ID: 1119873527

View in Genome Browser
Species Human (GRCh38)
Location 14:78036963-78036985
Sequence GAGGCCAAGGCAGGATCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119873527_1119873531 -10 Left 1119873527 14:78036963-78036985 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1119873531 14:78036976-78036998 CCTTGGCCTCCCAAAGAGCTGGG 0: 522
1: 87296
2: 214935
3: 250695
4: 273867
1119873527_1119873534 -2 Left 1119873527 14:78036963-78036985 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1119873534 14:78036984-78037006 TCCCAAAGAGCTGGGGTTACAGG 0: 29
1: 5972
2: 302203
3: 326249
4: 304826
1119873527_1119873532 -9 Left 1119873527 14:78036963-78036985 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1119873532 14:78036977-78036999 CTTGGCCTCCCAAAGAGCTGGGG 0: 9
1: 1605
2: 3942
3: 5356
4: 6686
1119873527_1119873537 22 Left 1119873527 14:78036963-78036985 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1119873537 14:78037008-78037030 GTGAGCCACCATGCCCAGCCAGG 0: 419
1: 1692
2: 4732
3: 8417
4: 10293
1119873527_1119873539 29 Left 1119873527 14:78036963-78036985 CCTCGTGATCCTGCCTTGGCCTC No data
Right 1119873539 14:78037015-78037037 ACCATGCCCAGCCAGGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119873527 Original CRISPR GAGGCCAAGGCAGGATCACG AGG (reversed) Intergenic
No off target data available for this crispr