ID: 1119879999

View in Genome Browser
Species Human (GRCh38)
Location 14:78092402-78092424
Sequence AGTCAAACTGGCAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119879999_1119880007 17 Left 1119879999 14:78092402-78092424 CCATCCAGCCTGCCAGTTTGACT No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119879999_1119880011 24 Left 1119879999 14:78092402-78092424 CCATCCAGCCTGCCAGTTTGACT No data
Right 1119880011 14:78092449-78092471 CTCATCTCTCTGAAGGCCAGTGG No data
1119879999_1119880012 29 Left 1119879999 14:78092402-78092424 CCATCCAGCCTGCCAGTTTGACT No data
Right 1119880012 14:78092454-78092476 CTCTCTGAAGGCCAGTGGTCTGG No data
1119879999_1119880013 30 Left 1119879999 14:78092402-78092424 CCATCCAGCCTGCCAGTTTGACT No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119879999 Original CRISPR AGTCAAACTGGCAGGCTGGA TGG (reversed) Intergenic