View in Genome Browser
Species Human (GRCh38)
Location 14:77907754-77907776
Sequence GGTCTGGGGAAGCTGGGAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 425}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119856885_1119856900 22 Left 1119856885 14:77907754-77907776 CCGATTCCCAGCTTCCCCAGACC 0: 1
1: 0
2: 8
3: 56
4: 425
Right 1119856900 14:77907799-77907821 CCAGGTCCCCCGAATCCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 85
1119856885_1119856898 21 Left 1119856885 14:77907754-77907776 CCGATTCCCAGCTTCCCCAGACC 0: 1
1: 0
2: 8
3: 56
4: 425
Right 1119856898 14:77907798-77907820 CCCAGGTCCCCCGAATCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 144
1119856885_1119856892 4 Left 1119856885 14:77907754-77907776 CCGATTCCCAGCTTCCCCAGACC 0: 1
1: 0
2: 8
3: 56
4: 425
Right 1119856892 14:77907781-77907803 GACCTGTCCCTTCCTATCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119856885 Original CRISPR GGTCTGGGGAAGCTGGGAAT CGG (reversed) Intronic
900966322 1:5961240-5961262 GGGCTGGGGGAGTAGGGAATAGG + Intronic
901480656 1:9522736-9522758 GGCCTGGGGGAGCGGGGAATGGG + Intergenic
901947522 1:12715574-12715596 GGGCTGGGGAAGGTGGGCGTAGG + Intergenic
902138476 1:14331748-14331770 GGTAGGGGGAAGCAGGGGATGGG - Intergenic
902761791 1:18585901-18585923 GGTGGGGGGAAGCTGGGAGAAGG + Intergenic
903068812 1:20716554-20716576 GAACTGGGGGAGCTGGGAGTGGG + Intronic
903786770 1:25866349-25866371 GGTCAGGGGAAAGTGGGATTGGG - Intronic
904603752 1:31687710-31687732 GAGATGGGGAAGCTGGGAAGAGG + Intronic
904907411 1:33908163-33908185 AGTCTTGGGAACCTGGGAAGTGG + Intronic
906212358 1:44019337-44019359 GGTTTGGGGAAGATGGGGACAGG + Intronic
906436988 1:45804201-45804223 GGTCTGGGGAGGCCGAGAAATGG + Intronic
906712929 1:47945032-47945054 GGGCTGGGGAAGTTGGGGGTGGG + Intronic
907045977 1:51300297-51300319 GGTCTGGGGCAGGTGGGGCTGGG - Intronic
907065852 1:51482291-51482313 GGTATGGGGAAGATGGGGAGAGG + Intronic
907144293 1:52218793-52218815 GGTTTTGGGAAGCGGGTAATGGG + Intronic
907241309 1:53082531-53082553 GGGCTGGGGAAGCTTGCCATGGG + Intronic
907919719 1:58901251-58901273 GGTCTGGAGAAGGTGGGGGTTGG + Intergenic
908964138 1:69737617-69737639 ATTCTGGGAAAGCAGGGAATTGG - Intronic
909184273 1:72465988-72466010 GGTCATGTGAAGCTGGGAACAGG - Intergenic
909676733 1:78246899-78246921 GGTAGGGGGAAGGGGGGAATAGG - Intergenic
912795981 1:112693941-112693963 GGTCTGGGGAACCTGGGGGCTGG + Intronic
913531106 1:119734961-119734983 GGTCTAGGTAAGCTGGGCACAGG + Intronic
915063171 1:153203412-153203434 GATCTGAGGAAGCTGGGGGTGGG - Intergenic
915235534 1:154477951-154477973 GGGCTGGGGAAGGAGGAAATGGG - Intronic
915897595 1:159823865-159823887 GTTTTGGGGAAGCTGAGAAAGGG - Intergenic
915908412 1:159896709-159896731 GGTCTGGGGAAGATGAGGACTGG + Intronic
916322620 1:163521871-163521893 GGTCTGAGGATGAGGGGAATAGG + Intergenic
916829957 1:168480907-168480929 TGGCTGGGGAAGCAGGAAATGGG + Intergenic
917655038 1:177117677-177117699 GGTGTGGGAAACCTGGAAATTGG - Intronic
917816042 1:178711306-178711328 GGGTTGGGGAAGCGGAGAATTGG + Intergenic
917996174 1:180440598-180440620 GGTTTGGGGGAGAGGGGAATGGG - Intronic
917996189 1:180440651-180440673 GGTTTGGGGGAGAGGGGAATGGG - Intronic
918178683 1:182067650-182067672 GGTCTTGAGAAGCTTGGAAAGGG - Intergenic
918979175 1:191533309-191533331 GCTGTGGGGAGGCTGGTAATGGG - Intergenic
919514238 1:198501883-198501905 GGTCTGGGGAAGGGGGAAATGGG - Intergenic
919706457 1:200680893-200680915 GGTCCAGGGAAGCTGGGAGAGGG - Intergenic
919846209 1:201643808-201643830 GGTCTGGGGAATCTGTCAGTTGG - Intronic
920003068 1:202812407-202812429 GTTCTTGGGAAGCTGGGTCTGGG + Intergenic
920334176 1:205233176-205233198 TGTCTGGGGATGCTGGCCATGGG + Intronic
920370504 1:205476242-205476264 GGTCAGGGGAAGAGGAGAATGGG + Intergenic
920397967 1:205660274-205660296 GGGCTGGGGGAGGTGGGAAGAGG - Intronic
920530793 1:206700865-206700887 GCTCTGGGGAAGCTGGGAAATGG + Intronic
920660225 1:207909117-207909139 AGTCTGGCAAGGCTGGGAATGGG + Intronic
921118825 1:212119172-212119194 GGTCTGGAGAAGCTGGGGTCAGG + Intergenic
921330727 1:214033084-214033106 GGTCTGGGGAACCAGGGACAGGG - Intronic
922223856 1:223628445-223628467 GGCCTAGGGGAGCTGGGAAGAGG + Intronic
922566546 1:226605187-226605209 GGTCTGGGGCAGCTGAGGGTGGG - Exonic
922586735 1:226738906-226738928 GGGCTGGGGAGGCAGGGAAGGGG - Intronic
922752932 1:228079329-228079351 GGTCTGGGGAAGAAGGAAACAGG + Intergenic
