ID: 1119879391

View in Genome Browser
Species Human (GRCh38)
Location 14:78088350-78088372
Sequence GCTATGAGCAGAGCCCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119879383_1119879391 19 Left 1119879383 14:78088308-78088330 CCAAAGGAAGCTTCCAATGCCAT No data
Right 1119879391 14:78088350-78088372 GCTATGAGCAGAGCCCTTCTGGG No data
1119879386_1119879391 6 Left 1119879386 14:78088321-78088343 CCAATGCCATCATGGTGTCTGGG No data
Right 1119879391 14:78088350-78088372 GCTATGAGCAGAGCCCTTCTGGG No data
1119879388_1119879391 0 Left 1119879388 14:78088327-78088349 CCATCATGGTGTCTGGGTGCGAG No data
Right 1119879391 14:78088350-78088372 GCTATGAGCAGAGCCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119879391 Original CRISPR GCTATGAGCAGAGCCCTTCT GGG Intergenic
No off target data available for this crispr