ID: 1119866649

View in Genome Browser
Species Human (GRCh38)
Location 14:77980319-77980341
Sequence TCCTCCCCAGGTTGGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119866649_1119866652 -10 Left 1119866649 14:77980319-77980341 CCATCAGTCCAACCTGGGGAGGA No data
Right 1119866652 14:77980332-77980354 CTGGGGAGGATGCCGTGACTTGG No data
1119866649_1119866654 -4 Left 1119866649 14:77980319-77980341 CCATCAGTCCAACCTGGGGAGGA No data
Right 1119866654 14:77980338-77980360 AGGATGCCGTGACTTGGGCCAGG No data
1119866649_1119866656 12 Left 1119866649 14:77980319-77980341 CCATCAGTCCAACCTGGGGAGGA No data
Right 1119866656 14:77980354-77980376 GGCCAGGCAGCTCTCTTCAGCGG No data
1119866649_1119866653 -9 Left 1119866649 14:77980319-77980341 CCATCAGTCCAACCTGGGGAGGA No data
Right 1119866653 14:77980333-77980355 TGGGGAGGATGCCGTGACTTGGG No data
1119866649_1119866658 15 Left 1119866649 14:77980319-77980341 CCATCAGTCCAACCTGGGGAGGA No data
Right 1119866658 14:77980357-77980379 CAGGCAGCTCTCTTCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119866649 Original CRISPR TCCTCCCCAGGTTGGACTGA TGG (reversed) Intergenic
No off target data available for this crispr