924191808 1:241561354-241561376 GTTCTGGGGAAGTCAGGAATGGG - Intronic
924391592 1:243566338-243566360 GTTCTGGGCAAACTGGGAGTTGG - Intronic
1062930278 10:1348307-1348329 GGTCTGGGGAGTCTGGGATGTGG + Intronic
1063614640 10:7591308-7591330 GGTTTAGGGAAGCTGGGTGTGGG - Intronic
1064213388 10:13379851-13379873 GGGCTGGGAAAGAGGGGAATGGG + Intergenic
1066518902 10:36194492-36194514 GGTCTTGGGTAGCGGGGGATGGG + Intergenic
1066671748 10:37847813-37847835 TAACTGGGGAAGCTGAGAATGGG + Intronic
1067693563 10:48519790-48519812 GGTCTGGGGAGCCTGGGAGGGGG + Intronic
1068013054 10:51478557-51478579 GTTTTAGGGAAACTGGGAATTGG - Intronic
1068961710 10:62872935-62872957 GGGCTTGGGAAGCAGAGAATGGG - Intronic
1070058432 10:72957328-72957350 GGGCTGGGGAAAAGGGGAATGGG - Intergenic
1070332320 10:75427075-75427097 GGTTTGAGGAAGGTGGGAGTGGG - Intergenic
1070441266 10:76445986-76446008 GCTTTGGGGAAGCTGGGACTAGG - Intronic
1070637256 10:78139455-78139477 TGTGTGGGGAAGGTGGGATTAGG + Intergenic
1070637899 10:78143858-78143880 GGCCTGTGGTAGCTGGGAAGAGG + Intergenic
1070748609 10:78950628-78950650 GTTCTGGGGAAGCAGGGACCCGG - Intergenic
1070840532 10:79484278-79484300 TGTCTGGGGAATTTGTGAATGGG - Intergenic
1071308575 10:84322256-84322278 GGGCTGGGGGAGAGGGGAATGGG + Intergenic
1071569934 10:86691282-86691304 GGCCTGGGGAAGTTGGGAGTGGG - Intronic
1072060831 10:91809251-91809273 GGAACTGGGAAGCTGGGAATAGG + Intronic
1072726127 10:97815293-97815315 GGCTTGGAGGAGCTGGGAATGGG + Intergenic
1073203026 10:101751608-101751630 GGGCTGGGGAGCCAGGGAATAGG + Intergenic
1073440481 10:103549715-103549737 GGTCTGGGGAGGCCAGGAAGAGG - Intronic
1073854419 10:107658340-107658362 GGGCTGGGGGTGATGGGAATGGG + Intergenic
1074828802 10:117233573-117233595 GGCCTGGGGATGCTGGGAGCAGG + Intergenic
1075573101 10:123559325-123559347 GGCCTGGGGAAACTGGGATTGGG - Intergenic
1076343301 10:129764617-129764639 AGCGTGGGGAAGCTGGGCATGGG + Intronic
1077888310 11:6402071-6402093 GGACAGTGGAAGGTGGGAATAGG - Exonic
1078088120 11:8246936-8246958 GGTCTGGGGAAGGAGGTAAGGGG - Intronic
1078213150 11:9288083-9288105 GGTCGGGGGGAGGTGGAAATTGG - Intronic
1079130531 11:17744565-17744587 GGCCTGGAGAAGCGGGCAATGGG - Intronic
1080008126 11:27430888-27430910 GGGTTGGGGGAGCTGGGAGTGGG - Intronic
1080406910 11:31987590-31987612 GGGCTGGGGGCGCTGGGAAGAGG + Intronic
1081441915 11:43090136-43090158 GGTCTGGGGTCACTGGGAACTGG - Intergenic
1081733015 11:45384765-45384787 TGGCTGGGGAAGCTGGGGCTCGG - Intergenic
1081741486 11:45444067-45444089 GGTCGGAGGAAGCTGATAATTGG + Intergenic
1081885616 11:46493389-46493411 GGTCTAGGGAAAGTGGGAATAGG + Intronic
1083808079 11:65086998-65087020 GGCCTGGGGAAGCTGGGGGCCGG - Exonic
1083969100 11:66061792-66061814 TGTCTGGGGAAGCAGCGAAGAGG + Intronic
1084031770 11:66485276-66485298 GGGTTGGGGAAGGTGGGGATGGG + Intronic
1084191935 11:67503434-67503456 GGTGTGGCGGAGCTGGGATTGGG - Intronic
1084962923 11:72726714-72726736 GGTCTGGGGCAGCTGTGGATGGG + Exonic
1085170282 11:74444063-74444085 AGGCGGGGGAATCTGGGAATGGG - Intergenic
1086275786 11:85127024-85127046 AGTCTGGGCAAGCTGGGATTTGG + Intronic
1087769750 11:102195436-102195458 AGTTTGGGGAGGCTGGGAGTTGG + Intronic
1087882064 11:103428635-103428657 GGGCTGGGGAAGGGGTGAATGGG - Intronic
1088666380 11:112097979-112098001 TGGCTGGGGAAGCTGGGATGAGG + Intronic
1088770251 11:113028051-113028073 GGGGTGGGCAAGCTGGGAAAAGG + Intronic
1089003894 11:115074808-115074830 GCTCAGGGGCAGCTGGGACTGGG + Intergenic
1089207822 11:116779122-116779144 GTTCTTGGGAAGGTGGGAATTGG - Intronic
1090056197 11:123427043-123427065 TGTCTGGGGAAGCGGGGAATGGG + Intergenic
1090241692 11:125187831-125187853 GGCCTGGGCCAGGTGGGAATGGG + Intronic
1090299944 11:125626397-125626419 GGTCTGGGGAAGAGAGGAAGAGG - Intronic
1090990909 11:131815932-131815954 GAGCTGGGGAAACTGGGAGTTGG + Intronic
1091194390 11:133719009-133719031 GGTCTGGGGGAGCGGGGATGGGG + Intergenic
1091724169 12:2834240-2834262 GGTCTGGGGAACCTGTGGTTCGG + Intronic
1091920372 12:4299471-4299493 TGCCTGGGGAAGCTGGGAAGTGG - Intronic
1093085915 12:14866998-14867020 GGCCAGGGGAAGCTGGAACTGGG - Intronic
1093512863 12:19949521-19949543 GGCATGGGGAAGCTGTCAATGGG - Intergenic
1095463677 12:42468050-42468072 TGTCAGGGGAAGCTGGGAGAAGG + Intronic
1095621851 12:44265753-44265775 GGCCTGGGGAAGGGGAGAATGGG - Intronic
1095891216 12:47236201-47236223 GGTGTGGGGAAGAAGGGCATAGG - Exonic
1096048640 12:48586641-48586663 CCTCTGGGGCAGCTGGGCATGGG - Intergenic
