ID: 1119870965

View in Genome Browser
Species Human (GRCh38)
Location 14:78016739-78016761
Sequence TTCTCCATGCATGAGCAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119870961_1119870965 26 Left 1119870961 14:78016690-78016712 CCCTGATGTGTGAGTTTAGCCAA No data
Right 1119870965 14:78016739-78016761 TTCTCCATGCATGAGCAATTAGG No data
1119870963_1119870965 7 Left 1119870963 14:78016709-78016731 CCAAGATTGTCAAAGCTATCTAG No data
Right 1119870965 14:78016739-78016761 TTCTCCATGCATGAGCAATTAGG No data
1119870962_1119870965 25 Left 1119870962 14:78016691-78016713 CCTGATGTGTGAGTTTAGCCAAG No data
Right 1119870965 14:78016739-78016761 TTCTCCATGCATGAGCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119870965 Original CRISPR TTCTCCATGCATGAGCAATT AGG Intergenic
No off target data available for this crispr