ID: 1119869708

View in Genome Browser
Species Human (GRCh38)
Location 14:78006314-78006336
Sequence TGCAGTGGCAAGGATATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119869708_1119869712 -2 Left 1119869708 14:78006314-78006336 CCCTTTATATCCTTGCCACTGCA No data
Right 1119869712 14:78006335-78006357 CATGAAATGTATTTTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119869708 Original CRISPR TGCAGTGGCAAGGATATAAA GGG (reversed) Intergenic
No off target data available for this crispr