1096313009 12:50538120-50538142 GGTGTGGGAGAGCTGGGCATAGG + Intronic
1096333815 12:50737875-50737897 GATTTGGGGAGGCTGGGCATGGG - Intronic
1096463812 12:51837309-51837331 GGTCCGGGGGAGCTGGGAACTGG + Intergenic
1096621718 12:52869582-52869604 GGCCTGGGGAAGCTGGGATGGGG - Intergenic
1096676610 12:53229758-53229780 AGTCTGGGGAACATGGGGATGGG - Intronic
1096794896 12:54070460-54070482 GGGCTGGGGAATCCGGGATTAGG + Intergenic
1096983884 12:55744046-55744068 AGTCCGGGGAAGCTGGGGCTGGG + Intronic
1097894253 12:64808734-64808756 GGGCTGGGGAGGGAGGGAATGGG - Intronic
1098006392 12:66001046-66001068 ATTCTTGGGAAGCTGGGAACAGG - Intergenic
1098630555 12:72716644-72716666 GACCTGGGGAAGCTGGCAAAAGG + Intergenic
1100811500 12:98343202-98343224 GGACTGGGGGAGTTGGGAGTGGG + Intergenic
1101240659 12:102834986-102835008 GGTCTGGGGAGGATGGAATTTGG - Intergenic
1102032995 12:109753690-109753712 GGTGGGGTGAGGCTGGGAATTGG - Intronic
1102699192 12:114824261-114824283 GGTAGGGGGAAGCTGGGACAGGG + Intergenic
1103317038 12:120064496-120064518 GCTCTGGGGAAGCTGGAATGTGG - Intronic
1103741500 12:123094587-123094609 GAACTTGGGAAGCTGGTAATTGG + Intronic
1103962630 12:124618486-124618508 GGGCTGGGGGAGGTGGGAACGGG - Intergenic
1104345439 12:127992389-127992411 GGGCTGGGAAAGCTGGGTCTCGG - Intergenic
1104356288 12:128089831-128089853 GGAGTGGGGAACCTGGGTATGGG + Intergenic
1105473599 13:20712848-20712870 GGTCTGTGGAATTTGGGGATGGG + Intronic
1105885602 13:24638491-24638513 GGTCTGGGGAGGGTGGGGAGGGG - Intergenic
1106004871 13:25759443-25759465 GCTGTGGGGAAGGTGGGAATAGG - Intronic
1106193690 13:27475768-27475790 GGGCTGGGGAAGGCGGGAATGGG - Intergenic
1106283811 13:28301767-28301789 GGTCTGAGCATGATGGGAATAGG - Exonic
1106858774 13:33882135-33882157 CATCAGGGGAAGCTGAGAATAGG - Intronic
1106945677 13:34824953-34824975 GGGCTGGGGGAGAGGGGAATGGG - Intergenic
1107762355 13:43693947-43693969 AGTATGGGGAAGCTAGGACTTGG + Intronic
1107930022 13:45299495-45299517 GGTCTGGGAAACCTGGAAATGGG - Intergenic
1108745120 13:53385607-53385629 GAGCTGGATAAGCTGGGAATGGG + Intergenic
1108771390 13:53705327-53705349 GGAATGGGGAATCTGGGAGTTGG - Intergenic
1109178460 13:59184646-59184668 GGTTTGGGGGAGGTGGGAATAGG - Intergenic
1109764319 13:66873681-66873703 AGGCTTGGGAAGCTGGGGATGGG - Intronic
1110654143 13:77976656-77976678 AGTCTGGGAGAGGTGGGAATGGG - Intergenic
1112195712 13:97224211-97224233 GCTCTGGAGCAACTGGGAATAGG - Intronic
1112508794 13:99991028-99991050 GGGCTGGGGGAGGTAGGAATGGG - Intergenic
1112575087 13:100628198-100628220 GGTCTGGTGGAGGTGAGAATGGG - Intronic
1113117024 13:106885086-106885108 GGTGTGGGGAAGTTGGGATCAGG - Intergenic
1114587274 14:23826323-23826345 GGTCTGGGGAAGCCAGGAGGGGG - Intergenic
1114960162 14:27877354-27877376 GTTGTGGGGAAGCTGCGGATGGG - Intergenic
1117337228 14:54765885-54765907 GGTTTGGGGAAGTGGGGAAGGGG - Intronic
1117656114 14:57958489-57958511 GGTCTGGGGTAGAGGGGAATGGG + Intronic
1118837721 14:69488346-69488368 GCTCTGGGAAAGCTCGGCATTGG - Intronic
1119671792 14:76525607-76525629 GGGCTGGGAAAGCTGGGGAGGGG + Intergenic
1119856885 14:77907754-77907776 GGTCTGGGGAAGCTGGGAATCGG - Intronic
1122048062 14:99037408-99037430 GGGCTGGGGGAGTGGGGAATGGG + Intergenic
1122903855 14:104793056-104793078 CGGCTGGGGGAGGTGGGAATGGG - Exonic
1123008787 14:105337274-105337296 GGGCCGGGGAAGGTGGGAATGGG + Intronic
1124533022 15:30522769-30522791 GGTGTGGGGATGCTGGCAAGGGG + Intergenic
1124765635 15:32484875-32484897 GGTGTGGGGATGCTGGCAAGGGG - Intergenic
1125139681 15:36390213-36390235 TGTCATAGGAAGCTGGGAATAGG - Intergenic
1126280561 15:46943077-46943099 GGTCTAGGGAAGCTAGGGTTTGG - Intergenic
1126759451 15:51955922-51955944 AGTCTGGGGAAGCTGGGGTGGGG + Intronic
1128262316 15:66241055-66241077 GGACTGGGCAAGCAGGCAATAGG + Intronic
1128924050 15:71637643-71637665 GGGCTGGGGGAGGTGGCAATGGG + Intronic
1129668851 15:77595770-77595792 GGCCTGGGGAGGCTGGGATTTGG + Intergenic
1129704310 15:77785726-77785748 GATTTGGGGAAGCTGGGGGTGGG - Intronic
1129877585 15:78986223-78986245 GATCTGGAGCAGCTGGGGATGGG + Intronic
1129889595 15:79063042-79063064 AATCTGGGGAAGCTGGAAATAGG - Intronic
1130072598 15:80660697-80660719 GGTGTAGCGAAGCTGGAAATAGG - Intergenic
1130584085 15:85166290-85166312 GGTTTGGGGAAAGGGGGAATGGG + Intergenic
1131268866 15:90934721-90934743 GGGCTGTGCAAGCTGGTAATGGG + Intronic
1131571171 15:93538035-93538057 GGGTTGGGGAAGGTAGGAATAGG - Intergenic
1131605823 15:93901253-93901275 GGGCGGGGGGAGCTGGGAACAGG - Intergenic
1132626387 16:893637-893659 GCACTGGGGAAGGTGGGACTTGG + Intronic
1133255977 16:4516255-4516277 GGTCTGGGGGAGAGGGGAAATGG + Intronic
1133360740 16:5171737-5171759 GGTCTGGGCCAGCTGGGGATGGG - Intergenic
1134323601 16:13186722-13186744 GGGCTGGAGAAGCGGGGATTGGG - Intronic
1134812713 16:17180994-17181016 GGGTTGGTGAGGCTGGGAATTGG + Intronic
1137750822 16:50859933-50859955 GGTCTGGGGAAGGAGGGCAAAGG - Intergenic
1138392931 16:56683313-56683335 GGTTTGGGGAAGCTGGTCATTGG - Intronic
1138530810 16:57633460-57633482 GGTCTGGGACAGCTGGGGACAGG - Intronic
1138760218 16:59534499-59534521 GGGCTTGGGAAGTTGGGAGTCGG - Intergenic
1141042115 16:80681589-80681611 GGTCTGGGGGAACTGGGAAGAGG - Intronic
1141463462 16:84191726-84191748 GGTCTGGGGAAGGTGGACCTTGG + Intronic
1141533469 16:84662499-84662521 GGTTTGGGGAGGCTTGGACTAGG - Intronic
1141784613 16:86190753-86190775 GGTCTGGGAAGGCTGGAAAATGG - Intergenic
1141837961 16:86555129-86555151 GCTCCGGGGCGGCTGGGAATGGG - Intronic
1142900747 17:3009909-3009931 GGTCTGGGGAAGGCAGGAAGGGG + Intronic
1143453522 17:7051127-7051149 GCTGTGGGGAAGCTGGTAATAGG + Intergenic
1143652748 17:8274007-8274029 CGTATGGGGAAACAGGGAATGGG + Intergenic
1143859071 17:9874702-9874724 CGTCTGTGGAAGGTGGGGATGGG + Intronic
1144137906 17:12316405-12316427 GCACTGGGAAAGCTGGGAATAGG + Intergenic
1144453197 17:15398189-15398211 GGTCTGGAGAAGCTGGTAGCAGG - Intergenic
1145361986 17:22219823-22219845 GGGCTGGGAAAGGAGGGAATGGG + Intergenic
1146127252 17:30238981-30239003 GGTCCTGGGCAGCTGGGAAGAGG + Intergenic
1146181519 17:30701316-30701338 GGGCTGGGGGAGGAGGGAATGGG - Intergenic
1146846444 17:36184137-36184159 GGTCGTGGGGAGCTGGGACTGGG + Intronic
1147954241 17:44123462-44123484 GGTCCGGGGAAGATGGGATCTGG + Intronic
1149140566 17:53428349-53428371 GATCTGGAGAAGCTGGGATATGG - Intergenic
1149405544 17:56346503-56346525 GAGCTGGAGAAGATGGGAATAGG + Intronic
1149549050 17:57526251-57526273 GCTTAGGGGAAGCTGGGAACAGG - Intronic
1150294371 17:63999990-64000012 GGTCAGGAGAAGCAGGGACTGGG + Intronic
1150458974 17:65331177-65331199 GGGCTGGGGGAGTAGGGAATGGG - Intergenic
1152426943 17:80223160-80223182 GAGCTGGGGAAGGTGGCAATGGG - Intronic
1152598981 17:81252129-81252151 GGGCTGGGGAGGCTGGGCAGGGG - Intronic
1153559013 18:6351353-6351375 GGTCTGGGGGAGAAGGCAATGGG + Intronic
1153966853 18:10190159-10190181 GGACGGGGGCAGCTGAGAATGGG + Intergenic
1155341633 18:24819421-24819443 GGGCAGGGGCAGGTGGGAATGGG + Intergenic
1155864253 18:30944663-30944685 GTTCTGGTGGAGCTGGGAACTGG + Intergenic
1157121624 18:44916952-44916974 GGTCTGGGAAACCAGGGAAGCGG - Intronic
1157277407 18:46321472-46321494 GGACTGGGGAAGTGGAGAATGGG + Intergenic
1157423010 18:47561655-47561677 GGTCCGGGGAAGGTGGGAACTGG + Intergenic
1157688717 18:49663852-49663874 GCTCTGGAGAAGCAGGAAATTGG - Intergenic
1159419290 18:68195713-68195735 GGCATGGGGAAGCTGGAGATGGG + Intergenic
1159617733 18:70600756-70600778 GGGCTGGGGGAGAAGGGAATGGG - Intergenic
1159954725 18:74511143-74511165 GGTTTATGGAAGCTGGGAATTGG - Intronic
1161703503 19:5807002-5807024 GGGCTGGGGAAGCTCAGAGTGGG + Intergenic
1162388483 19:10375247-10375269 AGTCATGGAAAGCTGGGAATGGG + Intronic
1162638784 19:11990772-11990794 GGACTGGGGAGGATGGGAAAGGG + Intergenic
1162741691 19:12777356-12777378 CCTCTGGAGTAGCTGGGAATAGG - Intronic
1163445091 19:17341334-17341356 GGTCAGGGGAGGCTGGGAGTGGG - Intronic
1163808919 19:19418132-19418154 GCTCTGGGACAGCTGGGTATTGG + Intronic
1164883178 19:31753422-31753444 GGGCTGGGGAAGGTGGGAATAGG + Intergenic
1165007800 19:32820704-32820726 GGTCAGGGGAAGCAGGAAACTGG + Intronic
1165069322 19:33246813-33246835 GGACTGGGGAGGCAGGGAAGAGG - Intergenic
1165326837 19:35118917-35118939 TGTTTGGGGAAGCGGGGCATTGG - Intronic
1165435642 19:35793269-35793291 GGGCTGTGGAGGATGGGAATTGG - Intergenic
1165703736 19:37959508-37959530 GGGCTGGGGATGCTGTGAACAGG + Intronic
1165811466 19:38614358-38614380 GGCCTGGGGATTCTGGGGATGGG - Intronic
1166569514 19:43784825-43784847 GGTCTGAGGAAGGAGGGGATGGG + Intergenic
1166676039 19:44741800-44741822 GGTCTGGGAAGGCGGGGCATAGG - Intergenic
1166735528 19:45081960-45081982 GGGCTGGGGACAATGGGAATGGG - Intronic
1167460210 19:49620929-49620951 GGTCTGAGGAAGGAGGGACTGGG + Intronic
1167669013 19:50839038-50839060 GGTCTGAGGGAGCTGGGGCTGGG + Intergenic
1167678732 19:50906521-50906543 GGTCTGGGGAAGGAGGGGTTGGG + Exonic
1167746243 19:51353389-51353411 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746257 19:51353426-51353448 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746272 19:51353463-51353485 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746287 19:51353500-51353522 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746302 19:51353537-51353559 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746317 19:51353574-51353596 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746332 19:51353611-51353633 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746360 19:51353685-51353707 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746408 19:51353833-51353855 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746422 19:51353870-51353892 GGTCTGAGGAAGAAGGGGATGGG - Intronic
1167746435 19:51353907-51353929 GGTCTGAGGAAGGAGGGGATGGG - Intronic
1167746462 19:51353981-51354003 GGTCTGAGGAAGAAGGGGATGGG - Intronic
1167801862 19:51748308-51748330 GGACTGGGGAAACTAGGAAGTGG + Intronic
1168346143 19:55651085-55651107 GGTCTGTGGGAGGTGGTAATGGG - Intronic
926581794 2:14637952-14637974 GGTGTGGCTAAGCTGGGGATTGG + Exonic
927210478 2:20636080-20636102 GGGCAGGGCAAGCTGGGAAACGG + Intronic
927795416 2:26043981-26044003 GGGCTGGGGAAGAGGGAAATAGG + Intronic
927904950 2:26849094-26849116 GGTCTCGGGGAGCAGGGAGTGGG + Intronic
928162514 2:28941000-28941022 GGTCTCTGGGAGCTGGGAAAAGG + Intronic
928178065 2:29048495-29048517 GGACTGGGGAAGGGAGGAATGGG - Intronic
928201813 2:29252067-29252089 GGTGAGGGGGAGCTGGGAAAAGG - Intronic
930235422 2:48884578-48884600 GGTCGGGGGAAGGTAGGACTGGG - Intergenic
932230986 2:70084091-70084113 GAGCTGGGGAAGCTGGGAAAGGG + Intergenic
934614074 2:95760662-95760684 GTTCTGGGGACACTGGGTATTGG + Intergenic
937216009 2:120314025-120314047 GGTCTGGGGCAGCCGGGCAGGGG + Intergenic
938260874 2:129894587-129894609 TGCCTGGGGCAGCTGGGAAATGG + Intergenic
938308218 2:130268647-130268669 AGCCTGAGGAAGCTGGGGATAGG + Intergenic
938968964 2:136414936-136414958 GGTCGGTGGAAGTAGGGAATGGG + Intergenic
939963330 2:148585676-148585698 GGTTTGAGGAAGCTGGGCCTTGG + Intergenic
940772714 2:157856287-157856309 GCTCAGGGGAAACTGGAAATAGG - Intronic
942790891 2:179759222-179759244 GGACTTGGGAAGCTGTGGATGGG + Intronic
945497250 2:210524102-210524124 GGCATGGGGAAGCTGGGAGAAGG - Intronic
945828077 2:214749145-214749167 GGTGTGAGGAAGCTGGCCATGGG + Intronic
946155813 2:217806040-217806062 GGTCTGAGCCAGCTGGGAAAGGG - Intronic
947428998 2:230009246-230009268 GGCAGGGGGAAGCTGGGTATGGG + Intronic
948209191 2:236179618-236179640 GGTCTGGGGAGGGTGGGGCTGGG + Intergenic
948940995 2:241196355-241196377 GGCTTGGGGCAGCTGGGGATTGG + Intronic
1169204346 20:3731942-3731964 CTTCTGGGGATGCTGGGACTTGG - Intergenic
1169586858 20:7095545-7095567 GGTTTGGGGAAGCTTGGCATTGG - Intergenic
1171280471 20:23891999-23892021 TTTGTGGGGATGCTGGGAATTGG + Intergenic
1172518660 20:35553485-35553507 GGGTTGGGGAAGGTGGGAGTTGG + Intronic
1172865246 20:38090974-38090996 GGGCAGGGGAAGCGGGGAGTTGG + Exonic
1173047719 20:39528519-39528541 AGTGTGGGGAGGCTGGGAGTGGG + Intergenic
1173285752 20:41670243-41670265 GGGCTGGGGGAGCAGGGAAGGGG + Intergenic
1173707929 20:45126653-45126675 GGTCTGGGGGTGGGGGGAATAGG - Intergenic
1174107809 20:48175398-48175420 AGTCTGGGGAAGCTGGGGCCGGG - Intergenic
1174375486 20:50124065-50124087 GGTTGGGGGGAGCTGGGAATGGG + Exonic
1174413648 20:50352754-50352776 GGTTTGGGGAGGCTGGGATGAGG + Intergenic
1175175766 20:57110987-57111009 GGTGTGGGGGAGCAGGGAAGTGG - Intergenic
1175893358 20:62325042-62325064 GGGCTGGGGTAGGTGGGAAAGGG + Intronic
1176124561 20:63469704-63469726 GGCCTGGGGCAGCCGGGAGTGGG - Intronic
1176149599 20:63583142-63583164 AGTCTGGGGCTGCTGGGAATGGG - Intergenic
1178549355 21:33522778-33522800 GGTCTGGGGTAGTGGGGAATGGG - Intronic
1178601758 21:34000530-34000552 TGCCAGGGGCAGCTGGGAATGGG + Intergenic
1178782569 21:35618535-35618557 GGTCTGGGGAAGCAAGGAATAGG + Intronic
1178828659 21:36036454-36036476 GGTTTGGGGAAGAGGGGAATAGG - Intronic
1179927126 21:44540825-44540847 GGTGTGGGAACGCTGGGGATAGG + Intronic
1179931254 21:44572387-44572409 GGTGTCGGGAAGCTGGCAAAGGG + Intronic
1179947527 21:44688351-44688373 GGTCTTGGGAAGGTGGAGATGGG - Intronic
1180840715 22:18957663-18957685 GGGCTTGGGAAGGTGGGGATGGG + Intergenic
1180929287 22:19577892-19577914 GGTCTGGGTCAGTTGGGAACTGG + Intergenic
1180929844 22:19581941-19581963 AGGGTGGGGAAGCAGGGAATGGG + Intergenic
1181049268 22:20231040-20231062 GGCCTGGGGAAGCTGGGCCCAGG - Intergenic
1181458383 22:23071943-23071965 GGGCTGAGGGAGCTGGGAAGTGG + Intronic
1181754872 22:25016675-25016697 GGGCTGGGGAAGAGGGGAATGGG + Intronic
1181844369 22:25694754-25694776 GGTCAGGGGAGGCAGGGAAAGGG - Intronic
1182283505 22:29231365-29231387 GGTCGGGGGGAGCTGGGAGTGGG + Intronic
1182442676 22:30373413-30373435 GGTCGGGGGAAGCTGGCAGCAGG - Intronic
1182481044 22:30608899-30608921 GGTCTGGGGAATCTTGAACTGGG + Intronic
1182824642 22:33254217-33254239 GGCCTGGGGAAGCTGGAGGTGGG + Intronic
1183341578 22:37284611-37284633 GGCCTGGGGAAGCGGGGATTGGG + Intronic
1183463873 22:37969130-37969152 GGGCTGGGGAGGAGGGGAATTGG + Exonic
1184245901 22:43235590-43235612 GTTCTGGAGATGCTGGGAAGAGG + Intronic
1185129078 22:49027433-49027455 GGTCAGGGGATGCAGGGGATGGG - Intergenic
952217925 3:31296002-31296024 GGGCTGGGGAAGTGGAGAATGGG + Intergenic
953882232 3:46696614-46696636 GCTCTGGGGGAGCTGGGGGTAGG - Intergenic
954224753 3:49174409-49174431 GGCCTGGGGAATGTGGGAAGGGG + Intronic
954278745 3:49560570-49560592 CCTCTGGGTAAGCTGGGACTTGG + Intronic
954311195 3:49768834-49768856 GGGCTGGGGGAGGTGAGAATGGG + Intronic
954374146 3:50185392-50185414 GGGCTGGGGATGCTGGGGAAGGG - Intronic
954687040 3:52376699-52376721 GGGCTGGGGCAGGTGGGAAGGGG - Intronic
954705701 3:52479420-52479442 GCTCTTGGGCAGCTGGGACTAGG - Intronic
954737373 3:52717435-52717457 GGTCTGGGGAAGAGGTGATTTGG - Intronic
954741832 3:52758239-52758261 GGACTGGGGTAGTAGGGAATGGG + Intronic
954749147 3:52803998-52804020 AGCCTGGGGAAGGTGGGGATAGG + Exonic
955393002 3:58534925-58534947 GGTAAGGGGAAGCTGGGGAATGG - Exonic
956821252 3:72956317-72956339 CGTCTGGGGAAAATGGGAATGGG + Intronic
960001311 3:112734938-112734960 GGTCTGGGGAAGTGGTGAAGTGG - Intergenic
960699457 3:120426347-120426369 GGGCTTGGGAAGCTGGGGGTGGG - Intronic
961534194 3:127559531-127559553 GCTCTGGGGCAGGTGGGCATAGG - Intergenic
961662595 3:128477560-128477582 GGGCTGGGGCAGCTGGGACAAGG + Intergenic
962013917 3:131421385-131421407 GGTATGGGGAAGCAGGAAATGGG + Intergenic
962926607 3:139999412-139999434 CTTCTGGGGAACCTGGGAATGGG + Intronic
964801396 3:160563367-160563389 GGGCTGGGGTAGTTGGGAATTGG + Intronic
968665817 4:1821858-1821880 TGTCTGGGCAAGCTGGCAAAGGG + Intronic
968890030 4:3363888-3363910 GGGCGGGGGAAGCTGGGGAAGGG + Intronic
969544395 4:7815241-7815263 GGGCTGGGGGAGGAGGGAATGGG + Intronic
971251486 4:24976366-24976388 GGGCTGGAGAAGGTGGAAATGGG + Intronic
971350571 4:25852299-25852321 GGCGTGGGGAAGGTGGGAGTGGG - Intronic
972081583 4:35158280-35158302 GGTCTGGGGGTGAGGGGAATGGG + Intergenic
972740420 4:41881933-41881955 GGTCTGGGATAGTTGGGAAAGGG - Intergenic
972795902 4:42419526-42419548 GGGTTTGGAAAGCTGGGAATTGG + Intronic
976269479 4:83216932-83216954 GGGCTGGGGGAGAGGGGAATAGG + Intergenic
979745936 4:124213038-124213060 GCTCTGGGGAACCTGCAAATGGG + Intergenic
979791232 4:124783916-124783938 AATCTGGGGAAGCTTGGAAGAGG + Intergenic
980005175 4:127533475-127533497 GCTCTGGGAAAGTTGGGAAATGG - Intergenic
981453275 4:144924240-144924262 GGTCAGGGAAAGGTGGGGATGGG - Intergenic
981771034 4:148308582-148308604 GGTATGGGGAAGGGGGCAATTGG + Intronic
982446416 4:155495725-155495747 GCTCTGGTGCAGCAGGGAATAGG + Intergenic
985647097 5:1090116-1090138 GGCCTGGGGAGGATGGGAACAGG + Intronic
985664607 5:1175485-1175507 GGATTGGGGAGGCTGGGATTGGG + Intergenic
985746557 5:1651761-1651783 GGCCTGGGGAAGGTGGGGCTGGG + Intergenic
985863913 5:2496393-2496415 GGGCTCTGGAAGCTGGGAGTCGG - Intergenic
986904352 5:12475885-12475907 GGTCTGGAGAAGCTGCACATGGG + Intergenic
987191680 5:15484988-15485010 GGTCTGGGTACGCTGGGCCTGGG + Intergenic
987472805 5:18353492-18353514 GGGCTGGGGTAGTTGGGAGTGGG - Intergenic
990755538 5:59065322-59065344 GGCTGGGGGAAGATGGGAATTGG + Intronic
990872312 5:60445634-60445656 GGGCTGGGGAAGGGGGAAATGGG + Intronic
991590180 5:68242983-68243005 TGTCTGGGGACGGTGGGAAGAGG - Intronic
994660612 5:102649296-102649318 AGTCTGGGAAAGCAGGGAATAGG + Intergenic
994869987 5:105335452-105335474 GGTTTGGAGATGCTGGGAATAGG + Intergenic
995754084 5:115484197-115484219 TGTCTGGGGAAGCTGGAGATCGG - Intergenic
995903146 5:117093447-117093469 TGTCTGGGAAAGGTGGGAAGAGG - Intergenic
997345681 5:133190426-133190448 GGTCAGGGGCAAGTGGGAATAGG - Intergenic
997600862 5:135137493-135137515 GGCCTGGGGTAGCTTGGGATAGG + Intronic
998002129 5:138633693-138633715 GGGATGGGGATGGTGGGAATGGG - Intronic
998699105 5:144677157-144677179 GGCCTGGAGGAGCAGGGAATGGG + Intergenic
998802868 5:145888395-145888417 GGTCTGGGGAAGTAGGGATCGGG + Intergenic
1001052160 5:168422254-168422276 GGCCTGGTGTAGCTAGGAATAGG + Intronic
1001308699 5:170595107-170595129 TCTCTGGGGAAGCTAGGACTGGG - Intronic
1001678407 5:173537455-173537477 GTGCTGGGGAAGAGGGGAATAGG - Intergenic
1001701015 5:173706432-173706454 GGCCTGGGGAAGCTGGGCCCTGG - Intergenic
1002910576 6:1488174-1488196 GGGCTGGGGAAGCAGAGAGTGGG + Intergenic
1003060636 6:2859923-2859945 GGGCTGGGGAACACGGGAATGGG + Intergenic
1003118372 6:3298531-3298553 GGTGGGGGGAAACTGGGGATAGG + Intronic
1003540054 6:7010754-7010776 CCTCTGGGGAAGATTGGAATAGG - Intergenic
1004050483 6:12073459-12073481 GGTCTGGGGCAGCTGGAAATTGG - Intronic
1004077563 6:12358358-12358380 AGACTGGGGAAGAAGGGAATGGG - Intergenic
1004438486 6:15621903-15621925 GGTCTGGGGAAGCACAGAAGAGG - Intronic
1005991847 6:30908143-30908165 GCGCGGGGGATGCTGGGAATTGG - Intergenic
1006084414 6:31586309-31586331 GCTCTGGGTAAGCTGGGAATGGG + Intronic
1008014198 6:46500049-46500071 GGGCTGGGGGAGGTGGGAGTGGG + Intergenic
1008538889 6:52529265-52529287 GGTCTGGGAAAGCTGGGGGGAGG - Intronic
1009691741 6:67043473-67043495 GGGCTGGGGTGGCTGGGCATAGG - Intergenic
1010797404 6:80133551-80133573 CCTCTGGGGAAGCAGGGAGTGGG + Intronic
1013028856 6:106310700-106310722 GAGCTGGGGAAGCAGGGAATGGG - Intronic
1016081065 6:139856885-139856907 GCTCTGGGGCAGATGGAAATAGG - Intergenic
1018441211 6:163815057-163815079 GGTGTGGGGGAGCTGGCAAGAGG + Intergenic
1018915642 6:168130871-168130893 GTGCTGGGGCAGCAGGGAATTGG + Intergenic
1019051929 6:169190231-169190253 GGGCTTGGGAAGCTGGAGATGGG - Intergenic
1019557661 7:1640803-1640825 GGTCTGGGGCTGCTGGGCGTGGG - Intergenic
1019859223 7:3642032-3642054 GGTCTGGGGTAGCTGGTGATGGG - Exonic
1019870356 7:3755186-3755208 GGCCTGGGGAAGCCGGAAGTGGG + Intronic
1020269609 7:6586300-6586322 GGTCTGGGGGAGGAGGGAATGGG - Intronic
1021244649 7:18246511-18246533 AGTCTGAGGAAGGTGGGAATGGG - Intronic
1021290798 7:18842309-18842331 GGTCTGGGAAAGATGGTAGTAGG - Intronic
1021422379 7:20460313-20460335 GATCTGGAGAACTTGGGAATAGG - Intergenic
1022124056 7:27338728-27338750 GGGATGGTGAAGCTGGGCATAGG + Intergenic
1022417786 7:30192726-30192748 GGTCTGGGAAATCTTGGAAGAGG + Intergenic
1022516103 7:30975883-30975905 TGTCTGGGGATACTGGGAAAGGG + Intronic
1022839515 7:34149736-34149758 GGTCTTGGGAAAATGGGAGTTGG + Intronic
1022880587 7:34582768-34582790 GGGCTGGGGAAGGGAGGAATGGG + Intergenic
1023797800 7:43808233-43808255 TGTCTGGTGAAGCTGGAAAAGGG + Intergenic
1024557670 7:50617453-50617475 CCTCCGGGGAAGCTGGGAGTGGG - Intronic
1026522166 7:71127062-71127084 GGTCTGGGGAAGCGGGAGGTGGG - Intergenic
1027055154 7:75044640-75044662 GGACTGGGGCAGCTGGTGATAGG - Intronic
1030755410 7:113282055-113282077 GGTCAGGGAAAGCTGGGATCAGG + Intergenic
1031775108 7:125899220-125899242 GGTCAGGGGAAGAGGGAAATGGG - Intergenic
1032886244 7:136142120-136142142 GCTCTGAGGAAGCAGGAAATTGG + Intergenic
1033153568 7:138937221-138937243 GTTCTGGGGAAGATGGAAAAGGG - Intronic
1033542778 7:142372548-142372570 GGGGTGGGCAAGCTGAGAATAGG - Intergenic
1033557324 7:142500144-142500166 GGGGTGGGAAAGCTGAGAATGGG - Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034131085 7:148718378-148718400 GTTGTGGGGATGGTGGGAATGGG - Intronic
1034162516 7:149003763-149003785 GGTCTGCGGAAGGTGGGAGGAGG - Exonic
1034468088 7:151241642-151241664 GAACTGGGGAGGCTGGGAAAAGG + Exonic
1034676952 7:152898723-152898745 GGTGGGGGGCAGCTGGGAGTAGG + Intergenic
1034712767 7:153209127-153209149 GGGCTGGGGTAGAAGGGAATGGG - Intergenic
1034977084 7:155455070-155455092 GGGCCGGGGAAGCTGGGATGGGG - Intergenic
1036188510 8:6647739-6647761 GGTCTGCTGCAGCTGGGGATGGG + Intergenic
1036286432 8:7447654-7447676 GGTCAGGGGAAGCTGGGAAGAGG - Intronic
1036335044 8:7863874-7863896 GGTCAGGGGAAGCTGGGAAGAGG + Intronic
1036564737 8:9928892-9928914 GGTCTGGCCAAGTTGGAAATTGG + Intergenic
1036926174 8:12908309-12908331 GGTCTGGGGAATGGGGGAAATGG + Intergenic
1037291436 8:17353277-17353299 GGGCTGTGGTAGGTGGGAATGGG + Intronic
1037328299 8:17717263-17717285 GTTCTAGGGAAGGTGAGAATTGG - Intronic
1037498756 8:19465334-19465356 GGGCTGGGGAAGCAGGGACTGGG + Intronic
1037909229 8:22733789-22733811 GGTTTGGGGAGGGTGGGGATGGG + Intronic
1038493793 8:27987824-27987846 GCCCTGAGGAAGCTGGGAGTGGG - Intronic
1038613063 8:29071558-29071580 GGTCTGGGGAAGCAGGAACGTGG - Intronic
1038696031 8:29807231-29807253 GGTCTGAGCAGGCTGGCAATAGG + Intergenic
1038843905 8:31211359-31211381 GGTATGGGGAAGCTGTGGGTGGG - Intergenic
1039303063 8:36231144-36231166 GATCTGGGGAAGCTGAGGAAGGG - Intergenic
1042370372 8:67984811-67984833 CTTCTGGGAAGGCTGGGAATTGG - Intronic
1042796886 8:72673782-72673804 GGTCTGGGGGACATGGAAATGGG + Intronic
1044206097 8:89493490-89493512 TTTCTGGGGAAGTTGGAAATGGG - Intergenic
1044681365 8:94781567-94781589 GGCCTATGGAAGCAGGGAATTGG + Intronic
1045194484 8:99916373-99916395 GGTCTGGGGAAGGGTGGAATGGG - Intergenic
1045397707 8:101777399-101777421 GTACTGGGGAAGTTAGGAATGGG + Intronic
1047511729 8:125520818-125520840 GGTCTGGGGGTGCTGGGGAGGGG + Intergenic
1047719069 8:127621776-127621798 GGGCTGGGGGAGCAGAGAATGGG + Intergenic
1047921973 8:129644566-129644588 GGTATGGGCTAGCTGGGAGTTGG - Intergenic
1048042996 8:130748887-130748909 GGTCTGGGGCATTTGGAAATAGG + Intergenic
1048904703 8:139076374-139076396 GGTTTGGGGAAGCTGCCCATGGG - Intergenic
1049493663 8:142918042-142918064 GGTCTGAGGATGCTGAGAAAAGG + Intergenic
1050126426 9:2361043-2361065 AGTATGGGGCAGCTGGGGATAGG + Intergenic
1050483672 9:6112142-6112164 GGCCTGGGGAAGCTGGATGTGGG - Intergenic
1051372437 9:16370061-16370083 AGGCTGGAGAAGCTGGGAATGGG + Intergenic
1051629376 9:19127741-19127763 GGCCTGGGGAGGCTGGGAGTTGG + Intronic
1051905178 9:22086673-22086695 GGTCTGAGGCAGCTGGGATAGGG + Intergenic
1052053647 9:23879487-23879509 GGTCAGGGAAAGGAGGGAATAGG - Intergenic
1052717617 9:32136276-32136298 TGTCTGAGGAAGTTGGGAAGGGG - Intergenic
1053003949 9:34592202-34592224 GAGCTGGGGAGGCCGGGAATAGG - Intergenic
1053179250 9:35954099-35954121 GGACTGGGGACCCTGGGGATGGG + Intergenic
1053314165 9:37037628-37037650 GGTCTGGGGAAGAGGGGCATCGG - Intergenic
1054741293 9:68808392-68808414 GTGGTGGGGAAGCTGGGAGTCGG - Intronic
1055589641 9:77798387-77798409 TGTTTGGGGAAGCTGGGTAAAGG - Intronic
1055845521 9:80557914-80557936 GATCTGTAGAACCTGGGAATGGG - Intergenic
1055940043 9:81640859-81640881 GGTCAGGAGAAGGTGGGCATTGG - Intronic
1056953883 9:91067117-91067139 GCTCTGGGGCAGATGGGACTCGG + Intergenic
1057187376 9:93064400-93064422 GCTCTGGGGATGCTGGGAAGGGG + Intronic
1059395426 9:114031422-114031444 GGTCGGGGGGAGGTGGGAATTGG + Intronic
1059605929 9:115835898-115835920 AGTCTGTTGAAGCTGGAAATGGG - Intergenic
1059652330 9:116326388-116326410 GGGCTGGGGAAGCTGCTTATAGG + Intronic
1060408373 9:123383801-123383823 GGTCAGGGGGAGCTGGGACAGGG + Exonic
1060591726 9:124821070-124821092 GGTCAGGGGCAGCTGGGAGAGGG - Intergenic
1060897095 9:127225091-127225113 GGTCTGGGCAGGCTGGGGTTCGG + Intronic
1061058038 9:128234729-128234751 GAGCTGGGGGAGCAGGGAATGGG - Intronic
1061161150 9:128895004-128895026 GGCCTGGGGGAGCAGGAAATGGG - Intronic
1061257125 9:129459633-129459655 GGACTGGAGATGCTGGGGATGGG - Intergenic
1061408617 9:130406168-130406190 GGTCTGGGTCTGCTGGGCATGGG + Intronic
1061828743 9:133277169-133277191 CGCCTGGGGAAGGCGGGAATGGG + Intergenic
1062160452 9:135076754-135076776 GGTCAGGGGCAGCTGGGGCTTGG - Intronic
1062273643 9:135720826-135720848 GCTCTGGGGAAGCTAGGGCTGGG + Intronic
1062377349 9:136268082-136268104 GGCCAGGGGAAGCTGGGAGAGGG + Intergenic
1186015425 X:5186353-5186375 GAAATGGGGAAGCTGGAAATTGG + Intergenic
1186446742 X:9636135-9636157 GGCCTGGGGGAGGAGGGAATGGG + Intronic
1187049254 X:15679811-15679833 GGGTTGGGGTAGGTGGGAATGGG - Intergenic
1187369801 X:18695595-18695617 GGTCTGGGTAAGATGGAAAAGGG - Intronic
1189405306 X:40716990-40717012 GGTTAGGAGAAGCTGGGAAGGGG + Intronic
1189715967 X:43866550-43866572 GGGCTGGGGAAGAAGGGAATGGG + Intronic
1190322243 X:49186126-49186148 GGTCTGGGAATGCAGGGGATGGG + Intronic
1190596245 X:52054472-52054494 GCCCTGGGGAAGCTGGGAGCAGG - Intergenic
1190612579 X:52199601-52199623 GCCCTGGGGAAGCTGGGAGCAGG + Intergenic
1192059814 X:67812500-67812522 GGTCTGGGAAATATGGGAAAGGG + Intergenic
1192148657 X:68698372-68698394 GGTCTGCCGATGCTGGGTATGGG + Intronic
1195927655 X:110042189-110042211 GGCCTGGGGAAGGTAAGAATTGG - Intronic
1196220154 X:113104316-113104338 CTTCTGGGGAAGCTGGGGAAAGG + Intergenic
1197121486 X:122898346-122898368 GGCCTGGGGTAGTGGGGAATTGG - Intergenic
1197745663 X:129931384-129931406 GGGCTTGGAAGGCTGGGAATGGG - Intergenic
1198233402 X:134714643-134714665 GGGCTGGGAAAGAGGGGAATGGG - Intronic
1200228240 X:154431212-154431234 GGCCAGAGGAAGCTGGGGATGGG + Intronic
1200405906 Y:2811292-2811314 AGTCTGGGGAAGCTTGAACTGGG - Intergenic